ID: 1022262373

View in Genome Browser
Species Human (GRCh38)
Location 7:28718833-28718855
Sequence TGGCATTGTAGGGTTGGGCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 213}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022262373 Original CRISPR TGGCATTGTAGGGTTGGGCA GGG (reversed) Exonic
900513727 1:3071731-3071753 GGGGACTGTGGGGTTGGGCAGGG + Intronic
901180218 1:7336546-7336568 TGTGATTGCAGGGGTGGGCAGGG + Intronic
901684738 1:10937615-10937637 GGGCAGTGTAGGGCTGGGCCCGG - Intergenic
902651125 1:17838320-17838342 GGGCAGAGTGGGGTTGGGCAGGG - Intergenic
905683273 1:39889836-39889858 CGGCTTTTTAGGGCTGGGCATGG + Intergenic
905807498 1:40887407-40887429 AGCCATTGCAGGTTTGGGCAGGG + Intergenic
906203731 1:43975842-43975864 TGGCATGGTAAGGGAGGGCAGGG + Exonic
906488938 1:46252575-46252597 TGGGATTTTAGGCTTTGGCAAGG + Intronic
906710986 1:47929916-47929938 GGGCATTGGGGGGCTGGGCAAGG - Intronic
908573068 1:65429419-65429441 AGGCTTTGTAGGCTAGGGCAAGG + Intronic
908701146 1:66902121-66902143 TGGTATTGTAGGGCCAGGCATGG - Intronic
910387284 1:86698753-86698775 TGGCATTGTAGGGCCGGGCGCGG + Intergenic
912765714 1:112408383-112408405 TGGCATTTAAGGGTTAGGCTAGG - Intronic
914453406 1:147813176-147813198 TTGCTTTGTAGGGTGAGGCAAGG + Intergenic
917442032 1:175076751-175076773 TGGCATTGTGGGGATGAGCATGG + Intronic
920444115 1:206002740-206002762 TGGCATTGCAGCACTGGGCAAGG + Intronic
920501567 1:206488551-206488573 TGCCATTGTGGGGTAGTGCAAGG + Intronic
922280654 1:224120570-224120592 TGTCATTGTAGGGCTGGGCGTGG + Intronic
922722887 1:227907698-227907720 TGGCATGGTTTGCTTGGGCATGG - Intergenic
922774554 1:228208717-228208739 TGTCAGTGTAGGGGTGGGGAGGG + Intronic
923448504 1:234094692-234094714 TGGCATTATAGGATTCGGCAGGG + Intronic
1064982932 10:21182179-21182201 ATTCATTTTAGGGTTGGGCACGG + Intergenic
1065572012 10:27080886-27080908 TGGACATGTAGGGTAGGGCAGGG - Intronic
1065842325 10:29712884-29712906 TGCAATGGTAGGGCTGGGCACGG + Intronic
1066466143 10:35652011-35652033 TGTAATTGTAAGGCTGGGCACGG - Intergenic
1067136595 10:43613921-43613943 AGACATTTTAGGGCTGGGCATGG + Intronic
1069380597 10:67840213-67840235 TGGAATGTTAGGGCTGGGCATGG + Intergenic
1069505390 10:68992907-68992929 TGTCACAGTAGGGTTGGGGAGGG + Intronic
1069867351 10:71511972-71511994 TGGCAGTGAAGGGTTGGGATGGG + Intronic
1071223069 10:83492537-83492559 TGGCATTGTAGCTTTTGTCATGG - Intergenic
1072290569 10:93961147-93961169 AGGCATTGTAGTGATGAGCAGGG + Intergenic
1072763515 10:98078009-98078031 TGAATTTGTAGGGTGGGGCAGGG - Intergenic
1073186569 10:101618703-101618725 TGGGATTGTGGGGTGGGGAAAGG - Intronic
1075015032 10:118904159-118904181 TGGCAGTGTGGGGCTAGGCAGGG - Intergenic
1075173827 10:120141079-120141101 TGTCATTGTCAGTTTGGGCAAGG + Intergenic
