ID: 1022270692

View in Genome Browser
Species Human (GRCh38)
Location 7:28804772-28804794
Sequence CACACTGCAAAAATAGATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 4, 3: 26, 4: 293}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022270692_1022270697 24 Left 1022270692 7:28804772-28804794 CCAAAATCTATTTTTGCAGTGTG 0: 1
1: 0
2: 4
3: 26
4: 293
Right 1022270697 7:28804819-28804841 GTAATATGAATCAATGGATTAGG 0: 1
1: 0
2: 0
3: 23
4: 197
1022270692_1022270696 18 Left 1022270692 7:28804772-28804794 CCAAAATCTATTTTTGCAGTGTG 0: 1
1: 0
2: 4
3: 26
4: 293
Right 1022270696 7:28804813-28804835 TCAAAAGTAATATGAATCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022270692 Original CRISPR CACACTGCAAAAATAGATTT TGG (reversed) Intronic
902239157 1:15076841-15076863 CCCACTGCAAACATATATTAGGG + Intronic
906995753 1:50792304-50792326 CAATCTGCAAAATTAAATTTTGG - Intronic
908321302 1:62981624-62981646 TATACTACAAAAATAGAGTTTGG + Intergenic
908633145 1:66132788-66132810 CACACTGCAAAAATGTATGCTGG - Intronic
908886680 1:68797240-68797262 CAGACTTCTAAAATGGATTTGGG - Intergenic
909429506 1:75570568-75570590 AAAACTGCAAAAATAGGTGTTGG - Intronic
909780984 1:79546947-79546969 AAAACTGTAAAAATATATTTGGG + Intergenic
910740468 1:90510203-90510225 CACAATTCAAAATGAGATTTGGG - Intergenic
912074230 1:105851801-105851823 CACATTGCAACATAAGATTTAGG - Intergenic
915357924 1:155267603-155267625 CACAGTCCAAAAATAGAATAAGG - Intronic
915842980 1:159231984-159232006 TTCACAGCAAAAATAGATTGTGG + Intergenic
919051516 1:192517027-192517049 CACACTGCAAAAGGAAGTTTTGG - Intergenic
919068515 1:192724385-192724407 TACGCTGCAAAAATTGATTTAGG - Intergenic
919302223 1:195785433-195785455 TACAATTCAAAAAGAGATTTGGG - Intergenic
920662991 1:207933920-207933942 CACATTGCAAAAGAACATTTGGG + Intergenic
921503341 1:215934256-215934278 CAAATTGCAAATATAAATTTTGG + Intronic
923801409 1:237213140-237213162 CAAACTGCAAAAATAGGTTTTGG - Intronic
924657496 1:245986410-245986432 CATACAGCAAAAATGTATTTGGG - Intronic
1063024384 10:2163830-2163852 CACACTTCAACATGAGATTTGGG - Intergenic
1063166888 10:3471397-3471419 CACACTCCAAAAATATTTTATGG - Intergenic
1066803859 10:39222767-39222789 CATACTGCAAACAGACATTTGGG + Intergenic
1067513650 10:46917005-46917027 CACATAGCAACAATTGATTTAGG - Intronic
1067648602 10:48134829-48134851 CACATAGCAACAATTGATTTAGG + Intergenic
1067979019 10:51061401-51061423 TACACTTCAAAATGAGATTTGGG + Intronic
1068385566 10:56322571-56322593 CAGACTGGAAATATAAATTTCGG - Intergenic
1068453878 10:57230898-57230920 AACATTGCTAAAATAGATTATGG - Intergenic
1068905273 10:62315224-62315246 CACACTGAAAATATAAAATTGGG + Intergenic
1070261205 10:74857647-74857669 CCCAATGCAAAATTTGATTTAGG - Intronic
1070427403 10:76302953-76302975 CAGACTGCAAAAGGAGATTGGGG - Intronic
1071769688 10:88713638-88713660 CACCATGTAAAAATAAATTTAGG + Intergenic
1072218126 10:93305198-93305220 CACAATTCAAGAAGAGATTTGGG - Intergenic
