ID: 1022270976

View in Genome Browser
Species Human (GRCh38)
Location 7:28807810-28807832
Sequence TTGAGAATGAAGAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1089
Summary {0: 1, 1: 0, 2: 2, 3: 118, 4: 968}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022270971_1022270976 23 Left 1022270971 7:28807764-28807786 CCTGAGTGACTAAGAAATGGGAG 0: 1
1: 0
2: 0
3: 13
4: 183
Right 1022270976 7:28807810-28807832 TTGAGAATGAAGAAGGAGGAAGG 0: 1
1: 0
2: 2
3: 118
4: 968

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022270976 Original CRISPR TTGAGAATGAAGAAGGAGGA AGG Intronic
900977146 1:6025059-6025081 GGGAGAAGGGAGAAGGAGGAAGG - Intronic
901168854 1:7239875-7239897 ATGAGAATGAGAGAGGAGGAGGG + Intronic
901319597 1:8331534-8331556 TGGAGGCTGAAGAAGGAGGATGG + Intronic
901386126 1:8910474-8910496 TGGAGAATGAGGAAGGTGGCAGG + Intergenic
901867990 1:12120018-12120040 TTCAGAACTAAGAAGGAGGTGGG - Intronic
902444210 1:16451835-16451857 TAGAACATGAAGAAGAAGGAAGG + Exonic
902772632 1:18654503-18654525 TGGAGATTTAGGAAGGAGGAAGG - Intronic
902797963 1:18811644-18811666 GGGAGAAAGATGAAGGAGGAAGG - Intergenic
903406263 1:23099095-23099117 TTGAGAATGAGGAAGCAGGTAGG - Intronic
903467244 1:23560093-23560115 CTGAGATTGCAGAAGGAGGAGGG + Intergenic
903799465 1:25955736-25955758 GAGGGAAGGAAGAAGGAGGAAGG + Intergenic
904248618 1:29206152-29206174 TGGAGAATAAAGAACGTGGAGGG - Intronic
904295760 1:29518852-29518874 AGGAGAATGAGGAAGGAGGAAGG - Intergenic
904295768 1:29518891-29518913 AGGAGAAGGAAGAAGGAAGAAGG - Intergenic
904493935 1:30876520-30876542 TTGAGAAGGGACAGGGAGGAGGG - Intronic
904610119 1:31721190-31721212 ATGAGCCTGAGGAAGGAGGAGGG + Intergenic
904758418 1:32782904-32782926 CTGAGTAAGAAGAAAGAGGAAGG + Intronic
904834203 1:33324439-33324461 TGGAGAAAGAAGTGGGAGGAAGG + Exonic
905013110 1:34760228-34760250 TTGGGGATGGGGAAGGAGGAGGG + Intronic
905116622 1:35646781-35646803 TTTAGAATGAAGGGGGAGCAGGG + Intergenic
905330596 1:37193047-37193069 TGGAGCATGAAGAAGGAGGTTGG - Intergenic
905502073 1:38447365-38447387 ATGATAATGAAGAATGAGAAGGG + Intergenic
905755999 1:40509372-40509394 TTGAGAATGGAGCTGGAAGAGGG + Exonic
905906455 1:41621617-41621639 TTGAGACTGAAGCGGGTGGATGG - Intronic
906324925 1:44839608-44839630 TGGGGAATGGAGAGGGAGGAAGG + Intronic
906457506 1:46009772-46009794 TGGAGAATGAAAGAGGAAGAGGG - Intronic
906582904 1:46951170-46951192 ATAAGAATGAAGAAGGATAATGG - Intergenic
906794203 1:48683869-48683891 TGGAGAATGAATGAGGAAGACGG + Intronic
907125199 1:52043927-52043949 TTGGGAATGAAAAGTGAGGATGG - Intronic
907473446 1:54689615-54689637 TTGGGTTTGAAGGAGGAGGAGGG + Intronic
907703223 1:56810018-56810040 GAGAGAAAGAAGGAGGAGGAAGG + Intronic
908029367 1:59983591-59983613 TTGAGACTTACCAAGGAGGAAGG + Intergenic
908142307 1:61198919-61198941 TTCAGAGTGATGAAGGAGGGGGG - Intronic