1075326302 10:121534683-121534705 TGCCATTTTGGGGCTGGGCATGG - Intronic
1075731122 10:124637423-124637445 TGGCTTTGCAGGGTAGGGCAGGG - Intronic
1075742999 10:124707057-124707079 TGGCATGGCAGGGGTGGGCGGGG - Intronic
1076032733 10:127173308-127173330 TGGCACTGAGGGCTTGGGCAAGG - Intronic
1076872811 10:133201914-133201936 TGGCACTGCCGGGTGGGGCAGGG + Intronic
1077868959 11:6245431-6245453 TGTCATGGTAGGGCTGGGCCAGG - Intergenic
1082660757 11:55908026-55908048 TGGCATTTGAGGTTGGGGCATGG + Intergenic
1083146378 11:60762782-60762804 TGGCATTTGAGGTTGGGGCATGG + Intronic
1083894483 11:65613366-65613388 CGGCATTGGAGGCTTTGGCAAGG - Exonic
1086387753 11:86326933-86326955 TGGTATTTTAGAGCTGGGCATGG + Intronic
1087225392 11:95592963-95592985 TGGCATTGTATGGATGTGCGTGG - Intergenic
1087227485 11:95618421-95618443 TGGCAGTGATGGGCTGGGCAAGG - Intergenic
1089378726 11:118012861-118012883 TGCCCTTGTAGGGTTGACCAGGG - Intergenic
1090817131 11:130308014-130308036 TGGTATTACAGGGTTGCGCACGG - Intronic
1091476318 12:776794-776816 TTGCATTGTATGGTTGTCCAAGG + Intronic
1091479119 12:808395-808417 TGGCAAACTAGGGCTGGGCATGG - Intronic
1095524408 12:43108282-43108304 TGGCATGGTGGAGTTGGGCTTGG + Intergenic
1096573205 12:52536491-52536513 GAGTATTGTAGGGCTGGGCACGG + Intergenic
1098070084 12:66664505-66664527 TAGCATTTGAGGGTTAGGCAGGG - Intronic
1099142526 12:78996688-78996710 TGGATTTGTAGGGTGTGGCATGG - Intronic
1099376355 12:81899512-81899534 TGGCATTGTGGACGTGGGCAAGG - Intergenic
1102245807 12:111355013-111355035 TGGCTCAGTAGGTTTGGGCAGGG - Intergenic
1103127132 12:118433431-118433453 TGGAATGGTACGGTTGGGGAAGG - Intergenic
1103687069 12:122740593-122740615 AGGCATTGGAGTGTTGCGCAAGG - Intergenic
1104043921 12:125148192-125148214 TGGGATTGTGGTGCTGGGCATGG + Intergenic
1107074140 13:36302870-36302892 AGGCATTGAAGGGATGGGGAGGG - Exonic
1108632626 13:52301876-52301898 TGGCTTTGTGGGGCTGGCCATGG + Intergenic
1108654073 13:52510717-52510739 TGGCTTTGTGGGGCTGGCCATGG - Intergenic
1112394184 13:99013561-99013583 GGGCATTTTAGGGTTAAGCAGGG + Intronic
1113071439 13:106425280-106425302 TAGCATTGTATTGTTGGGGAAGG + Intergenic
1119417836 14:74486376-74486398 TGGCAGGGTTGGGTGGGGCATGG + Exonic
1119845282 14:77824722-77824744 AGGCATTTTGGGGCTGGGCATGG - Intronic
1120381955 14:83791833-83791855 AGGCATTGTTAGGCTGGGCATGG - Intergenic
1120771801 14:88387188-88387210 TCCCATGGTAGGGATGGGCAGGG + Intronic
1121581725 14:95037032-95037054 TGGCATTGTAGGGGGAGCCAAGG - Intergenic
1125251773 15:37713277-37713299 TGGCATTGTGAGGCTGTGCAGGG - Intergenic
1128606916 15:69043499-69043521 TGGCAAGGTAGGGTTGGGCCAGG - Intronic
1129678962 15:77647191-77647213 TGGAAGTCTAGGGATGGGCAGGG + Intronic
1130331006 15:82922297-82922319 TGGCATTATAGGGAAGGCCATGG - Intronic
