ID: 1022267211

View in Genome Browser
Species Human (GRCh38)
Location 7:28768794-28768816
Sequence TGTTAACTCATTTGAGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 3, 3: 6, 4: 112}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022267211_1022267216 3 Left 1022267211 7:28768794-28768816 CCTCCCACTCAAATGAGTTAACA 0: 1
1: 0
2: 3
3: 6
4: 112
Right 1022267216 7:28768820-28768842 TTGGCCATCTTCCCAGAAGGAGG 0: 1
1: 0
2: 0
3: 21
4: 264
1022267211_1022267215 0 Left 1022267211 7:28768794-28768816 CCTCCCACTCAAATGAGTTAACA 0: 1
1: 0
2: 3
3: 6
4: 112
Right 1022267215 7:28768817-28768839 GTGTTGGCCATCTTCCCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022267211 Original CRISPR TGTTAACTCATTTGAGTGGG AGG (reversed) Intronic
900884115 1:5403391-5403413 TGTTTCCTCATGTGAGTGGGGGG - Intergenic
906371203 1:45255425-45255447 TGTTAATTCATTTGAATAGTTGG + Intronic
906797215 1:48707846-48707868 TGTTGTCTCATTTGAGTTTGGGG + Intronic
907719764 1:56960781-56960803 TGTTTTCCCATTTGAGTGTGTGG + Intronic
908314350 1:62918120-62918142 TGTTAACGAAGTTGAGTGAGAGG - Intergenic
908380782 1:63594571-63594593 AGTTAACTGACTTGATTGGGCGG + Intronic
908635028 1:66154108-66154130 TCTTAACTCCTTTGTGTGGTGGG - Intronic
909354966 1:74697713-74697735 TCTAAACTCATTAGAGAGGGAGG - Intergenic
910180924 1:84481809-84481831 TGGTAACTTACTTGAATGGGAGG - Intronic
914883553 1:151566429-151566451 TGTTAACAGATTGAAGTGGGTGG + Intronic
917294277 1:173502787-173502809 GGTTAACTCATTTAACTGGTAGG - Intronic
917828356 1:178848455-178848477 GGTTAGCTCATTTGTGTGGTAGG - Intronic
919027112 1:192187190-192187212 TGTTAACTGACTTTAGTGTGTGG + Intergenic
921499460 1:215883351-215883373 TGTTAACTTTTTTTGGTGGGTGG + Intronic
922111552 1:222562195-222562217 AGTTAACTTTTTTGAGTGGTGGG + Intronic
1063126379 10:3139955-3139977 TCTTAGCTCATTTCAGTTGGAGG - Intronic
1068378771 10:56219821-56219843 TCTTATCTCACTTGAGTAGGTGG + Intergenic
1070437653 10:76409399-76409421 TGTTAACTCATTTGTGCCAGAGG - Intronic
1075794437 10:125109022-125109044 TGTTAACTCATCTGTCTGAGAGG + Intronic
1080617447 11:33957064-33957086 TGTTCACTCATCTGAGCAGGAGG + Intergenic
1081403182 11:42666237-42666259 TGAGATCTCATTTGAGTGGGGGG - Intergenic
1081720309 11:45284208-45284230 TGTTAAAGCAGGTGAGTGGGTGG + Intronic
1087185135 11:95182917-95182939 TCTTAACCCAGTTGAGTGTGAGG - Intronic
1088251292 11:107863129-107863151 GGTTAAATCATGTGAGTGGTTGG + Intronic
1088568891 11:111202140-111202162 TGTTAACTGCTTTGAGTTGAGGG + Intergenic
1091157475 11:133386956-133386978 TGTTTTCTCATTTGAGATGGAGG - Intronic
1091699687 12:2651465-2651487 TGTCCACTCATTAAAGTGGGCGG + Intronic
1094719413 12:33048220-33048242 TGTAAACTCCTTTGGGTAGGGGG - Intergenic
1096050333 12:48601884-48601906 GGCTAACTCATTTGATAGGGAGG - Intergenic
1098692594 12:73507128-73507150 TGTTTACTCCATTGAGTGCGTGG + Intergenic
1098825257 12:75288419-75288441 TTTTAACTTTTTTGATTGGGGGG - Intronic
1104100618 12:125605247-125605269 TGCTCACACATGTGAGTGGGTGG + Intronic
1105016518 12:132788990-132789012 GGTTGACTCATTTGATGGGGAGG - Intronic