908233668 1:62130227-62130249 AAGAGACTGAAGCAGGAGGATGG + Intronic
908331478 1:63074970-63074992 TTGAGGATGGGGAGGGAGGAGGG - Intergenic
908826084 1:68134049-68134071 ATGAGAATGGAAAAGGAGCATGG + Intronic
908888146 1:68813693-68813715 CTGACTTTGAAGAAGGAGGAAGG + Intergenic
909187478 1:72506593-72506615 TTGAGATTGGAGAGGTAGGAAGG + Intergenic
910203837 1:84727374-84727396 TTGAGAAGGAAAATGGAGGTGGG - Intergenic
910207800 1:84765205-84765227 TTGACTTTGAAGATGGAGGAAGG - Intergenic
910758229 1:90712707-90712729 GGGAGAATGAAGGAGGAGGCAGG - Intronic
911625364 1:100117824-100117846 TTAAGAATTAAGAAGGTGGCAGG + Intronic
911653165 1:100412491-100412513 AGGAAAATGAAGAAGGAGGAAGG - Intronic
911770635 1:101736632-101736654 TAGAGAATGAAGAAGAATGAGGG - Intergenic
912168529 1:107069400-107069422 ATAATAATAAAGAAGGAGGAGGG + Intergenic
912233864 1:107827291-107827313 TGGAGAATAAGGAAGGAAGAGGG - Intronic
912489305 1:110052984-110053006 AGGAGAATGAAAAAGGACGAGGG - Intronic
912578018 1:110693486-110693508 TAGAGTCTGAAGAAGGAGAAGGG - Intergenic
913320690 1:117586548-117586570 TACAGTATGAAGAAGGAGAAGGG + Intergenic
913440109 1:118888040-118888062 TTGAGTATTAGAAAGGAGGAAGG - Intronic
913691176 1:121281332-121281354 AAGAGAATGAAGAAGGAAGAAGG - Intronic
914328727 1:146646268-146646290 TTAATACTGAAGAAGGAGAAAGG - Intergenic
914730301 1:150364096-150364118 TTGAGAAGGAAGCAGGGGTAGGG + Intronic
915119492 1:153619988-153620010 TTAAGAAAGAAGAAGCAGGAAGG + Intronic
915281730 1:154827393-154827415 GTGAGATTGAGGAATGAGGAAGG - Intronic
915447661 1:155983311-155983333 ATGGGAAGGAAGAAAGAGGAAGG + Intronic
916189058 1:162161139-162161161 TGGGGAAGGAAGAATGAGGAGGG - Intronic
916509669 1:165460905-165460927 TTGAGAAGGAAGTAGAAGGTGGG - Intergenic
916722276 1:167493361-167493383 TGGAGAAGGAAAAAGGAAGATGG - Intronic
916874907 1:168958790-168958812 TTGAGATAGGGGAAGGAGGAGGG - Intergenic
916915028 1:169397189-169397211 ATGAACATGAGGAAGGAGGAGGG + Intronic
917313594 1:173702595-173702617 AGGAGAAGGAGGAAGGAGGAAGG + Intergenic
918188457 1:182148437-182148459 AGGAGAAGGAAGTAGGAGGAAGG - Intergenic
918331120 1:183461502-183461524 TTGAGAAAGAAGAAAGAATAGGG - Intergenic
918355017 1:183699816-183699838 TTGGGCTTGAAGAATGAGGAAGG - Intronic
918394694 1:184101610-184101632 GTGAGCATGAGGAAGGAGGTAGG + Intergenic
918448269 1:184635358-184635380 GGGAGAAAGAAGAAGGAGGAAGG - Intergenic
918703829 1:187637389-187637411 TTGGGGATGGAGAAGGAGGAGGG - Intergenic
919052572 1:192529505-192529527 TTAAGAATGAGAAAAGAGGAGGG + Intergenic
919434828 1:197544961-197544983 AGGAGAAGGAGGAAGGAGGAAGG + Intronic
919514392 1:198503711-198503733 TTGAGAAAGAAGAATGAAGCTGG - Intergenic
919706682 1:200682963-200682985 TTGAGAATCCAGAAGGATGGGGG + Intergenic
920044946 1:203127111-203127133 ATGAAGAGGAAGAAGGAGGAAGG + Exonic