1131087779 15:89591412-89591434 TGGCTTTGTATGGTTGGGTACGG - Intronic
1132205934 15:99986141-99986163 AGGCCTTGCAGGGTGGGGCAGGG + Intronic
1132496759 16:266959-266981 TGGCCATGGAGGGGTGGGCAGGG + Intronic
1132958576 16:2609859-2609881 TGGCAGTGAAGGGCTGGGCTTGG - Intergenic
1133466575 16:6033022-6033044 AGGTAGTGTAGGGTTGGGTATGG + Intronic
1136165738 16:28451765-28451787 TGGCATCGCAGGGCTGGCCATGG - Intergenic
1136197234 16:28663244-28663266 TGGCATCGCAGGGCTGGCCATGG + Intergenic
1136213573 16:28777391-28777413 TGGCATCGCAGGGCTGGCCATGG + Intergenic
1136258306 16:29057315-29057337 TGGCATCGCAGGGCTGGCCATGG + Intergenic
1136320189 16:29479001-29479023 TGGCATCGCAGGGCTGGCCATGG - Intergenic
1136434760 16:30218342-30218364 TGGCATCGCAGGGCTGGCCATGG - Intergenic
1137243941 16:46687718-46687740 TGGAATTTTAGGGCTGGGAAGGG + Intronic
1137295355 16:47087312-47087334 TGTAATTATAGGGCTGGGCACGG - Intronic
1137878652 16:52022604-52022626 TTGCATTGTATGTGTGGGCATGG - Intronic
1139211123 16:65078050-65078072 TGGCATAGTAGGGGAGGGTAAGG - Intronic
1139372428 16:66477368-66477390 TGCCATTGTCGTGTTGGGCATGG - Intronic
1139595844 16:67957865-67957887 TGGCGTGGGAGGGTTGGGCTGGG - Intronic
1140258947 16:73360627-73360649 TGGCTTTATACGGCTGGGCATGG - Intergenic
1140765692 16:78154752-78154774 TGACATAGTAGGGTTTGACATGG + Intronic
1140791861 16:78399503-78399525 TGGCATTGTTGGGTTGAACAGGG + Intronic
1141150275 16:81559855-81559877 AGGCATTGTGGGGCTGGGCGTGG + Intronic
1141223693 16:82094995-82095017 TGGCATGGGAGGGATGGGTAGGG + Intronic
1143258759 17:5583416-5583438 TGGCATTGTAGTTATGAGCACGG - Intronic
1144783072 17:17817454-17817476 TTGCCTGGTGGGGTTGGGCAGGG + Exonic
1145200148 17:20937847-20937869 GGGCATCGTGTGGTTGGGCACGG + Intergenic
1145805276 17:27722835-27722857 TGGCATTGAAGGGTTCCACAGGG - Intergenic
1145865733 17:28240482-28240504 TGGCCTTGAAGGTTGGGGCAGGG - Intergenic
1145939046 17:28732161-28732183 TTGCATTCTGGGGCTGGGCATGG + Intronic
1146874385 17:36396772-36396794 TGGCATTGAAGGGTTCCACAGGG - Intronic
1146881741 17:36447687-36447709 TGGCATTGAAGGGTTCCACAGGG - Intergenic
1147065001 17:37916099-37916121 TGGCATTGAAGGGTTCCACAGGG + Intergenic
1149692655 17:58590843-58590865 TGAAATTGTTGGGCTGGGCAAGG - Intronic
1150129516 17:62659748-62659770 TGGGAATGTAGGTTGGGGCAGGG - Intronic
1150495806 17:65607077-65607099 TGGGATGGTGGTGTTGGGCAGGG + Intronic
1152323328 17:79621387-79621409 TGGCTTTGCAGGGTTGCTCAGGG - Intergenic
1153745802 18:8178491-8178513 TGGCTTTGATGGGCTGGGCACGG + Intronic
1154129816 18:11727162-11727184 GGGCCTTGCAGGGCTGGGCAGGG - Intronic
1154414735 18:14170872-14170894 GGGCAGTGTTGGGCTGGGCAGGG + Intergenic
1157765967 18:50297921-50297943 TGGCTTTGCAGGGTGTGGCAAGG - Intergenic