1108891587 13:55267276-55267298 TGTTACCTAATTAAAGTGGGTGG + Intergenic
1110967399 13:81716786-81716808 TCTTAACTCATTGAGGTGGGAGG - Intergenic
1111534537 13:89585775-89585797 TTTAAACTCATTTGTGTGGCAGG - Intergenic
1119351064 14:73966128-73966150 TGTTAACACATTAGCCTGGGAGG + Exonic
1124129776 15:26973092-26973114 TGGTCACTCGTTTGAGTTGGTGG - Intronic
1126480445 15:49112903-49112925 TTTTAACCCATTTGCATGGGTGG - Intronic
1127239477 15:57096821-57096843 TGTTAACTCATTTAACAGGTTGG + Intronic
1127554544 15:60074641-60074663 TTTGAACTCATTTGAGTGGGTGG - Intergenic
1129722794 15:77887336-77887358 TGTTAGCACATGTGGGTGGGGGG - Intergenic
1130846785 15:87755051-87755073 TGTTTACTCATTCGGGGGGGCGG + Intergenic
1131579050 15:93623020-93623042 TGTCAACTCGTTTGAGTAGTAGG + Intergenic
1133395280 16:5442203-5442225 TGGGAACACATTTGAGGGGGAGG + Intergenic
1149137558 17:53387531-53387553 TGCTAACTCATTTGCGTTTGGGG - Intergenic
1149935742 17:60804948-60804970 TGTAAACTAATTTGAGTGTCGGG + Intronic
1150608970 17:66717928-66717950 TGTTGACCCAGTTGTGTGGGAGG + Intronic
1158013650 18:52758554-52758576 TCATAACTCATTTAAATGGGAGG - Intronic
1161781691 19:6297412-6297434 TGTTTACTCTGTGGAGTGGGAGG - Intergenic
1168334773 19:55591584-55591606 TGTGAACTCATCTGAGTGGGAGG - Exonic
928210136 2:29317816-29317838 TGTTATCTCATTGGTGTGGGTGG - Intronic
929962234 2:46505435-46505457 TCTTAACTCCTTTCATTGGGAGG - Intronic
931326889 2:61235134-61235156 TGTTAATTAATTTGAATGTGGGG + Intronic
933360956 2:81283351-81283373 TTTTGACTCATTTGAGTTTGTGG + Intergenic
934856511 2:97733333-97733355 CGTTGACTCATGTGAGTTGGGGG + Exonic
936821635 2:116528922-116528944 TGTTATCTCCTTTAAGTGTGTGG - Intergenic
937433527 2:121861041-121861063 TGTTAAATGAATTGAGTGGTTGG - Intergenic
937643043 2:124235511-124235533 GGTTATCTCATTTGAGTGGGAGG - Intronic
938150549 2:128879002-128879024 TGTTTATTTATTTGATTGGGAGG - Intergenic
1169599855 20:7245776-7245798 TGTTAATTTATTTGTTTGGGTGG - Intergenic
1183444687 22:37845560-37845582 TTTTAACTGGGTTGAGTGGGAGG - Intronic
949487245 3:4551878-4551900 AGTTAACTCATTTGAGAGTAGGG - Intronic
950996267 3:17500504-17500526 CACTAACTCATTTGAGTGGATGG - Intronic
951034935 3:17922376-17922398 TGTGAAATCAGTTTAGTGGGAGG + Intronic
952710239 3:36424135-36424157 TGTTAAATTAAGTGAGTGGGGGG - Intronic
953936866 3:47052500-47052522 TTTTAAGTCATTTGAATGAGTGG - Intronic
955306846 3:57841795-57841817 TGTTAGCTTATTTTGGTGGGAGG + Intronic
957191291 3:77013006-77013028 TCTTGACTCATTTGTGGGGGAGG + Intronic
957512753 3:81210932-81210954 TTTTAACTCTTTTCAGTGAGTGG - Intergenic
957781928 3:84829656-84829678 TGTTAACTCATTTATAAGGGTGG + Intergenic
964101671 3:152995170-152995192 TTTTAAAACATTTGAGTAGGTGG - Intergenic
969256586 4:6006652-6006674 TGTTGATTCATTTGATTGAGGGG - Intergenic
969428244 4:7138356-7138378 TGTTAACTCACCTGTGAGGGGGG - Intergenic
969724978 4:8913338-8913360 TGTCATCTCAGCTGAGTGGGCGG + Intergenic
971625324 4:28912528-28912550 AATTAATTCATTTGAGTGTGTGG - Intergenic
973231832 4:47848212-47848234 TATTATCTCATTTCAGTGTGTGG - Exonic
973260000 4:48153650-48153672 TTTTAACTCATTTGTGCTGGAGG - Intronic