1072546396 10:96442676-96442698 CACACTGCAACAAAAAATCTTGG - Intronic
1073804333 10:107080231-107080253 CACACTGCAAAACAACATTATGG - Intronic
1075518769 10:123131374-123131396 AACACTGCAAGAACAGACTTTGG + Intergenic
1076067052 10:127456969-127456991 CACACTTCAAAAAGACATTGGGG + Intergenic
1076904963 10:133357079-133357101 CACACTGCAAGCATGGACTTGGG + Intronic
1079047963 11:17125433-17125455 CATGCTGAAATAATAGATTTCGG - Intronic
1079596425 11:22254169-22254191 TGCACTGGAAAAATATATTTTGG + Intronic
1080049358 11:27843300-27843322 TAAACTGGAAAAATAGAATTCGG - Intergenic
1080119757 11:28663730-28663752 CAGACAGTAACAATAGATTTAGG + Intergenic
1080411109 11:32025849-32025871 CCCACTTCCAAAATAGATTTGGG + Intronic
1081240086 11:40694781-40694803 CACACTGCACAAATTGATATAGG + Intronic
1082310630 11:50643127-50643149 GAAACTGCAAAGAGAGATTTGGG + Intergenic
1082588758 11:54978233-54978255 CACTCTGCAAGTATACATTTTGG + Intergenic
1084770378 11:71339198-71339220 CACGCTGCAAAAACAGCATTTGG - Intergenic
1085603324 11:77875156-77875178 CATGCTGCAAAAAAAGATTCAGG - Intronic
1087161511 11:94952610-94952632 AACACTGAAGAAAAAGATTTTGG + Intergenic
1090723705 11:129501644-129501666 GACACTTAAAAAGTAGATTTTGG + Intergenic
1091468155 12:703654-703676 CAGACTTCAAAATTAAATTTTGG + Intergenic
1092174469 12:6393777-6393799 CACACTGGCAAAATAGACATGGG - Intergenic
1094313859 12:29115816-29115838 CATAGTGCTAAAATAGATTTTGG + Intergenic
1094866452 12:34537757-34537779 CAAAGTGCAAATATATATTTGGG - Intergenic
1095919612 12:47516347-47516369 CACAATTCAAAATGAGATTTGGG + Intergenic
1097548962 12:61042834-61042856 TAAACTGCAAAAATTGGTTTGGG + Intergenic
1098002817 12:65962850-65962872 CACACAAGAAAAATAGAGTTAGG - Intronic
1098147861 12:67516103-67516125 CAAGCTGCAGAAATGGATTTTGG + Intergenic
1099492052 12:83300109-83300131 CACAGTGTAAAAAAAGCTTTTGG + Intergenic
1100672443 12:96831458-96831480 CACACTACAAAAGCAGAGTTGGG + Intronic
1102889646 12:116548419-116548441 CACACACCAAAAATAGTTCTGGG - Intergenic
1104030043 12:125058485-125058507 AACACTGCAAAAAACTATTTTGG + Intergenic
1105595409 13:21833298-21833320 CACAGTGGAAAAATAGACATGGG + Intergenic
1109166606 13:59043030-59043052 CACACTACTAAAATAGATTTGGG - Intergenic
1109405671 13:61895487-61895509 CACACTGCAAAAATATATAATGG + Intergenic
1112182993 13:97103596-97103618 TACAATTCAAAAAGAGATTTGGG - Intergenic
1113134846 13:107078037-107078059 CACAGTTGAAAATTAGATTTGGG - Intergenic
1114989646 14:28271601-28271623 CACATTTCAAGATTAGATTTGGG + Intergenic
1116415676 14:44673976-44673998 TACAATGCAAAATGAGATTTTGG + Intergenic
1117763421 14:59056778-59056800 AGCACTTCAAAAATAGATGTTGG - Intergenic
1117799781 14:59431303-59431325 CTCACTTCAAAAAGTGATTTAGG + Intronic
1117804528 14:59477359-59477381 CACACTGCTGAAGCAGATTTAGG - Intronic
1117907594 14:60606253-60606275 CACACTATAAAAAGAGTTTTTGG - Intergenic
1119196534 14:72721120-72721142 CACAGTGCAGAAATAGAGATAGG + Intronic