1161479214 19:4502354-4502376 TGGCCTTTCAGGGTTGGGCTGGG - Exonic
1162858119 19:13484790-13484812 TGCTATTGTAGGGGTGGGAATGG - Intronic
1163049671 19:14672901-14672923 TAGGATTCCAGGGTTGGGCATGG - Intronic
1165334558 19:35160295-35160317 TGTCACTGTAGGGTTGGGAAGGG - Intronic
1167478418 19:49713912-49713934 TGGCCTTGGAGGGTTGGGTTTGG - Intergenic
1168513537 19:56992588-56992610 TGGCACTGGAGGCTGGGGCAAGG - Intergenic
925807831 2:7669439-7669461 TAGCCTAGTAGGGGTGGGCAAGG + Intergenic
926046544 2:9714138-9714160 TGGCAATATAGGGCCGGGCATGG + Intergenic
927673886 2:25090625-25090647 CGGCCTTTTAGAGTTGGGCAGGG - Intronic
927850265 2:26494421-26494443 TGGCACTGTGAGGTTGGACAAGG + Intronic
929893079 2:45935494-45935516 TTGCAGCTTAGGGTTGGGCACGG + Intronic
929908723 2:46070351-46070373 TGGCATTTTATGGCTGGGCGCGG + Intronic
933762807 2:85684828-85684850 TGGCTTTGAAGGGATGGACAGGG + Intergenic
936027835 2:109047000-109047022 TGGCACTGCAGGGCAGGGCAGGG - Intergenic
937365304 2:121257056-121257078 TGACAGTGTAGGGTTGGGCCAGG - Intronic
939646589 2:144707025-144707047 TAGTAATGTAGGGCTGGGCATGG + Intergenic
943037811 2:182767953-182767975 TGGCATTTGAGGTTGGGGCATGG - Intronic
947263811 2:228253986-228254008 TGAGATCGTGGGGTTGGGCAGGG - Intergenic
947616903 2:231563655-231563677 TGTCTTGGTAGGGTTGGGCAGGG - Intergenic
948983596 2:241507586-241507608 TGGCCGTGTTGGGCTGGGCAGGG - Intronic
1173006734 20:39145565-39145587 TGGCTGTGTGGTGTTGGGCAAGG + Intergenic
1174364266 20:50047013-50047035 AGGCTTTGAAGGGCTGGGCAAGG - Intergenic
1175704715 20:61168153-61168175 TGCCCTTGTCGAGTTGGGCATGG - Intergenic
1175953964 20:62598792-62598814 TGGCTGTGTTGGGTTGGGCGTGG + Intergenic
1176858285 21:13987382-13987404 GGGCAGTGTTGGGCTGGGCAGGG - Intergenic
1179496594 21:41775729-41775751 TGGCATTGGACATTTGGGCAAGG + Intergenic
1179984606 21:44913584-44913606 TGGCATTGGGGGGTGGGGCAGGG - Intronic
1181862619 22:25830618-25830640 TGTCCTTGTAGTGCTGGGCAGGG + Intronic
1182802023 22:33039268-33039290 TGGCATAGTAGCTTTGAGCATGG - Intronic
949497591 3:4647466-4647488 TGGCATGGTATGGTATGGCATGG + Intronic
950536684 3:13582940-13582962 AGGCCTGGCAGGGTTGGGCAGGG + Intronic
950758950 3:15203305-15203327 TGGGTCAGTAGGGTTGGGCAGGG - Intergenic
953027895 3:39155124-39155146 TGGCATTGAAGGGGGGGGAAGGG - Intergenic
953222173 3:40982123-40982145 AGACATTGTCGGGCTGGGCATGG - Intergenic
953554393 3:43931955-43931977 TTGCATTATGGGGCTGGGCACGG + Intergenic
954332736 3:49899487-49899509 GGGCATGGCAGGGTGGGGCAGGG - Intronic
955326959 3:58015969-58015991 GGGCAGTGGAGGGGTGGGCAGGG + Intronic
955424433 3:58772934-58772956 TAGAAATGTAGGGTTGGGCATGG + Intronic
961744051 3:129052327-129052349 TGTCATTGTTGAGCTGGGCATGG + Intergenic
965789333 3:172371117-172371139 TGGATTTGTGGGGGTGGGCAAGG - Intronic