976020814 4:80623201-80623223 TGCAAACTCATTTGAGTGAAAGG - Intronic
981113606 4:140964067-140964089 TGTTATCTCATTTCATTGGTTGG - Intronic
981491162 4:145340964-145340986 TGGTCACTCTTTTGAGTTGGGGG - Intergenic
983408556 4:167365782-167365804 AGTTAAATCATTTGAGCAGGTGG - Intergenic
983596507 4:169473429-169473451 TGTTCACTATTTTGAGTGGTAGG + Intronic
983616521 4:169711707-169711729 TTCTAACACATTTGAGTAGGAGG - Intronic
984501103 4:180559948-180559970 TGTTAACTGAATCGGGTGGGGGG - Intergenic
986460657 5:7967660-7967682 TGTTAACGCATAGGATTGGGGGG + Intergenic
986918413 5:12654899-12654921 ATTCAACTCATTTGACTGGGGGG - Intergenic
987849418 5:23330877-23330899 TGATACATCATTTCAGTGGGTGG + Intergenic
988220591 5:28341522-28341544 TGTTAATTCATTGGGGGGGGGGG + Intergenic
990231068 5:53713143-53713165 TTTTAACTTTTTTGGGTGGGTGG - Intergenic
990272149 5:54154474-54154496 TGATAACTTATTTTAGTAGGTGG - Intronic
994458873 5:100049165-100049187 TGTTAAGTCCTGTGAGTAGGAGG + Intergenic
995512602 5:112923398-112923420 TGTTCACTGATTTGGCTGGGTGG - Intergenic
998612813 5:143707502-143707524 TGTTACCTCATTTGAAGGAGGGG + Intergenic
999040030 5:148398889-148398911 TCTTATTTCATTTGAGTGGTAGG + Intronic
1005998174 6:30944580-30944602 TGTTCACTCATTTGAAAGAGAGG - Intronic
1008315590 6:50036099-50036121 TGTTATCTCTTATGAGTGGAAGG + Intergenic
1010042358 6:71400382-71400404 TGTTAAATCATTTGAGATTGAGG - Intergenic
1011256868 6:85431462-85431484 TTTTATCTCTTTTGACTGGGAGG - Intergenic
1011741440 6:90364520-90364542 TGTTCTCACATTTCAGTGGGAGG + Intergenic
1020003641 7:4769866-4769888 TGTTTGCTCATTTGAGTGGTTGG + Exonic
1022267211 7:28768794-28768816 TGTTAACTCATTTGAGTGGGAGG - Intronic
1029060855 7:97796815-97796837 TGGTAACTCATTTTAGTCGGGGG - Intergenic
1029907270 7:104104383-104104405 AGTTAGCAAATTTGAGTGGGAGG + Intergenic
1031277029 7:119738320-119738342 TGTGAACTCATTTGAATTTGGGG - Intergenic
1031631834 7:124052873-124052895 TGTTAACTCATTTAAATGTCTGG + Intergenic
1037701584 8:21279815-21279837 TGTTAACTCCTTTTAATGGTGGG + Intergenic
1044093388 8:88030172-88030194 GGGTAACTAATTTGAGAGGGTGG + Intergenic
1046130110 8:109956128-109956150 TGTGGACACATCTGAGTGGGGGG - Intergenic
1050830338 9:10002987-10003009 TTTTATCTCATTTTAGTTGGTGG - Intronic
1051032195 9:12694442-12694464 TCTTAAATCATTTGAGCTGGAGG + Intronic
1051070454 9:13159839-13159861 TGTTTACTCATCTTAGTGTGTGG + Intronic
1051740223 9:20244251-20244273 TGTAAACTCATTTTAGTGTCTGG - Intergenic
1186332418 X:8548850-8548872 GGTTAACTCATTTCAGAGGCTGG + Intronic
1190143510 X:47869158-47869180 TGTTAACTGGTTTGACTGGAAGG - Intronic
1192422506 X:71046086-71046108 TGTAAACTTATTTGAGTGTAGGG - Intergenic
1194128003 X:90043679-90043701 TGTTTGCACATTTGAGTGTGGGG - Intergenic
1195287128 X:103396289-103396311 TGTGAATACATTTGAGGGGGTGG + Intergenic
1195502445 X:105617681-105617703 TGCCAACTGATTTGAGAGGGTGG - Intronic
1197612663 X:128656620-128656642 TGTTAAAGCATTTGAGAGGGAGG + Intergenic
1198788590 X:140317743-140317765 TGTTCACTCAGTTGTGTTGGGGG - Intergenic
1201490138 Y:14532114-14532136 GGAAAGCTCATTTGAGTGGGAGG + Intronic