1119617135 14:76106235-76106257 AGCCCTGCAGAAATAGATTTGGG - Intergenic
1124796819 15:32789466-32789488 CACACTGCATAATGACATTTCGG + Intronic
1126942207 15:53779614-53779636 TACAATTCAAAAAGAGATTTGGG - Intergenic
1127377509 15:58398487-58398509 CATAGTGCAAAAGTAGATGTGGG + Intronic
1131189011 15:90299374-90299396 CATACTGAAAAAATAGTTATGGG + Intronic
1131974037 15:97924154-97924176 CACTCTGCAAAAAAAGATCTGGG + Intergenic
1132187415 15:99813637-99813659 GAAACTGCAAAAAAAGATTTAGG - Intergenic
1132978676 16:2723220-2723242 CTCCCTTCAAAAATAGAATTGGG + Intergenic
1135939429 16:26808588-26808610 AGCACTGCAAAAATAAATGTGGG - Intergenic
1140417472 16:74786311-74786333 CACCATTCAAGAATAGATTTGGG + Intergenic
1203012502 16_KI270728v1_random:310614-310636 CATTCTGCAAAAGTACATTTGGG + Intergenic
1203030837 16_KI270728v1_random:583773-583795 CATTCTGCAAAAGTACATTTGGG + Intergenic
1203040884 16_KI270728v1_random:750658-750680 CATTCTGCAAAAGTACATTTGGG - Intergenic
1143236570 17:5406703-5406725 CACACTGGAACAATTGTTTTGGG + Intronic
1144145301 17:12392026-12392048 CACCCTCCAAAAATAGGTTGTGG + Intergenic
1146588764 17:34109316-34109338 CAGAATGGAAAACTAGATTTTGG - Intronic
1146748873 17:35358850-35358872 CACACTTAAAAAATAGCTTAGGG + Intronic
1146749037 17:35360801-35360823 CACACTTAAAAAATAGCTTAGGG + Intronic
1147007241 17:37413270-37413292 CACACTCCTAATATAAATTTAGG + Intronic
1147893077 17:43731186-43731208 CACAATTCAAAATGAGATTTGGG - Intergenic
1148840341 17:50491607-50491629 CAGAATGCAAAATTAGATCTGGG - Intergenic
1148883821 17:50756724-50756746 CACACAGAAAACATACATTTAGG - Intergenic
1149904373 17:60511955-60511977 CACACTGAATATATAGATTCTGG + Intronic
1150987610 17:70215726-70215748 CACATTGCAAAAATATTTTCAGG - Intergenic
1151107819 17:71638404-71638426 CACACTTCAACATGAGATTTGGG + Intergenic
1153149046 18:2069040-2069062 CATAGTTCAAAAATAAATTTAGG + Intergenic
1153161866 18:2215577-2215599 CACACTGGAATAATTTATTTGGG + Intergenic
1158047098 18:53169536-53169558 CACACTGCCAACTTAGAGTTAGG + Intronic
1158464481 18:57678226-57678248 AAGACTGCAAAAATAGATAGTGG + Intronic
1162923324 19:13917010-13917032 CACACTGCATAAATATATTTTGG + Intronic
1164359345 19:27485470-27485492 CAAACTGCAAAAGTATATTTGGG + Intergenic
1164911513 19:32016039-32016061 CACACTGCATAACAACATTTTGG + Intergenic
1165150818 19:33759158-33759180 CACACTTCAACATGAGATTTGGG + Intronic
1167527357 19:49993378-49993400 CACACAGCAAAAAAAGAGTCTGG - Intronic
925601194 2:5610345-5610367 CACACTGAAAGAACAGGTTTGGG + Intergenic
926662765 2:15486250-15486272 TAAACTGGAAAAATAGATTTTGG - Intronic
928702472 2:33912909-33912931 CACACAGCAAAATTATATATTGG - Intergenic
929288189 2:40159858-40159880 CAGACTGGAAAAAGGGATTTGGG + Intronic
930666790 2:54107017-54107039 CACACTTCTAAAATACTTTTAGG - Intronic
931824425 2:65985000-65985022 ATCACTGGAAAAATAGACTTAGG - Intergenic
933099648 2:78237005-78237027 AACACTTCAAAATGAGATTTGGG + Intergenic
933851808 2:86373269-86373291 CCAACTGCAAAAAGGGATTTTGG + Intergenic
