ID: 1022265209

View in Genome Browser
Species Human (GRCh38)
Location 7:28746908-28746930
Sequence TAGGGCAGGAAGGCTGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 373
Summary {0: 1, 1: 0, 2: 0, 3: 33, 4: 339}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022265199_1022265209 20 Left 1022265199 7:28746865-28746887 CCCTGAGAAAACGTTATTGGTTC 0: 1
1: 0
2: 0
3: 8
4: 96
Right 1022265209 7:28746908-28746930 TAGGGCAGGAAGGCTGATGAAGG 0: 1
1: 0
2: 0
3: 33
4: 339
1022265203_1022265209 -3 Left 1022265203 7:28746888-28746910 CCAGACGTTTCTTAGGCTCCTAG 0: 1
1: 0
2: 0
3: 2
4: 69
Right 1022265209 7:28746908-28746930 TAGGGCAGGAAGGCTGATGAAGG 0: 1
1: 0
2: 0
3: 33
4: 339
1022265200_1022265209 19 Left 1022265200 7:28746866-28746888 CCTGAGAAAACGTTATTGGTTCC 0: 1
1: 0
2: 2
3: 10
4: 70
Right 1022265209 7:28746908-28746930 TAGGGCAGGAAGGCTGATGAAGG 0: 1
1: 0
2: 0
3: 33
4: 339
1022265198_1022265209 21 Left 1022265198 7:28746864-28746886 CCCCTGAGAAAACGTTATTGGTT 0: 1
1: 0
2: 0
3: 5
4: 85
Right 1022265209 7:28746908-28746930 TAGGGCAGGAAGGCTGATGAAGG 0: 1
1: 0
2: 0
3: 33
4: 339
1022265202_1022265209 -2 Left 1022265202 7:28746887-28746909 CCCAGACGTTTCTTAGGCTCCTA 0: 1
1: 0
2: 0
3: 6
4: 145
Right 1022265209 7:28746908-28746930 TAGGGCAGGAAGGCTGATGAAGG 0: 1
1: 0
2: 0
3: 33
4: 339

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022265209 Original CRISPR TAGGGCAGGAAGGCTGATGA AGG Intronic
901020800 1:6254417-6254439 GAGGGCAGGCAGGCTCAGGAGGG - Intronic
901226293 1:7614712-7614734 TGGGCCAGGCAGGCTGATGGTGG - Intronic
901449185 1:9325770-9325792 TTGGGCAGGATGGCTGAGAAAGG + Intronic
902448892 1:16484472-16484494 TAGGGGAGGCAGGCAGAAGAAGG + Intergenic
902547246 1:17197779-17197801 GAGGGCAGGAAGGTTGGTGATGG + Intergenic
902611974 1:17602904-17602926 TAGGACAGGAAGTCTGAGGGTGG + Intronic
902755164 1:18544647-18544669 GAGGGCAGGAAGGCTGAGTAAGG - Intergenic
904164735 1:28546807-28546829 GAGGGCAGGGAGGCTGAGGTGGG + Intergenic
904532599 1:31179477-31179499 CAGGGCCGGGAGGCTGAGGAAGG - Intergenic
904679140 1:32216599-32216621 TGGGGCAGAAAGGTTGCTGAGGG + Exonic
910369762 1:86503404-86503426 AAGGCCAGAAAGGCTGATGCTGG - Intergenic
911428859 1:97757435-97757457 GAGTCCAGGGAGGCTGATGAGGG + Intronic
912670201 1:111618218-111618240 TAGGGGAGAAAGTCTGATTAGGG - Intronic
916485653 1:165256207-165256229 TAGGGCAGGATGGCTGAGTTTGG - Intronic
917186122 1:172358055-172358077 TAGGGTATGAAGGCAGAAGAAGG - Intronic
918414333 1:184291030-184291052 TAGGGCAGGAAAACTGTAGATGG - Intergenic
918423768 1:184387728-184387750 GAGAGCAGGAAGGCTGAGGGCGG - Intronic
919776731 1:201199137-201199159 TAGGGTAAAAAGGCTTATGATGG + Intronic
919939476 1:202276419-202276441 CAGGGCAGGGAGGTTGTTGAGGG - Exonic
920115822 1:203620579-203620601 TAGCGAAGGAAAGCTGAAGATGG - Intergenic
920313409 1:205061528-205061550 TAGGGCAAGCAGGCTCATGCAGG - Intronic
921152272 1:212412181-212412203 AAGGGCAGGGAGGCTGGTGAAGG + Intronic
923630306 1:235645255-235645277 CAGGGCAGGGAGGCTGCTGAGGG - Intronic
924148522 1:241102423-241102445 TAGGGAAGAAAGGCTGATAGTGG - Intronic
1063662436 10:8043705-8043727 CAGGGCAGGAAGGTGGAGGAGGG + Intergenic
1063679292 10:8171905-8171927 CAGGGCAGGAAGGCAGAGGCAGG - Intergenic
1066566671 10:36728563-36728585 GAGGGAAGGAAGGCTGATTGGGG + Intergenic
1067973469 10:50996923-50996945 AAGGGGAGGAAGGCTGAGGAAGG + Intronic
1069599205 10:69692636-69692658 CTGGGCAGGAAGGGTGATGAGGG + Intergenic
