ID: 1022266909

View in Genome Browser
Species Human (GRCh38)
Location 7:28765804-28765826
Sequence ATAAAGTATGTTTCCAAATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022266908_1022266909 0 Left 1022266908 7:28765781-28765803 CCTTAGACAGAAAATGATAACAG 0: 1
1: 0
2: 2
3: 26
4: 336
Right 1022266909 7:28765804-28765826 ATAAAGTATGTTTCCAAATATGG No data
1022266907_1022266909 1 Left 1022266907 7:28765780-28765802 CCCTTAGACAGAAAATGATAACA 0: 1
1: 0
2: 1
3: 33
4: 388
Right 1022266909 7:28765804-28765826 ATAAAGTATGTTTCCAAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022266909 Original CRISPR ATAAAGTATGTTTCCAAATA TGG Intronic
No off target data available for this crispr