934865229 2:97803557-97803579 AACACTACAACAATAGAGTTAGG - Intronic
934899086 2:98142763-98142785 AACACTTCAAGAATAGATGTTGG + Intronic
936042897 2:109163219-109163241 CACACACCAAAAATAGTTCTGGG - Intronic
936771711 2:115921273-115921295 AACACTACAAAAAAAGCTTTTGG + Intergenic
936824129 2:116559782-116559804 CAAACTGTAAAAACAGATTTAGG - Intergenic
939488941 2:142853466-142853488 AACACTGCTGAAATAGTTTTTGG + Intergenic
941307656 2:163891561-163891583 CACAATTCAAAATGAGATTTGGG + Intergenic
942862595 2:180634185-180634207 CATACTTCTAAAATTGATTTAGG - Intergenic
943739156 2:191391909-191391931 AACACTGAAAAAGTAAATTTGGG - Intronic
944404606 2:199369124-199369146 CACACTGCAGAACAACATTTAGG + Intronic
945479089 2:210323525-210323547 CAAACTGGCAAAAGAGATTTTGG + Intergenic
946485427 2:220096570-220096592 CACACTGCAAAAAGCACTTTGGG + Intergenic
947003377 2:225484276-225484298 TACACTGAAAAAATACATGTTGG - Intronic
947562407 2:231168233-231168255 CACAGTGGAAAAAAAGAATTTGG + Intronic
947933335 2:233982675-233982697 CAAACTACAAAAATAATTTTGGG + Intronic
1169435219 20:5581184-5581206 CACACTGTAATAATACATTGAGG + Intronic
1170027336 20:11903949-11903971 CAATGTGCAAAAATATATTTTGG + Intronic
1171203559 20:23261272-23261294 CACACTGCAGAATTAAATTTGGG - Intergenic
1172099885 20:32478943-32478965 CACAATACAAAAATAAGTTTTGG + Intronic
1173029751 20:39344175-39344197 CACACTGCATAACAACATTTTGG + Intergenic
1173457677 20:43216519-43216541 CACACTTCCCAAATAGATTTTGG - Intergenic
1177308303 21:19350718-19350740 CACACAGCAAAAATAGATAACGG - Intergenic
1178190271 21:30271937-30271959 CACACTGAAACAATAATTTTAGG - Intergenic
1179556923 21:42184961-42184983 CACACTGAACAATCAGATTTGGG - Intergenic
1179955078 21:44734047-44734069 CAACATGCAAAAATAGATCTTGG + Intergenic
949896975 3:8775070-8775092 CATACTGTAAATATAGTTTTTGG - Intronic
950975267 3:17235681-17235703 CACCCTGAAATAAGAGATTTGGG - Intronic
951523819 3:23633914-23633936 CAGACTGCAAAAAGGGTTTTTGG - Intergenic
952802645 3:37310701-37310723 CACACTTTAAAAATACTTTTAGG - Intronic
953446344 3:42971591-42971613 GACAGTGCAAATATAAATTTTGG + Intronic
955694229 3:61619603-61619625 CTCACTGCAAAAATGGGCTTGGG + Intronic
956235418 3:67064491-67064513 CATACTTCTAAAATAGTTTTAGG - Intergenic
957402844 3:79738866-79738888 GACACTCCAAAAATAGATAGGGG + Intronic
959300714 3:104597255-104597277 CACACTACATAAATAGCATTTGG - Intergenic
959884281 3:111480662-111480684 CACCCATCAAAAACAGATTTTGG + Intronic
960610072 3:119547723-119547745 TAGGCTGCAAACATAGATTTAGG - Intronic
962153612 3:132919860-132919882 CAGAGTGAAATAATAGATTTCGG + Intergenic
962642853 3:137406559-137406581 CACACTGCAGGAATGGACTTTGG + Intergenic
962949206 3:140202622-140202644 CTGACTGCAGAAATAAATTTAGG + Intronic
963371648 3:144408548-144408570 CACACTGCAAAAAGAGCCCTAGG - Intergenic
963491295 3:146004643-146004665 AAGACTGCAAAAATATATTGTGG + Intergenic
963499661 3:146109534-146109556 CACATTGGAAAAATGGATTTTGG - Intronic