1069599436 10:69693927-69693949 CTGGGCAGGAAGGGTGATGAGGG - Intergenic
1069720397 10:70545842-70545864 TAGGGCTGGAGGGGTGAGGAGGG - Intronic
1070627701 10:78062947-78062969 AAGGGAAGGAAAGATGATGAGGG - Intergenic
1070958901 10:80485380-80485402 AAATGCAGGAAGGCTGATAAAGG - Intronic
1073434138 10:103506046-103506068 TAGGGCAACAAGGCTAAAGAAGG - Intronic
1075088158 10:119427927-119427949 GATGGCAGTGAGGCTGATGATGG - Intronic
1075088160 10:119427945-119427967 GATGGCAGTGAGGCTGATGATGG - Intronic
1075291940 10:121238347-121238369 TAGGGGAGGAGGGCTCATGATGG - Intergenic
1075575871 10:123577124-123577146 TAGGGCAAGAAGGCTCAGAAGGG - Intergenic
1075948150 10:126455311-126455333 TAGGGCAGGGTGGGTGAGGAAGG - Intronic
1076700318 10:132269582-132269604 AAGGGCAGGAAGGCTGCTCGGGG + Intronic
1077151438 11:1074804-1074826 GAGGGCAGGAAGGCAGGGGAGGG - Intergenic
1077607088 11:3619673-3619695 TAGAGCAGGAAGGATGAGGCCGG + Intergenic
1078962960 11:16301004-16301026 TAGGGAAGAAAAGTTGATGAGGG - Intronic
1079598044 11:22276803-22276825 TAGGGCAAGAAGGCCTATCAGGG + Intronic
1080962148 11:37173066-37173088 TAGGGAAGAAAGCCTAATGATGG + Intergenic
1081568429 11:44275066-44275088 AGGGGCAGGAAGGCTGCTGCTGG - Intronic
1081660268 11:44884006-44884028 TATGGCAGTAATGGTGATGATGG - Intronic
1082729667 11:56779904-56779926 CAGGGCAGAAAGGATGATCAAGG - Intergenic
1083594060 11:63910760-63910782 TGGGGCAGGAGGGCTGAGGTTGG - Exonic
1083737077 11:64687502-64687524 CAGGGCAGCAAGGCTGGTGGGGG + Intronic
1084302450 11:68260387-68260409 TTGGGCAGGTGGGCAGATGAAGG + Intergenic
1084935666 11:72585296-72585318 TGGGGCAGGAAAGGAGATGATGG + Intronic
1085385724 11:76157141-76157163 TGGAGCAGGAAGGCTGCAGAGGG + Intergenic
1085777951 11:79383061-79383083 CAGGGCAGAAAGGCAGAAGATGG - Intronic
1086282766 11:85210023-85210045 GTGGGCAGAAAGGATGATGAGGG - Intronic
1088469960 11:110180598-110180620 AACTGCAAGAAGGCTGATGAAGG - Intronic
1088713584 11:112529308-112529330 GAGGGAAAGAAGGCTGGTGATGG + Intergenic
1089715803 11:120357944-120357966 TAGAGCATGGAGGTTGATGATGG + Intronic
1092180847 12:6445601-6445623 TGGGGGAGCAAGGCTGGTGACGG + Intronic
1094471701 12:30807521-30807543 TAGTGCAGGAAGGCTGCCTAGGG - Intergenic
1094829204 12:34292212-34292234 TAGGGCAAGAAGGCCCATAAGGG - Intergenic
1096113398 12:49041556-49041578 TAGGGCAGTCAGGCTGCTGCAGG + Intronic
1098304640 12:69090330-69090352 CAAGGCAGGAAGGCTGCTGAGGG - Intergenic
1100153808 12:91773372-91773394 TTGGGAAGGAAGCCTGAGGAAGG + Intergenic
1100189709 12:92177347-92177369 GAGGGAAGGGAGGCTGAGGAAGG + Intergenic
1101922243 12:108942471-108942493 TAGGACAGGGAGCCTGTTGATGG - Intronic
1102643288 12:114385371-114385393 ACGGGCAGGAAGGCTGGTGGAGG + Intronic
1103573039 12:121857509-121857531 TAGGGCAGGCAGGCTGAGGGGGG - Intronic
1104275184 12:127320530-127320552 TAGGGCAGGATGGTGGATGGAGG - Intergenic
1104691145 12:130827248-130827270 TAGTGTAGGAAGAATGATGATGG - Exonic
1105073543 12:133253477-133253499 TAGGTCATGAAGGCTCATGAAGG - Intergenic
1105729160 13:23194293-23194315 AAAGGCAGGATGGCTTATGATGG - Intronic
1106076347 13:26464465-26464487 TTGGGCAGGTGGCCTGATGATGG - Intergenic
1106119226 13:26844801-26844823 TACAGCAGGAGAGCTGATGATGG - Intergenic
1106466182 13:30016373-30016395 TAGAGCAGAAAGGCAGAGGAAGG + Intergenic
1107320097 13:39177434-39177456 TAGGGGAAGAAGGCCGGTGAGGG + Intergenic
1108418882 13:50228617-50228639 TAGGGCAGTAGGGCTGCTGCAGG - Intronic
1109938633 13:69328762-69328784 TAGGACAAGACGGCTGATTAAGG + Intergenic