920341552 1:205278273-205278295 GAGAAAATGAAGAAGAAGGAAGG - Intergenic
920478500 1:206299808-206299830 AAGAGAATGAAGAAGGAAGAAGG - Intronic
920619387 1:207529179-207529201 TGGAAAAGAAAGAAGGAGGAAGG - Intronic
920621169 1:207547734-207547756 TGGAAAAGAAAGAAGGAGGAAGG - Intronic
921037530 1:211396085-211396107 TAGAAAATGGAAAAGGAGGACGG - Intergenic
921787220 1:219245074-219245096 AAGAGAAAGAAGAAAGAGGAAGG - Intergenic
921841850 1:219836630-219836652 CTGAGATTGAAGAAAGAGGCTGG - Intronic
921969339 1:221129203-221129225 ATGGGAAGGAAGGAGGAGGAGGG + Intergenic
922004659 1:221517615-221517637 AAGACAATGAACAAGGAGGAGGG + Intergenic
922020783 1:221702351-221702373 GAGACAATGAGGAAGGAGGATGG - Exonic
922163897 1:223098777-223098799 TTCAGAAGGAAGAGGGATGAGGG + Intergenic
922774798 1:228209720-228209742 AAGAGACTGAAGCAGGAGGATGG - Intronic
923263651 1:232291488-232291510 CTGAGAAGGAAGATGGAAGAAGG + Intergenic
923663588 1:235979629-235979651 AGGAGCATGAAGAAGGAGGGAGG - Intronic
923688883 1:236174286-236174308 ATAAAAATCAAGAAGGAGGAAGG + Intronic
923908056 1:238407972-238407994 TTCAGACAGAAGAAAGAGGATGG + Intergenic
924700301 1:246444564-246444586 TTGTGAATGGAGAGGTAGGAAGG + Intronic
1063040481 10:2332605-2332627 TGGGGATTAAAGAAGGAGGATGG - Intergenic
1063440794 10:6071423-6071445 TGGAGGAAGAGGAAGGAGGAGGG - Intergenic
1063513974 10:6675738-6675760 TTGAGAATTAAAAAGCAGAATGG - Intergenic
1063535092 10:6875762-6875784 TTTAAAATGAAGTAGAAGGAGGG - Intergenic
1063538447 10:6908561-6908583 TTGAGAAAGCAGAAGCAGGAAGG + Intergenic
1063832982 10:9977886-9977908 TAGACACTGGAGAAGGAGGAAGG + Intergenic
1063945654 10:11173694-11173716 TAGATAATGAAGCAGGAGAATGG - Intronic
1064053387 10:12077679-12077701 ATGTCAATGAAGAATGAGGAGGG + Intronic
1064151709 10:12871125-12871147 TGGAAAATGAGGAAGGAAGAAGG + Intergenic
1064297781 10:14093994-14094016 ATGATAATGGAGCAGGAGGATGG + Intronic
1064331848 10:14401592-14401614 CTGAGCATGGAGAGGGAGGAGGG - Intronic
1064659525 10:17592434-17592456 TTAAGAATGCAGGGGGAGGAGGG + Intronic
1066761436 10:38757278-38757300 GTGAGAATGAAGAATAAGGTGGG + Intergenic
1066960150 10:42215146-42215168 GTGAGAATGAAGAATAAGGTGGG - Intergenic
1067454786 10:46411669-46411691 TTGAGAATGAGAAAGCAGGAAGG + Intergenic
1067495784 10:46758829-46758851 TTTAGAATGAAGAAGGATGGAGG + Intergenic
1067528834 10:47055732-47055754 TTAACAGGGAAGAAGGAGGAGGG + Intergenic
1067598870 10:47581561-47581583 TTTAGAATGAAGAAGGATGGAGG - Intergenic
1067632418 10:47972965-47972987 TTGAGAATGAGAAAGCAGGAAGG - Intergenic
1067948531 10:50708144-50708166 TTTAGAATGGAGAAGGATGGAGG - Intergenic
1068155868 10:53197841-53197863 TTGAGAATGAAGAACAAAGCTGG - Intergenic
1068174002 10:53433469-53433491 AAGGGAAAGAAGAAGGAGGAAGG + Intergenic