963680312 3:148366446-148366468 CAAAATGCACATATAGATTTAGG - Intergenic
963784627 3:149521634-149521656 CATACTGCCAAAATAGGTTTAGG - Intronic
963816995 3:149842195-149842217 CACAAGGCAAAAAGAGACTTAGG - Intronic
963833076 3:150029632-150029654 CACACTGGAAATATAAATTTGGG + Intronic
964158368 3:153614773-153614795 CACAATGGAGAAATAGATCTGGG + Intergenic
964292445 3:155196337-155196359 CACATTGCTCAAATAGCTTTGGG - Intergenic
964806822 3:160619287-160619309 CAGACTGGAAAGATAGGTTTTGG + Intergenic
965368961 3:167836991-167837013 CACTCTGCAAACACACATTTCGG - Intergenic
965620601 3:170639098-170639120 CCCTCTGCTAAATTAGATTTGGG + Intronic
966084180 3:176047282-176047304 TACACTGTAAAAATACATTAAGG - Intergenic
968116170 3:196091598-196091620 TACACGGCAAAACTAGATTTGGG - Intergenic
968179223 3:196578856-196578878 CACACTGGAAGAATTGTTTTGGG - Intronic
970535675 4:17027654-17027676 CACTCTGCCAAAATCTATTTTGG - Intergenic
970957287 4:21828945-21828967 AACTCTGCAAAAATACATATAGG + Intronic
971235733 4:24840426-24840448 AGCACTGCAAATATTGATTTTGG - Intronic
971278615 4:25221988-25222010 CACAATTCAAGATTAGATTTGGG + Intronic
971696224 4:29907256-29907278 TACAATTCAAAATTAGATTTGGG + Intergenic
971771540 4:30903773-30903795 AACACTGCAAATTTACATTTTGG - Intronic
973131622 4:46654781-46654803 CACAGTGGAATAATAGATTTTGG + Intergenic
975594599 4:76037268-76037290 CACACTTAAAACAAAGATTTAGG - Intronic
976197831 4:82550471-82550493 CTCAATGAAAAAATAGATTGAGG + Intronic
976897868 4:90133544-90133566 CCCACTGCTGAAATAAATTTTGG + Intronic
977078267 4:92487233-92487255 GAAACTGGAAAAATAAATTTAGG - Intronic
977163690 4:93669392-93669414 CACAGTACAAAAATATATATTGG + Intronic
977170951 4:93762183-93762205 CACACTGAATAAATCTATTTTGG - Intronic
978062965 4:104360818-104360840 CCCTTTGTAAAAATAGATTTGGG - Intergenic
978302005 4:107280827-107280849 CACATTTCCAAAAAAGATTTGGG + Intronic
978647557 4:110955819-110955841 CACACTGAATACATATATTTAGG - Intergenic
978845224 4:113265534-113265556 CACAGTTCCAAAATAGAATTTGG + Intronic
978882625 4:113725314-113725336 CACTCTGCAAAAATAGTTGCTGG - Intronic
980196781 4:129599653-129599675 CACAAGGCAAAGATAGTTTTGGG + Intergenic
980820834 4:138014687-138014709 AACACTGTAAAAATAATTTTTGG - Intergenic
981871247 4:149488399-149488421 CACTTTCCAAAAATACATTTGGG + Intergenic
984451769 4:179911920-179911942 AACACTGCAAAGAAAGATTAGGG - Intergenic
987815479 5:22895646-22895668 CACATTGTAAAAATAGTGTTTGG - Intergenic
988704544 5:33711503-33711525 CACACAGCACAAACAGATTTTGG + Intronic
990209572 5:53468218-53468240 TACACTTCAAAAGTACATTTTGG + Intergenic
990718259 5:58663415-58663437 CACATTTCAAAAAGTGATTTTGG + Intronic
991051339 5:62275554-62275576 AACTCTGCAAAAATGGATTCTGG - Intergenic
991121617 5:63021964-63021986 CACAATGCAAAAATAAATTGTGG - Intergenic
992309556 5:75481957-75481979 AACATTGTAAAAATATATTTTGG - Intronic
992349555 5:75915133-75915155 CACAATTCAAAATAAGATTTGGG + Intergenic