1110852186 13:80258537-80258559 TAGGACAGGAAGCATGATGTTGG + Intergenic
1111022866 13:82477738-82477760 TAGAGAAGAAAGGCTAATGACGG + Intergenic
1112220053 13:97479443-97479465 GTGGGCAGGAAGACTGATTAGGG + Intergenic
1112232263 13:97601117-97601139 TAGGGGAGCAAGGAGGATGAGGG + Intergenic
1112386003 13:98940296-98940318 TAGGACAGAGAGGCTGAAGAAGG + Intronic
1116023333 14:39487042-39487064 TAGGGAAGAAAGGCTAATTATGG + Intergenic
1116951799 14:50885148-50885170 GAGAGCAGGAAGGCTGAGCAGGG - Intronic
1118866985 14:69711807-69711829 AAGGCCAGGAAGGCCGATGCTGG - Exonic
1119326833 14:73764836-73764858 CAGGGCAGGGAGGCTGGGGAGGG - Intronic
1119887143 14:78152599-78152621 GTGGGCAGGGAGGCTGATGAAGG + Intergenic
1121406863 14:93724471-93724493 TAGGACAGGAACGGGGATGAAGG - Intronic
1123389223 15:19852745-19852767 GAGGGAAGGAAGGCTGATTGGGG + Intergenic
1124242100 15:28037263-28037285 GAGGGCAGGAAGGCAGCTGGTGG + Intronic
1126099000 15:45108450-45108472 GAGGTCAGGCAGGCTGGTGATGG - Intronic
1126173684 15:45715845-45715867 GAGAGGAGGATGGCTGATGAAGG + Intergenic
1126994550 15:54425833-54425855 TAGGTCAGGAAGTCTGATGTGGG + Intronic
1127598458 15:60511279-60511301 TAGGGAAAGAAGCCTGATGCTGG + Exonic
1127704960 15:61537355-61537377 TAGGTCAGGGAGGATGAGGATGG + Intergenic
1127996913 15:64158515-64158537 TAGGGCAGGCAGGCTGCTGGGGG - Intronic
1130707762 15:86249257-86249279 AAGAGCAAGAAGGCTGATAAAGG - Intronic
1132203103 15:99968625-99968647 TAGAACAGGAAGGCTGACGAAGG + Intergenic
1132385555 15:101397745-101397767 TGTGTCAGGAAGGCTGAGGAAGG - Intronic
1132399933 15:101498910-101498932 GACGGCAGGGAGGGTGATGAGGG - Intronic
1132777602 16:1604430-1604452 CAGGGCTGGAAGGCCGAGGAAGG + Intronic
1132948652 16:2547652-2547674 TGGGGCAGAAAGGGTGAGGACGG + Intronic
1132965935 16:2654475-2654497 TGGGGCAGAAAGGGTGAGGACGG - Intergenic
1133002962 16:2860355-2860377 TAGGGGTGGGAGGCAGATGACGG + Intergenic
1133241199 16:4415766-4415788 AACGGCAGGAGGACTGATGAGGG - Intronic
1134230058 16:12421988-12422010 AAGGGATGGATGGCTGATGATGG - Intronic
1134331721 16:13257502-13257524 TAGGCCAAGAGAGCTGATGATGG - Intergenic
1137990842 16:53153408-53153430 TGGGGAAGGAAGGCAGAGGAAGG + Intronic
1138287394 16:55820797-55820819 TAGGGGAGGCAGGCAGAGGAAGG - Intronic
1138384462 16:56626656-56626678 TAGGGCAGAAAGCCTGGAGAGGG - Intronic
1138385561 16:56633530-56633552 TAGGGCAGAAAGCCTGGAGAGGG - Intronic
1139677883 16:68537803-68537825 TAGCACAGGGAGGCTGAGGAGGG - Intronic
1139701308 16:68709780-68709802 TTGGGCAGCTGGGCTGATGATGG - Intronic
1140109951 16:71995419-71995441 TAGGGCAGAAAGGATGAAGATGG - Intronic
1140848571 16:78913094-78913116 TAGGGCAGGATGTCAGATGTGGG - Intronic
1141015630 16:80446605-80446627 TATGTCAGGCAGGGTGATGAAGG - Intergenic
1141470466 16:84234879-84234901 GAGAGCAGGGAGGCTGAGGACGG - Intronic
1141612866 16:85192971-85192993 TAGGGCAGGAGGGCTGTTGGAGG + Intergenic
1141828395 16:86496464-86496486 CAGGGCAGCCAGGCTGATGCGGG - Intergenic
1141841037 16:86574289-86574311 TAGAGCAGGAAGGTTGAAAAAGG - Intergenic
1142048118 16:87939112-87939134 GAGGGCAGGACGGCTGAGGATGG - Intergenic
1142247437 16:88976454-88976476 TGGGGCAGGTGGGCTGGTGAGGG - Intronic
1143156445 17:4840305-4840327 GAGGGCAAGAAGCCTGAGGATGG + Intronic
1143538185 17:7554161-7554183 GAGGGGAGGAAGGCTGATCTGGG - Intronic
1143955974 17:10669453-10669475 TGAGGCAGGAAGGCTGAGGCAGG + Intergenic
1144017470 17:11209612-11209634 TAGGGCCCCAAAGCTGATGATGG + Intergenic