1068213561 10:53952964-53952986 TTGAGCATGCAGCAGGAGGGGGG + Intronic
1068884234 10:62082008-62082030 TTAAGAAAGAAGAATGAGGAGGG + Intronic
1069089598 10:64183687-64183709 TTGAGAAAGATGTAGAAGGATGG + Intergenic
1069265692 10:66454770-66454792 ATGAAGATGAAGGAGGAGGAAGG + Intronic
1069617810 10:69817407-69817429 TTGACAATGAAGTTGGGGGAGGG + Intronic
1069621093 10:69837696-69837718 TGGAGGATGATGAAGCAGGAGGG - Intronic
1069959352 10:72070462-72070484 GTGACAATGAGGAAGGAGCAGGG + Intronic
1070344323 10:75526752-75526774 TGGAGACTAAAGCAGGAGGATGG + Intronic
1070444615 10:76484153-76484175 GAGAGGAAGAAGAAGGAGGATGG - Intronic
1070484829 10:76920248-76920270 TTGAGAATGAAGAAGAGAGGGGG + Intronic
1070493124 10:76995911-76995933 TTGGGAAACAAGAAGGAGAAAGG - Intronic
1070544642 10:77442777-77442799 TTGGGTGTGAAGGAGGAGGAGGG - Intronic
1070883852 10:79873139-79873161 TTTAGAATGGAGAAGGATGGAGG - Intergenic
1071400492 10:85264147-85264169 TTGAGAATGCAGTAGGAGTGTGG - Intergenic
1071444897 10:85736304-85736326 GAGAGAAGGAAGAAAGAGGAAGG + Intronic
1071462137 10:85908734-85908756 TTGAAAATGAAGAACAAGGCAGG + Intronic
1071544047 10:86514487-86514509 TTGTGAAGGAGGAAGGAAGATGG + Intronic
1071650408 10:87389441-87389463 TTTAGAATGGAGAAGGATGGAGG - Intergenic
1071778094 10:88811577-88811599 TAGAGAATAGAGAAGGATGAAGG - Intronic
1071950076 10:90693172-90693194 TTGACAAAGAAAAAGGAAGATGG + Intergenic
1071998275 10:91168291-91168313 CTGAGAAGAAAGAAGCAGGAGGG + Intronic
1073010527 10:100355799-100355821 TTGAGAATGAAGACTGAGAAAGG + Intronic
1073096813 10:100984863-100984885 TTGAGAATGACCAAGGAGAGTGG - Exonic
1073120516 10:101119827-101119849 TTCAGAAGCAAGGAGGAGGAGGG + Intronic
1073131960 10:101195383-101195405 TTGGGAGTGAGGAAAGAGGAAGG - Intergenic
1073480738 10:103784749-103784771 AGGAGAAGTAAGAAGGAGGAAGG + Intronic
1074079007 10:110152684-110152706 TTCTGAATGGGGAAGGAGGAAGG + Intergenic
1074350301 10:112730246-112730268 TTAAGAATGCAGAGGAAGGAGGG - Intronic
1074358067 10:112803362-112803384 TCTAAAATGAAGAAGGAGGCTGG - Intronic
1074372849 10:112914188-112914210 CTGAAAAGAAAGAAGGAGGAAGG - Intergenic
1074389279 10:113043587-113043609 TGGGGAAGGAAGAAGGAAGAGGG - Intronic
1074947422 10:118294949-118294971 TTGACATGGAAAAAGGAGGAAGG + Intergenic
1075337208 10:121617153-121617175 TTGGAAAAGGAGAAGGAGGAAGG + Intergenic
1075382472 10:122030602-122030624 AGGAGAATGAAGACTGAGGAGGG - Intronic
1075513779 10:123093528-123093550 TTGAGAAGGAAGATGGTGGAAGG + Intergenic
1075709183 10:124521579-124521601 GGGAGAATGAAGGGGGAGGAGGG + Intronic
1076185906 10:128448567-128448589 CTGATAATGAAGATGGAGGCAGG + Intergenic
1076305013 10:129460038-129460060 GTGAGGATGCAGAAAGAGGATGG + Intergenic
1077164779 11:1130123-1130145 TTGTGAATGAACAAGGAACAAGG - Intergenic
1077344799 11:2041717-2041739 TGGAGAATGAAGAATGAGCATGG - Intergenic