993643013 5:90428548-90428570 AACACTGAAAAAATGTATTTAGG + Intergenic
995161060 5:108982522-108982544 AAGACTGCAAAAATCAATTTTGG - Intronic
996346025 5:122489481-122489503 CACACTGCTAAAATACAAGTAGG + Intergenic
998343844 5:141442945-141442967 CTCACTGCAAAAAGACATTCTGG + Intronic
998616830 5:143750490-143750512 CACACAGCAAAAATAGATTCAGG + Intergenic
998706412 5:144766699-144766721 CATACTGCAAAAATATTTTGGGG - Intergenic
999920736 5:156317635-156317657 CACACTGAAAAACTATATTTGGG - Intronic
1000196918 5:158968624-158968646 CATACTTAAAAAATTGATTTGGG + Intronic
1000552362 5:162682762-162682784 CACAATGCAAAATTAAATTGAGG + Intergenic
1001748961 5:174113449-174113471 CACACTGAAGATATGGATTTTGG + Intronic
1002630369 5:180571071-180571093 AACTGTGTAAAAATAGATTTGGG + Intronic
1005165378 6:22913868-22913890 CCCACAGCAATAATAGCTTTAGG - Intergenic
1007956381 6:45921434-45921456 CACTCTGCCATAAGAGATTTGGG + Intronic
1008235262 6:49039110-49039132 TACAATTCAAAATTAGATTTGGG - Intergenic
1008888017 6:56452496-56452518 CACACTTCAAATATATTTTTGGG + Intergenic
1009838574 6:69037497-69037519 CACACTCTAAAATTAGTTTTAGG - Intronic
1010084230 6:71897615-71897637 CAGACTTCTCAAATAGATTTTGG + Intronic
1010337833 6:74709083-74709105 CACATAGCAAAAATAAAATTTGG + Intergenic
1010372887 6:75132098-75132120 CAGACTTAAAAAATAGATGTTGG - Intronic
1010809278 6:80280448-80280470 CAGACTGCAAAACAACATTTTGG + Intronic
1010878336 6:81137255-81137277 CACAGGACAAAACTAGATTTAGG - Intergenic
1012659698 6:101872555-101872577 CACAATTCAAGATTAGATTTGGG + Intronic
1013432993 6:110072203-110072225 AACAAAGTAAAAATAGATTTTGG + Intergenic
1013473085 6:110483059-110483081 CACATTGCAAAACAACATTTTGG + Intergenic
1014186957 6:118445716-118445738 CACACTGCCAGAATATTTTTTGG - Intergenic
1014691312 6:124566612-124566634 CACTATGCAATAAAAGATTTTGG + Intronic
1014925852 6:127268516-127268538 ACCACTCTAAAAATAGATTTTGG + Intronic
1015477282 6:133667924-133667946 CACCTTGTAAAATTAGATTTGGG - Intergenic
1016239280 6:141909516-141909538 AACAAAGCAAAACTAGATTTGGG - Intergenic
1016286954 6:142484383-142484405 TACACTTCAAAATGAGATTTGGG - Intergenic
1016462593 6:144292802-144292824 CACACAGCAAAAACAGGCTTTGG - Intronic
1016915573 6:149241251-149241273 CAGACTAAAACAATAGATTTTGG + Intronic
1017721278 6:157244979-157245001 CACACTGGAAGAAGAGATCTCGG - Intergenic
1018419079 6:163626415-163626437 CACAGTGCAACATGAGATTTGGG + Intergenic
1018483180 6:164212712-164212734 GACATTGCAAAAATGTATTTTGG - Intergenic
1020181556 7:5926593-5926615 CAAACTGCAAAACCAGTTTTAGG + Intronic
1020193658 7:6020118-6020140 CACATTGAAAATGTAGATTTTGG + Intronic
1020301377 7:6798296-6798318 CAAACTGCAAAACCAGTTTTAGG - Intronic
1020902290 7:14020070-14020092 CAAATTGCAAATATAAATTTAGG - Intergenic
1020939606 7:14515546-14515568 CAGATTTCAAAAAGAGATTTAGG + Intronic
1021381179 7:19968303-19968325 CACACTGGAAATATAAATTTAGG - Intergenic
1022270692 7:28804772-28804794 CACACTGCAAAAATAGATTTTGG - Intronic