1145990735 17:29077926-29077948 TAGGGCAGGAAGTCAGCTGATGG - Exonic
1146372770 17:32275667-32275689 TGGGGCAGCCAGGCTGATTAGGG - Intronic
1146626198 17:34437347-34437369 TAGGGAGGGAAGTCTGCTGAAGG + Intergenic
1146974555 17:37099554-37099576 GATGGCAGGAGGGCTGATGGCGG + Intronic
1146974564 17:37099584-37099606 GATGGCAGGAGGGCTGATGGCGG + Intronic
1146974573 17:37099614-37099636 GATGGCAGGAGGGCTGATGGAGG + Intronic
1147168311 17:38604830-38604852 TAGGGAAGGCAGGCGGCTGAGGG - Intronic
1147170552 17:38616440-38616462 CAGTGCAGGAGGGATGATGAAGG + Intergenic
1147359396 17:39921665-39921687 TAGGGGAGGGAGGCTGCTGTGGG - Intronic
1147391691 17:40113237-40113259 GAGAGGAGGAAAGCTGATGAGGG - Intergenic
1148439517 17:47704431-47704453 TCGGGCGGGAAGACTGATGCTGG + Intronic
1148517610 17:48235659-48235681 TAGTGCAGCAAAGCTGAGGATGG + Intronic
1148689703 17:49520185-49520207 CAGGGCAGGAAGACTGTGGAGGG - Intergenic
1148774425 17:50087674-50087696 TAGGATAGGAAGGGTGAGGATGG + Intronic
1148777817 17:50105461-50105483 TGGGGCAGGAAGGCAGGTGTTGG + Intronic
1150004115 17:61459113-61459135 TAGGGAAGGAAGACACATGAAGG + Intronic
1150199596 17:63341006-63341028 TGGGGCAGGAAGACTTAAGAAGG - Intronic
1150868099 17:68875866-68875888 TAGGGCAGGTAGGATGAGGAAGG + Intronic
1151769937 17:76153963-76153985 TGCAGCAGGGAGGCTGATGATGG + Intronic
1153736811 18:8079195-8079217 TAGTGCTGGAAGGCTGAGAATGG - Intronic
1154358475 18:13640673-13640695 CCGGGCAGCAAGGCTGAGGAAGG + Intronic
1154532664 18:15363369-15363391 GAGGGAAGGAAGGCTGATTGGGG - Intergenic
1156447928 18:37250553-37250575 AAGGGCAGGAAGCCTGAGCAGGG - Intronic
1156533018 18:37836219-37836241 TAGGGAAGAAAGCCTCATGATGG - Intergenic
1156926109 18:42581864-42581886 TAGGGCTGGAAGACTGAGGCAGG + Intergenic
1157925987 18:51766835-51766857 TAGGATAGGATGGCAGATGAAGG + Intergenic
1159001001 18:62975072-62975094 TAGGGCAGTGTGGTTGATGAGGG + Intronic
1159248033 18:65835441-65835463 TAGAGGAGAAAGGATGATGAGGG - Intronic
1159433626 18:68386783-68386805 TAGGGCTGGAAATGTGATGAGGG - Intergenic
1162087060 19:8255377-8255399 TAGGGCAGGCAGGTCGCTGACGG - Intronic
1163202604 19:15779638-15779660 AAGGGCAGGAAGGGGGATCAAGG - Intergenic
1163718058 19:18883899-18883921 AGAGGCAGGAAGGCTGAGGAGGG - Intronic
1166068653 19:40375204-40375226 GAGGGCAGGAAGCCTGAGGCAGG + Intronic
1166681699 19:44771822-44771844 TAGAGCTGGAAGGGTGTTGAGGG - Intergenic
1166922109 19:46235979-46236001 TAGGGTAAGAAGGCAGACGAAGG - Intergenic
1167309485 19:48728868-48728890 TAGGGAAGGGAGGCTGGAGAAGG + Intronic
1167751404 19:51382524-51382546 TAGGGCAGACAGGATCATGAAGG + Exonic
1168126140 19:54284281-54284303 TCAGGAAGGAAAGCTGATGAGGG - Intergenic
1168351318 19:55677768-55677790 ATGGGAAAGAAGGCTGATGAAGG - Intronic
925145235 2:1578312-1578334 TAGGGAAGGAAGCCTAATGGTGG - Intergenic
925429446 2:3778455-3778477 GAGGGCAGGCAGGCTGTGGAGGG + Intronic
925627147 2:5852804-5852826 TTGTGCAGGGAGGCTGTTGATGG - Intergenic
926634787 2:15167408-15167430 CAGGGCATGAATGATGATGAAGG - Intronic
926888456 2:17618847-17618869 TAGGTAAGGAAGGCAGAGGAGGG + Intronic
928258998 2:29749975-29749997 TTAGCCAGGAAGGCTAATGAGGG + Intronic
928268178 2:29830381-29830403 TAGGGCTGGAAAGGTGATGGTGG - Intronic
928603927 2:32926851-32926873 CAGGGGAGGAATGCTGATGGGGG - Intergenic
928921675 2:36534142-36534164 GAGGGCAGGAAGGGGGAAGAAGG + Intronic
928943831 2:36754200-36754222 GAGGGAAGGAAGGGTGTTGATGG + Intronic