1077345211 11:2045077-2045099 TGGAGAATGAAGATGGAGAAAGG - Intergenic
1077345945 11:2053649-2053671 TGGAGAATGAAGTAGAAGAATGG - Intergenic
1077346569 11:2060456-2060478 TGGAGAATGAATAAAGAGTAAGG - Intergenic
1077392509 11:2306733-2306755 AGGAGGACGAAGAAGGAGGAGGG + Intronic
1077483842 11:2829964-2829986 ATGAGAAGGAAGGAGGAGGGAGG + Intronic
1077586959 11:3461138-3461160 ATGAGAATGAAGGAAGAGAATGG - Intergenic
1077619149 11:3703925-3703947 AGGAGACTGAGGAAGGAGGATGG - Intronic
1077743567 11:4875567-4875589 TTGACATTGAAGATGAAGGAAGG - Intronic
1077783856 11:5361320-5361342 GGGAGAATAAAGAAGGAGGGAGG + Intronic
1078373729 11:10774866-10774888 TTGGGAAAGAAGGAAGAGGAAGG + Intronic
1078522904 11:12077645-12077667 TGGAGAATGAAAAAGGCAGAGGG - Intergenic
1078584978 11:12576893-12576915 TTGAGAATGAAGGAGAAATAAGG - Intergenic
1078609792 11:12810273-12810295 TTAAGAATGGGGAAAGAGGAAGG - Intronic
1078861271 11:15249429-15249451 TTCAGAAAGAAGAACCAGGAAGG + Intergenic
1079192542 11:18292488-18292510 TTGAAATTGAAGAAGTAGGCTGG - Intronic
1079231404 11:18652077-18652099 TTGAGCATGAAGAATAAGCAAGG + Intergenic
1079299718 11:19267187-19267209 GAGAGAAGGAACAAGGAGGAGGG - Intergenic
1079445567 11:20553668-20553690 AGGAGAAAGAAAAAGGAGGAAGG - Intergenic
1079645198 11:22854632-22854654 TAGAGAATGCAGAAGAAGAATGG + Intronic
1079652879 11:22951763-22951785 CTGAGAAAGAAGAAAGAAGATGG - Intergenic
1080295297 11:30720326-30720348 AAGAGAAAGAAGAAGGAAGAAGG - Intergenic
1080709628 11:34734389-34734411 CTGAGCATGCAGAAAGAGGATGG - Intergenic
1080912931 11:36623449-36623471 TTGACAGTGAAAAAGGATGATGG + Intronic
1080937240 11:36877012-36877034 TTGACAATTAAGAAGCAAGAAGG - Intergenic
1081051334 11:38345195-38345217 TTGGAAATGAGGAAGGAGCAAGG - Intergenic
1081659487 11:44879267-44879289 TAGGGAAAGAAGAAGGAGGAAGG - Intronic
1081932554 11:46882155-46882177 ATGGGAATAAAGAAAGAGGAGGG + Intronic
1081989397 11:47329652-47329674 TTGGGAATGCAGAAGGAAGCAGG - Exonic
1083228328 11:61298943-61298965 TTGAGAATACAGCAGGAGTAGGG - Intergenic
1084242957 11:67835170-67835192 ATGAGAATGAAGGAAGAGAATGG - Intergenic
1084394003 11:68897026-68897048 ATGAGAATGAACCAGGTGGAGGG - Intronic
1084830035 11:71761805-71761827 ATGAGAATGAAGGAAGAGAATGG + Intergenic
1084952521 11:72674443-72674465 CTGATAATGCAGAAGGGGGAGGG + Exonic
1085101578 11:73805204-73805226 CTGAGAATGGGGAAGGAGCAAGG - Intronic
1085169021 11:74432239-74432261 TTGAGAAAGAACAAGGTAGAAGG + Intergenic
1085190725 11:74619442-74619464 TTGGGAAAGAAGAAGGATGGAGG + Intronic
1085219708 11:74863273-74863295 ATGAGACTGAAGAAGTAGGCAGG - Intronic
1085593183 11:77784106-77784128 TTGAGATCCTAGAAGGAGGATGG - Intronic
1085704232 11:78771495-78771517 ATGAGAATGAACAAGAAGCAAGG - Intronic
1085807656 11:79651035-79651057 TGGAGGAAGAAGAAGAAGGAAGG - Intergenic