966979012 3:185113152-185113174 TGGCAATGTAGGGCCAGGCATGG + Intronic
968625293 4:1624160-1624182 TGGCATTGTGGGCATGGGCATGG + Intronic
968726079 4:2248384-2248406 AGGCACTGGAGGGTGGGGCAGGG + Exonic
969624490 4:8295390-8295412 TGGCAATCTAGGAGTGGGCAGGG - Intronic
971197441 4:24482940-24482962 TGGCTTGTTAGGGTTGGACAGGG + Intergenic
972349789 4:38225975-38225997 TGGCATTCCAAGGCTGGGCATGG - Intergenic
972977493 4:44654667-44654689 AGGCAGTGTTGGGTTGGGAAGGG - Intronic
978732121 4:112039930-112039952 TAGCTTTTTAGGGTTGGGGATGG - Intergenic
980539688 4:134177462-134177484 TGGGACTGCTGGGTTGGGCACGG - Intergenic
981350455 4:143723438-143723460 AGCCATTGTAGGGCAGGGCACGG + Intergenic
981671270 4:147289696-147289718 TGGCAAGGTAAGGCTGGGCATGG + Intergenic
983473778 4:168189629-168189651 CTGCACTTTAGGGTTGGGCATGG + Intergenic
987558328 5:19484373-19484395 TGACATTGTGGTGTTGAGCAGGG - Intronic
988792343 5:34620185-34620207 TGGCTTTGGGTGGTTGGGCAGGG + Intergenic
992980642 5:82167893-82167915 TGTCATTGTAGGTTTGGGAGAGG + Intronic
994510571 5:100698256-100698278 TGGCATTGGATGGCTGGGCTTGG + Intergenic
995076441 5:107990239-107990261 TGGGATAGTAGGGATGGGTATGG + Intronic
998488387 5:142523752-142523774 TAGCAGTGTGGGGTTGGGCGTGG - Intergenic
999107544 5:149086980-149087002 TGGCAATGTAGGGGTGGCCAGGG + Intergenic
999608841 5:153347505-153347527 TGGCATTGTAGGGTGGCAGAAGG - Intergenic
999647260 5:153730313-153730335 TGGAGTTATAGGGGTGGGCAAGG - Intronic
999656012 5:153811274-153811296 TGGCACTGAAGGGTTTGGGATGG - Exonic
999729502 5:154466009-154466031 GGTCATAGCAGGGTTGGGCATGG - Intergenic
1001510295 5:172316027-172316049 GGGCATTGTGGGGGTGTGCAGGG - Intergenic
1002143666 5:177161430-177161452 TGACATTGGAGGGGTAGGCAAGG + Intronic
1002991143 6:2239987-2240009 TGGCATTATTGGGCTGGGCGTGG - Intronic
1003653790 6:7986884-7986906 AGGCATTGTAGTGATGAGCAGGG - Intronic
1004430591 6:15538987-15539009 TGGGAATGTGGGGATGGGCAGGG - Intronic
1005465511 6:26108891-26108913 TGGGGATGTAGGGGTGGGCAGGG - Intergenic
1008115388 6:47543615-47543637 TTGTATTGGAGGGTTGGGGAGGG + Intronic
1013199694 6:107881388-107881410 AGGCATTGTAAGGATGAGCAGGG - Intronic
1013664676 6:112335371-112335393 TGGCCTTGTAGGCTTGTGTAAGG + Intergenic
1014204479 6:118642621-118642643 AGGCTTTCTTGGGTTGGGCACGG + Intronic
1014284525 6:119481657-119481679 TGGTATTGTAGGGACAGGCAGGG + Intergenic
1015536335 6:134270917-134270939 TGGCAGTGTAGGGTGGGGTGGGG - Intronic
1016712797 6:147192679-147192701 TGGCTATGTTGGGATGGGCAAGG + Intergenic
1018129769 6:160717959-160717981 ATTCATTGTAGGGCTGGGCACGG + Intronic
1019930229 7:4217758-4217780 AGGCTTTGTAGTGCTGGGCATGG + Intronic
1022253249 7:28629585-28629607 TGGCCTTCTAGGGTTAGGAAGGG + Intronic