929427957 2:41863355-41863377 TAGGGCAGGAGGGCTCTAGAAGG - Intergenic
929487352 2:42366839-42366861 TGGGGAAGGGAGGCTGAAGAGGG - Intronic
929672129 2:43884480-43884502 AAGGGCAGGAAGACTGAAGCTGG + Intergenic
930173709 2:48279250-48279272 TAGGGAATGAAATCTGATGATGG + Intergenic
930206308 2:48589497-48589519 TGGGGCAGAAAGTCTGAAGAGGG + Intronic
932416514 2:71576669-71576691 CAGGGCAGGAAGGCTGGAGCGGG + Intronic
934653537 2:96105534-96105556 ATGGGCAGGAAGGGTGGTGAAGG - Intergenic
937445016 2:121950144-121950166 TAGGGCAGGAAGGTGGGTGGGGG + Intergenic
937660778 2:124427790-124427812 TAGAGTAGGAAGTCTCATGATGG - Intronic
937819059 2:126287466-126287488 TGAGGCAAGAAGGCTGAAGAAGG - Intergenic
937822753 2:126329387-126329409 AAGGGCAGGAAGAATTATGATGG + Intergenic
938600093 2:132828839-132828861 TAGGGCAGGACTCCTGAGGAAGG - Intronic
938765888 2:134460263-134460285 GAGGGCAGGATGGCTGTTGCAGG - Intronic
938773146 2:134518443-134518465 TAGGACAGGCAGGATGATAATGG - Intronic
938881154 2:135590778-135590800 TAGAGTATGAAGGCAGATGATGG + Intronic
940111014 2:150154147-150154169 CACGGCACTAAGGCTGATGAAGG + Intergenic
943831571 2:192470817-192470839 TAGGGGAGGCAAGATGATGATGG + Intergenic
944119833 2:196229154-196229176 TAGGGAAGGAATGCTGAAAAGGG + Intronic
946061936 2:216950110-216950132 TAGGGAATGAGGGCTGATGGGGG + Intergenic
946362636 2:219228585-219228607 TGGGGCAGGAAGGCTGCAGTGGG + Intronic
946466892 2:219919941-219919963 TAGGGTAGGAAGGCTGTGTAAGG + Intergenic
946877134 2:224140429-224140451 TAGGGCAGAAAGGAGGATGTGGG - Intergenic
947109765 2:226706339-226706361 TAGGTAAAGGAGGCTGATGAAGG - Intergenic
1168866739 20:1093001-1093023 TAGGGCAGGAAGGTGGAGGAAGG + Intergenic
1170899321 20:20445348-20445370 CATGGCAGAAAGGCAGATGATGG + Intronic
1171341201 20:24431087-24431109 TTGGGCTGGAAGGCTGTTGGGGG - Intergenic
1172027327 20:31957402-31957424 TAGGACAGGAAGGCAGGTGGAGG + Intergenic
1172072805 20:32270875-32270897 TTGGGGAGGAGGGCTGAAGAGGG - Intergenic
1172182071 20:33009708-33009730 GAGGGCAGGAAGGCGGCGGAGGG - Intronic
1172766473 20:37353787-37353809 GAGGGCTGGAGGGCTGATCAAGG - Intronic
1172768111 20:37361763-37361785 CAGGGCAGGAGTGCTGCTGAGGG + Intronic
1174199680 20:48798515-48798537 GAGGGAGGGAAGGCTGAGGAGGG - Intronic
1174338709 20:49882910-49882932 TAGGGCAGCCAGGCTGCTGCAGG - Intronic
1175538628 20:59733939-59733961 GAAGGCAGGAAGGCAGAGGATGG - Intronic
1175924323 20:62464634-62464656 CAGAGCAAGAAGGCTGGTGAGGG - Exonic
1176122566 20:63460676-63460698 CTGGCCAGGAAGGCTGGTGAGGG - Intronic
1176764696 21:13004842-13004864 GAGGGAAGGAAGGCTGATTGGGG + Intergenic
1177444513 21:21175207-21175229 TGGGTGGGGAAGGCTGATGATGG + Intronic
1178396333 21:32246811-32246833 TGGGGCAGACAAGCTGATGATGG + Intergenic
1178553091 21:33558631-33558653 TGGGACAAGAAGGCTGAAGATGG - Intronic
1180094753 21:45550848-45550870 GAGGGGAGGAAGGCAGAGGAGGG - Intergenic
1180511890 22:16099646-16099668 GAGGGAAGGAAGGCTGATTGGGG + Intergenic
1180674989 22:17580889-17580911 TGGGCCAGGGAGGCTGAAGAGGG + Intronic
1181850807 22:25748717-25748739 AAGGGCAGGAAGGTTGATGGAGG - Intronic
1182649014 22:31835552-31835574 GAGGGTCAGAAGGCTGATGATGG + Intronic
1183701342 22:39453000-39453022 TAGGGAAGAAAGCCTGCTGACGG - Intergenic
1184254064 22:43277048-43277070 CAGGGCAGGGAGGCTGAGGGTGG + Intronic
1184968572 22:47998878-47998900 CAGGACAGGCAGGCTGATGGGGG - Intergenic
950856084 3:16106632-16106654 TTAGGCAGGAAGGCAGATGCTGG - Intergenic