1024271890 7:47648896-47648918 CCCAATTCAGAAATAGATTTAGG + Intergenic
1025530433 7:61874498-61874520 GAAACTGCAAAAGTATATTTGGG - Intergenic
1026232961 7:68501360-68501382 CACTTTGCAATAATATATTTTGG - Intergenic
1028140438 7:87268293-87268315 AACACTTCAAACATAGATTGAGG - Intergenic
1028325432 7:89518438-89518460 GAGACAGCATAAATAGATTTAGG - Intergenic
1028397547 7:90387967-90387989 CACAGTGCAAAATGAGATTATGG - Exonic
1028929862 7:96401125-96401147 CACATTTCAAGGATAGATTTTGG + Intergenic
1029865167 7:103620028-103620050 CACAATGCAAGATGAGATTTGGG - Intronic
1030428575 7:109412386-109412408 CCTACTTCAAAAATGGATTTTGG + Intergenic
1030575060 7:111275454-111275476 CACACTCCAAAAACAGTTGTGGG + Intronic
1031351666 7:120739624-120739646 CACACAGGAAGAATAAATTTAGG + Intronic
1031546915 7:123062349-123062371 CACATAGCATAATTAGATTTAGG + Intergenic
1032377714 7:131439604-131439626 GACACTCCAAAAATAGCTTGTGG + Intronic
1034051094 7:147985232-147985254 CATCCTGGAAAAATAGATTATGG - Intronic
1034057175 7:148047731-148047753 AGCACTGCAAGTATAGATTTGGG + Intronic
1036038602 8:5048318-5048340 CACATTGGAAGACTAGATTTTGG - Intergenic
1036174842 8:6527595-6527617 CAAATTGGAAAAACAGATTTTGG - Exonic
1036179569 8:6572597-6572619 CACAGTGAAAAAATATTTTTAGG + Intronic
1036636404 8:10553028-10553050 TACACTTCAAAATGAGATTTGGG - Intronic
1036682197 8:10883620-10883642 CACACAGCAAAAGTAGACTTGGG - Intergenic
1037206609 8:16328619-16328641 CAGAATCCAAATATAGATTTTGG - Intronic
1037311525 8:17561504-17561526 CACAATTCAAAATGAGATTTGGG + Intronic
1037524920 8:19715287-19715309 CACAATTCAAAATGAGATTTGGG + Intronic
1038353435 8:26803889-26803911 CACTCTGCAAAAGAATATTTTGG + Intronic
1039410615 8:37352251-37352273 CACTCTCCAAAAATGGGTTTTGG - Intergenic
1039649049 8:39320759-39320781 CACACTGGAAGAATTGTTTTGGG + Intergenic
1040112477 8:43573517-43573539 GAAACTGCAAAAAGACATTTGGG + Intergenic
1040112677 8:43576415-43576437 GAAACTGCAAAAAGACATTTGGG + Intergenic
1040523020 8:48193909-48193931 CACACTGCAAAACTAGATCCAGG - Intergenic
1040820731 8:51553775-51553797 CACACTGAAAATATAAATCTCGG + Intronic
1040882073 8:52216686-52216708 CTCAATTCAAAAATAGGTTTTGG + Intronic
1041340000 8:56835008-56835030 AACACTGCAGATACAGATTTAGG + Intergenic
1041627804 8:60050610-60050632 CACACTGGAAGAATGCATTTTGG + Intergenic
1041756924 8:61324179-61324201 CACAATTCAAGAAAAGATTTGGG - Intronic
1042299628 8:67263129-67263151 TAGACTCTAAAAATAGATTTAGG - Intronic
1042725372 8:71869394-71869416 CAAATTGCAAAGATATATTTTGG + Intronic
1044100584 8:88132101-88132123 TCCACAGCTAAAATAGATTTTGG - Intronic
1044267176 8:90195824-90195846 GACACTGCAAATAAAAATTTTGG + Intergenic
1044703059 8:94981808-94981830 CACACTGCATAATGACATTTTGG + Intronic
1046846006 8:118916974-118916996 CACATTTCAAATATAGGTTTAGG - Intergenic
1052043309 9:23766259-23766281 CCCACTGTAACAAGAGATTTTGG + Intronic
1053090260 9:35268890-35268912 CACAGTGTAATAATAAATTTAGG - Intronic