1022262373 7:28718833-28718855 TGGCATTGTAGGGTTGGGCAGGG - Exonic
1022622034 7:31994507-31994529 TGGCAATCTTGGGGTGGGCAGGG - Intronic
1026442509 7:70456738-70456760 TGGGATTGAAGGGCTGGGGATGG - Intronic
1028242950 7:88443524-88443546 TGGCATTCTAGGAGAGGGCATGG + Intergenic
1029550968 7:101236932-101236954 TGGGATTGCTGGGGTGGGCAGGG - Intronic
1030280629 7:107770991-107771013 GAGCATTATAGGGATGGGCAAGG + Intronic
1031441057 7:121795188-121795210 TGGCCTTGTAGGCCTGGGTAAGG - Intergenic
1034732054 7:153396450-153396472 TGACATTCCTGGGTTGGGCAGGG - Intergenic
1034901425 7:154910152-154910174 TGGCATTCTGGGGTTGTGCTGGG - Intergenic
1037570282 8:20152043-20152065 TGGGATTTCAGGGTTGGGGAAGG + Intronic
1041246232 8:55891017-55891039 TTCCATTGTATGGCTGGGCACGG - Intronic
1041248995 8:55916740-55916762 TGCCATTGCAGTATTGGGCATGG - Intronic
1041811085 8:61911170-61911192 TGGCTTTGAACGGTTGGGGACGG - Intergenic
1045299681 8:100900279-100900301 TGGCTTTGGAGGGTTTGGCCAGG + Intergenic
1045471279 8:102514412-102514434 TGGAATTGTAGGGGAGAGCAGGG + Intergenic
1045521552 8:102907323-102907345 TCGGATTGTAGGATTGGGCTTGG + Intronic
1045547878 8:103143995-103144017 TGGAATCGTTGGGTTGGGCCAGG - Intronic
1046290991 8:112160729-112160751 GAGTATTGTAGGGTTGGGAAAGG - Intergenic
1048049486 8:130803927-130803949 TGGCTAGGTAGGGCTGGGCAGGG + Intronic
1049328748 8:142038624-142038646 TGGCACTCCAGGGTTGGCCATGG + Intergenic
1050629757 9:7546003-7546025 TGGGATTGGAGGGTTGAGTAAGG + Intergenic
1052493725 9:29199277-29199299 TGGCTTTCTGTGGTTGGGCAGGG - Intergenic
1054161527 9:61674898-61674920 GGGCATTGGAGGGTTGGGGGTGG - Intergenic
1056750904 9:89350382-89350404 TGGCAAACTATGGTTGGGCAGGG + Intronic
1059403111 9:114082849-114082871 TAGCAGGGTAGGGATGGGCAAGG - Intergenic
1185882897 X:3757101-3757123 TGCAATTATAGGGCTGGGCACGG - Intergenic
1189224245 X:39399122-39399144 TGGCACTGGAGGGAGGGGCAAGG - Intergenic
1189428239 X:40922372-40922394 TGGCATTTGAGGTTGGGGCATGG + Intergenic
1190334074 X:49252099-49252121 TGACATTTCAGGGTTGGGGAAGG + Intronic
1190818800 X:53953348-53953370 TGGGATCCTAGGGCTGGGCACGG + Intronic
1191609691 X:63099483-63099505 TGGCAGGGTAGTGTAGGGCAAGG + Intergenic
1191779271 X:64848734-64848756 TGGCAATGTAGGCATGGACAGGG - Intergenic
1192017453 X:67346982-67347004 TGACATTTTAGAGTTGGGCATGG - Intergenic
1193131513 X:77925020-77925042 AGGAATTGAAGGGTTGGGTATGG + Intronic
1197965921 X:132061689-132061711 TGACATTGTAGTGTGGGGAATGG - Intergenic
1198213537 X:134536463-134536485 TGGCAGAGCAGGGTTGGGGAGGG + Intergenic
1198605229 X:138330382-138330404 TGGGTTTGCAGGGTTGGGAAGGG - Intergenic
1199415921 X:147583085-147583107 TCCCAAAGTAGGGTTGGGCAAGG + Intergenic
1200093383 X:153646316-153646338 TGGCATTCTGACGTTGGGCAGGG + Intronic