952462012 3:33537380-33537402 GATGGCAGGAAGGCAGAGGAAGG + Intronic
953376269 3:42430990-42431012 TGGGGAAGGAAGGAAGATGAGGG + Intergenic
953383561 3:42492193-42492215 TAGGGGAGGAGGGATGAGGAAGG - Intronic
953757780 3:45662596-45662618 TAGGGAAGGAAGGGAGAGGATGG - Intronic
953899401 3:46831030-46831052 TGGGGCAGGGAGGCCGGTGAAGG - Intronic
954411901 3:50374452-50374474 TGGGGCAGGCAGGCTAAGGAGGG + Intronic
954705871 3:52480253-52480275 TGGGGCAGGGAGGCAGATGCGGG - Exonic
955900473 3:63748364-63748386 TATGGCAGGCAGACTGATGTGGG - Intergenic
956435275 3:69229256-69229278 TAAGGCAGGAAGGTTGCTGGAGG - Intronic
957462819 3:80544225-80544247 AAGGGCAGCCAGGATGATGAAGG - Intergenic
957800921 3:85079905-85079927 TTGAGAAGGAAGGATGATGAAGG + Intronic
958785671 3:98593885-98593907 TAGGGCTGGGAGGCTGAGGGCGG + Intergenic
960663279 3:120084456-120084478 TAGTGCAGAAGGGCTTATGATGG - Intronic
961010895 3:123435050-123435072 CAGGGCAGGCAGACTGATGGAGG + Intronic
961756440 3:129129961-129129983 GAGGGAAGGAAGGCTGAGAATGG + Exonic
962242910 3:133766445-133766467 TTGGGAAGGAGGGCTGGTGAGGG + Intronic
962348770 3:134641745-134641767 TAAAGCAGGAAGGATGATAAGGG - Intronic
962898489 3:139736793-139736815 GAAGGCAGTAAGGCTGTTGAAGG + Intergenic
963042777 3:141081594-141081616 TATGCCAGGAATGCTGAGGAGGG + Intronic
963935476 3:151047765-151047787 TAGGGCAGGAATGCTGAGAAGGG - Intergenic
966437489 3:179904929-179904951 TAGGGCAGGAAGAGCCATGATGG - Intronic
967025586 3:185561249-185561271 AAGGCCAGAAAGGCTGATGCTGG - Intergenic
967852584 3:194093412-194093434 TGGGGCAGAAAGCCTGAGGAAGG - Intergenic
968044058 3:195613659-195613681 CAGGGCAGGAGCGCTGATGAAGG - Intergenic
968058814 3:195712970-195712992 TAGGGCAGGAGGACTGGTCAGGG - Intergenic
968058839 3:195713061-195713083 TAGGGCAGGAGGACTGGTCAGGG - Intergenic
968058856 3:195713119-195713141 TAGGGCAGGAGGACTGGTCAGGG - Intergenic
968058960 3:195713469-195713491 TAGGGCAGGAGGACTGGTCAGGG - Intergenic
968058985 3:195713560-195713582 TAGGGCAGGAGGACTGGTCAGGG - Intergenic
968059029 3:195713707-195713729 TAGGGCAGGAGGACTGGTCAGGG - Intergenic
968059119 3:195714001-195714023 TAGGGCAGGAGGACTGGTCAGGG - Intergenic
968059145 3:195714094-195714116 TAGGGCAGGAGGACTGGTCAGGG - Intergenic
968691065 4:1990454-1990476 GCGGGCAGGAAGGCTGAGGCCGG - Intronic
968805109 4:2767174-2767196 TGGGGCAGGAAGGCTGAGGCTGG + Intergenic
968863889 4:3195399-3195421 GCGGGCAGGAAGGCGGATGCAGG - Intronic
968943924 4:3653768-3653790 GAGGGCAGGCAGGCAGAGGAAGG - Intergenic
968954984 4:3713707-3713729 TAGAGCAGAAAGGCTGAGTAAGG - Intergenic
969809430 4:9636600-9636622 TAGGGCAGGATGGGAGCTGACGG - Intergenic
970418816 4:15885341-15885363 GAGGGCAGGAAGGAAGAAGATGG - Intergenic
970421588 4:15910225-15910247 TAGGGAAGAAAGGCTCATGGTGG - Intergenic
973738107 4:53892430-53892452 TGGGGAAGGAGGGGTGATGATGG - Intronic
975703946 4:77093244-77093266 TAGGGAAGGAAGCCTGATGGTGG + Intergenic
976745887 4:88402619-88402641 GAGGGCAGGAAGGGTGACCATGG + Intronic
978390721 4:108222575-108222597 TGTGGCAGGGACGCTGATGAGGG + Intergenic
978825401 4:113016558-113016580 TAGGGCTAAAAAGCTGATGAAGG + Intronic
981861720 4:149363275-149363297 AAGCTCAGGAAGCCTGATGAAGG - Intergenic
981953721 4:150444336-150444358 TGGGGGAGGAAGGCAGGTGATGG - Intronic
982501328 4:156159851-156159873 TAGTGTGGGAAGGCTGGTGAGGG - Intergenic
982767720 4:159367426-159367448 TAGGGCAGGGTGGGTGGTGATGG - Intergenic
984193145 4:176628146-176628168 CAGGTCAGGAAGGCTGCAGAGGG + Intergenic