1053873093 9:42514189-42514211 CACACTGTATAAACAGATATTGG - Intergenic
1053899660 9:42781731-42781753 CACACTGTATAAACAGATATCGG + Intergenic
1054269237 9:62952563-62952585 CACACTGTATAAACAGATATTGG + Intergenic
1054945458 9:70791678-70791700 GACACTGAAAATATAGAGTTTGG + Intronic
1055080005 9:72259321-72259343 CTCACTGCAAAAATAGAAAGTGG - Intergenic
1055081487 9:72271617-72271639 CGCCCTGCAAAAATAGATGGTGG + Intergenic
1055234000 9:74097189-74097211 TACATAGCAAAATTAGATTTTGG + Intergenic
1055253802 9:74341417-74341439 CACTCTGCAAAAATACCATTTGG + Intergenic
1055884354 9:81042321-81042343 CACACAGAAAAAACATATTTCGG + Intergenic
1056945249 9:90989537-90989559 CACTTTAAAAAAATAGATTTAGG + Intergenic
1057952756 9:99383009-99383031 AACTGTGAAAAAATAGATTTCGG + Intergenic
1058018516 9:100064650-100064672 CACACTGCATAAAAATGTTTTGG + Intronic
1058074759 9:100639155-100639177 CATTCTGCAAATATAGGTTTTGG + Intergenic
1058214322 9:102214948-102214970 CACATTTCAAATGTAGATTTGGG - Intergenic
1058314326 9:103545245-103545267 GAGACAGCAAAATTAGATTTGGG + Intergenic
1058917466 9:109581466-109581488 CACACTTTAAAAATAGCTGTTGG - Intergenic
1062182943 9:135200630-135200652 CACAATTCAAGAAGAGATTTGGG + Intergenic
1185872623 X:3676710-3676732 CACACTTCAAGATTAGACTTGGG - Intronic
1185926869 X:4156950-4156972 CACACTTCTTAAGTAGATTTTGG - Intergenic
1186315393 X:8364504-8364526 AACACTTCAAAAGTAGATTACGG - Intergenic
1186384847 X:9099561-9099583 CACACTTCAAAGGTAGCTTTGGG + Intronic
1186435686 X:9541386-9541408 CAAACTGCAAAAATCGGTTCTGG + Intronic
1186614698 X:11174350-11174372 CACAAGGCAAATATAGAATTAGG - Intronic
1186879146 X:13847445-13847467 CAAACTGCAAAAATATAAGTAGG - Intronic
1188284278 X:28309129-28309151 TAAACTTAAAAAATAGATTTTGG + Intergenic
1190473912 X:50809546-50809568 CACTCTGCAAATAGAGACTTGGG + Intronic
1191987564 X:66999077-66999099 CAAACTGTAAAATTAGAATTAGG - Intergenic
1192297046 X:69861599-69861621 CACACTTACAAAATAAATTTAGG + Intronic
1192884450 X:75322013-75322035 CACACTGGAATAATGGACTTTGG - Intergenic
1193044508 X:77037361-77037383 TGCACTGCAAAAACACATTTAGG - Intergenic
1193265205 X:79460511-79460533 CTCACTGCAAAAGTACATTTTGG + Intergenic
1193682522 X:84540265-84540287 CACAATTCAAAAAGAGATTTGGG - Intergenic
1194258518 X:91665541-91665563 CAAATTGCAAAAATATATATAGG - Intergenic
1194341194 X:92707740-92707762 ATCACTTCAGAAATAGATTTAGG - Intergenic
1194480555 X:94416662-94416684 CACACAACAAAAATGGATTGTGG + Intergenic
1195570989 X:106398289-106398311 AGCACTGCAAGAATTGATTTGGG - Intergenic
1195743432 X:108090263-108090285 CCAACTGCAAAAAGACATTTGGG - Intronic
1195790519 X:108579784-108579806 CACACGGCATACATATATTTTGG - Intronic
1197555231 X:127944992-127945014 CAGATTGTAAAAATAGAATTAGG + Intergenic
1197964805 X:132048576-132048598 CTCCCTGTAAAAATATATTTTGG + Intergenic
1200275954 X:154732755-154732777 CACCCTGAAAAAATTCATTTGGG - Intronic
1201899445 Y:19033746-19033768 CACAATTCAAAATAAGATTTGGG - Intergenic