985823696 5:2178150-2178172 AAGGGCAGGCAGGCGGATCACGG - Intergenic
986044344 5:4022918-4022940 CAAGGTAGGAAGGCTGGTGAGGG + Intergenic
986179989 5:5384407-5384429 GAGAGCAGGAAGGCAGGTGAGGG + Intergenic
986542369 5:8859510-8859532 TTGGGCAGGAACGCAGATGGAGG + Intergenic
988094744 5:26591077-26591099 TAGAGCAGGATGGCTGAAGGAGG + Intergenic
989110386 5:37901774-37901796 GAAGGGAGGAAGGCTGATGAAGG + Intergenic
990533644 5:56698686-56698708 GAGTCCAGGATGGCTGATGAGGG + Intergenic
992299488 5:75363762-75363784 TAGGGCAGGTGGGGTGAGGATGG - Intergenic
993351508 5:86855731-86855753 CAGGGCAGGCAGGCTGCAGATGG - Intergenic
993547331 5:89229467-89229489 TAGGGCGGGCATGGTGATGAGGG + Intergenic
994776419 5:104040209-104040231 TAGGACAAAAAGGCAGATGAAGG + Intergenic
996214990 5:120855849-120855871 AAGGGCAGGAACCCTGGTGAGGG + Intergenic
997926488 5:138035108-138035130 TAGGGTAGGAATGCTGCTGGAGG - Intronic
999305211 5:150515124-150515146 CTGGGCAGGAAGCCAGATGAAGG + Intronic
999747253 5:154601707-154601729 TAGCACAGGAAGGCTGAGGCAGG - Intergenic
999776395 5:154815817-154815839 GAAGGCAGGGAGGGTGATGAAGG + Exonic
1000367262 5:160503411-160503433 TAGGGAAGAAAGGCTAATGATGG + Intergenic
1002643267 5:180640561-180640583 TAGGGCATGAAGCCAGATGGAGG - Intronic
1003278028 6:4668916-4668938 ATGGGCAGGAAGGCTCCTGAAGG - Intergenic
1003419280 6:5941126-5941148 TAGGCCAGGAAGGGTTCTGATGG + Intergenic
1003977002 6:11353916-11353938 CAGGGCAGGAAGAGTGATGGGGG + Intronic
1005839605 6:29733703-29733725 TAGGGCAGAAATGCCGATTATGG + Intronic
1006788051 6:36680809-36680831 TAAGGCAGGAAGGCCAATAAAGG + Intronic
1008536748 6:52512042-52512064 TGGGGCAGGAGAGCTGATGAAGG - Intronic
1008923325 6:56865644-56865666 TAGGGAAGCAAGGCTGAGCATGG - Intronic
1010500116 6:76588301-76588323 TATGGCTGGAAAGCTGATGCTGG + Intergenic
1013181471 6:107720320-107720342 TGGGGCATGAAGGCTGTAGAGGG + Intronic
1013621717 6:111896661-111896683 TAGTGCAGGAGGTCAGATGAAGG - Intergenic
1015942308 6:138464401-138464423 CAGGGCAGGAAGGCCGAGGATGG + Intronic
1018657767 6:166055926-166055948 TAGGGCAGAAAAGCAGAAGACGG - Intergenic
1018834618 6:167473589-167473611 GAGGGGAGGGAGGATGATGAGGG + Intergenic
1018933247 6:168256130-168256152 TAGGGAAGGAAGCCTAATGGCGG - Intergenic
1019021576 6:168923141-168923163 AAGGTCAGGAAAGCCGATGAGGG - Intergenic
1020155902 7:5724232-5724254 AAGGGCAGTCAGGCTGATGAAGG + Intronic
1020915889 7:14192081-14192103 GTGGACAGGAAGGCTGCTGATGG + Intronic
1022265209 7:28746908-28746930 TAGGGCAGGAAGGCTGATGAAGG + Intronic
1023171561 7:37394604-37394626 CAGAGCAGAGAGGCTGATGAGGG + Intronic
1023274460 7:38503009-38503031 CAGGGCAGGCAGCGTGATGATGG + Intronic
1023311621 7:38893174-38893196 TGGGGCAGTGAGGCTGGTGAAGG - Intronic
1023333689 7:39146335-39146357 GAGGGCAGGAAGGCAGAGGGAGG + Intronic
1023411184 7:39890760-39890782 TAGGGCATGAGGGAAGATGAAGG + Intergenic
1023503880 7:40879860-40879882 AAGGGCAAGAAAGCTGGTGATGG + Intergenic
1023555303 7:41416029-41416051 CTGGGCAGGAATTCTGATGAAGG + Intergenic
1024610984 7:51064027-51064049 TGGGGCAGAAAGGGTGCTGAGGG - Intronic
1026607457 7:71827967-71827989 TGGGGCTGGAAGGGAGATGAGGG + Intronic
1027278103 7:76583246-76583268 AAGGGCAAGAGGGCTGCTGAGGG + Intergenic
1028722371 7:94048313-94048335 TAGGGCAGGAGGGTGCATGAGGG + Intergenic
1028867031 7:95725361-95725383 CAGAGCAACAAGGCTGATGATGG - Intergenic
1029210237 7:98901993-98902015 TAGTCAAGGAAGGCTGCTGATGG - Intronic
1030301365 7:107977437-107977459 TATGGCAGGGTAGCTGATGAAGG - Intronic
1030588684 7:111451990-111452012 AAGGGCAGTAAGGCTGGGGAAGG + Intronic
1030673487 7:112362455-112362477 CAGGGAATGAAAGCTGATGAAGG - Intergenic
1031719168 7:125148478-125148500 TTGGGCAGGGAGGAGGATGATGG + Intergenic
1032404804 7:131648396-131648418 TGAGGCAGGAAGCCTGGTGAGGG + Intergenic
1032745075 7:134778231-134778253 TAATGCTGGAAGGCTGAAGAAGG + Intronic
1033761954 7:144445390-144445412 TAGGGCAGGGAGGCCGAGGCGGG + Intergenic
1034711634 7:153197280-153197302 TAGGGCAGGAAGGCAGGAGATGG + Intergenic
1034740890 7:153472337-153472359 TATGGCAGAAAGGCAGATTAAGG + Intergenic
1035494117 7:159306906-159306928 TAAGTCATGAAGGCTCATGAAGG - Intergenic
1035918719 8:3653639-3653661 TAGGCCACGAAGCCTGATAAGGG + Intronic
1036009606 8:4707424-4707446 TAGTGCAGGAATGCTGATGGTGG + Intronic
1037237321 8:16736048-16736070 TCTGGTAGGAAGGGTGATGATGG - Intergenic
1038611376 8:29062674-29062696 AAGGGAAGGCAGGCTGACGAAGG + Intronic
1038687818 8:29734404-29734426 TAGGTCAGGCAGGGTGAAGATGG - Intergenic
1039574640 8:38613380-38613402 TAGGGCTGGGAGGGTGCTGAAGG - Intergenic
1039719408 8:40146490-40146512 TTGGTCAGGAAGGCTGAGGTGGG - Intergenic
1041688436 8:60665929-60665951 TAGGGCAGGCAGGCAGTTCATGG - Intergenic
1042222046 8:66483635-66483657 AAGGGCAGCAAGGCTGAAGCAGG - Intronic
1044290148 8:90458540-90458562 TAGGTCAGGTAGTCTGATTATGG + Intergenic
1045734403 8:105278095-105278117 CAGAACAGGAAGGCTGAGGACGG + Intronic
1046854455 8:119015328-119015350 TAGGACAGGATGGCTGGTGTGGG + Intronic
1046911240 8:119630083-119630105 TAGGGAAGAAATGATGATGAAGG - Intronic
1048460055 8:134614131-134614153 ATGGGAAGGAAGCCTGATGAAGG - Intronic
1049595333 8:143480828-143480850 CATGGCAGGAAGGCTGGGGAAGG + Intronic
1049969902 9:812799-812821 TTGGCCAAGAAGGATGATGAGGG + Intergenic
1052963450 9:34319897-34319919 GAGGGCAGGCAGGATGATTATGG - Intronic
1053107412 9:35423453-35423475 AGGGGCTGGGAGGCTGATGAGGG - Intergenic
1054420280 9:64921877-64921899 GAGGGAAGGAAGGCTGATTGGGG - Intergenic
1054907332 9:70422262-70422284 TTGGTCAGGAAGGAGGATGATGG - Intergenic
1055114421 9:72591642-72591664 TAGGAGATGAAGGCTGATCAAGG - Intronic
1057271587 9:93654620-93654642 CAGGGCAGTAAGCTTGATGAGGG - Intronic
1059811365 9:117858974-117858996 TAGGGCAGGGATGCTGAAGCAGG + Intergenic
1061698694 9:132398091-132398113 TATGGCTGGAAGGCTGTGGATGG + Intronic
1062066148 9:134527390-134527412 GTGTGCAGGAAGGGTGATGAGGG + Intergenic
1062283271 9:135761475-135761497 TGGGGCAGGAGGGCCGAGGAGGG - Intronic
1185834169 X:3329441-3329463 GAGGGAAGGAAGGAAGATGAAGG + Intronic
1187827551 X:23347107-23347129 TAAGGCAGAAAGGCTGAAGGGGG - Intronic
1189572475 X:42313064-42313086 TAGGCTAGGAAGGCTAATGGGGG - Intergenic
1190477219 X:50840128-50840150 CTGGGCAGGAAGGCTGGGGAGGG - Intergenic
1190480242 X:50870217-50870239 CTTGGCAGGAAGGCTGGTGAGGG + Intergenic
1190616947 X:52243573-52243595 TAGGCCAGGGAGGCTGAGGTGGG + Intergenic
1192185052 X:68941000-68941022 GAGGGGAGGAAGGGTGAGGAGGG + Intergenic
1192507557 X:71698205-71698227 AAGGCCAGAAAGGCTGATGCTGG - Intergenic
1192519139 X:71783347-71783369 AAGGCCAGAAAGGCTGATGCTGG + Intergenic
1198084914 X:133273269-133273291 TTGGGCTGGAAGGCAGCTGAAGG - Intergenic
1198254580 X:134914358-134914380 AAGGGCAGGAGGGCTGGAGAGGG + Intronic
1198804567 X:140481208-140481230 TAGGGGATGCAGGCTGAGGAGGG - Intergenic
1200958069 Y:8971407-8971429 TAGGGGAGAAAGGCTCATCAGGG - Intergenic