1085825835 11:79846346-79846368 ATGAGAGAGAAGAAGGTGGAGGG + Intergenic
1085850781 11:80117152-80117174 TTGAGCACAAAGGAGGAGGAGGG - Intergenic
1086263918 11:84975099-84975121 GTGAGAATGGGTAAGGAGGAGGG + Intronic
1086360532 11:86054373-86054395 TCTAAAATGAAGACGGAGGATGG + Intronic
1086457076 11:86969537-86969559 TTGAAAAGGAAGAAGGAGAAAGG - Intergenic
1086733575 11:90278927-90278949 TTGAGAAAGAAGAGCGAGGCTGG - Intergenic
1086814470 11:91351620-91351642 TTGAGTATGATGAATGAAGAAGG - Intergenic
1086869638 11:92021473-92021495 TTGAAACTCCAGAAGGAGGAGGG - Intergenic
1087126385 11:94630366-94630388 CTGAGAAGGAAGGAAGAGGAGGG + Intergenic
1087207925 11:95416856-95416878 TTGGGAATGATGGTGGAGGAAGG - Intergenic
1087277137 11:96171849-96171871 CTGAGAATGGAGAAGGTGGCAGG - Intronic
1087307333 11:96502140-96502162 TTGAGACTGACGAAGGAAAATGG - Intronic
1087349142 11:97008906-97008928 TGGAGGGTGAAGAAGGAAGATGG - Intergenic
1087533326 11:99411413-99411435 GGGAGACTGAGGAAGGAGGATGG + Intronic
1087660700 11:100984647-100984669 TTTAGAATGAGGAATGAGGCTGG + Intronic
1087669576 11:101089679-101089701 TTGAGGGAGAAGAGGGAGGAAGG + Intronic
1087677650 11:101181213-101181235 ATAAGAATGAAGAAGGAAGAAGG + Intergenic
1088155120 11:106793071-106793093 TTGAGAATGAAGAACAAAGCTGG + Intronic
1088565999 11:111173661-111173683 TTAAAAAGGAAGAAAGAGGAAGG + Intergenic
1088727940 11:112656110-112656132 TGGAGAATGAAGGAGTAGCAAGG - Intergenic
1088801314 11:113309912-113309934 TTGAGGATCTAGAAGGAGGTCGG - Intergenic
1088903873 11:114139365-114139387 CGGAGAGTGAAGAAGCAGGAAGG - Intronic
1089380659 11:118028873-118028895 TTGGGGGAGAAGAAGGAGGAGGG + Intergenic
1089831132 11:121329179-121329201 CTGAGACTGAAGAAGAGGGAAGG - Intergenic
1089843358 11:121438443-121438465 GTGAGAATGTAGAGGGAGGGTGG - Intergenic
1089920677 11:122206749-122206771 CTGAGGAGGAAGAAGGAGGCCGG + Intergenic
1090254418 11:125273347-125273369 GGGAGAATGCAAAAGGAGGATGG + Intronic
1090807279 11:130210396-130210418 TCGAGTAGGAAAAAGGAGGAAGG - Intergenic
1090887935 11:130895764-130895786 TTGAGATTGTAGCAGGTGGATGG - Intronic
1091079880 11:132656466-132656488 TTAAAAAGGGAGAAGGAGGAAGG - Intronic
1202827785 11_KI270721v1_random:96907-96929 TGGAGAATGAAGAATGAGCATGG - Intergenic
1091650880 12:2308624-2308646 TTGAGAAAGAAGAACGAAGCTGG - Intronic
1091834059 12:3572081-3572103 TTGAGAAAGAAGAAGAAAGGAGG - Intronic
1091964695 12:4728797-4728819 TTGAGAAAGAAGAAGAAAGTTGG - Intronic
1091985226 12:4905437-4905459 TTGAGAAAGCAAAAGGAGAATGG - Intergenic
1092023174 12:5219255-5219277 ATGAAAATGAAAAAAGAGGATGG + Intergenic
1092413197 12:8269883-8269905 ATGAGAATGAAGGAAGAGAATGG - Intergenic
1092509326 12:9137466-9137488 TTGAGAAAGAAGAAGAAAGCTGG - Intergenic
1092509938 12:9144212-9144234 GTGAGGATGAGGGAGGAGGAGGG + Intergenic
1092641249 12:10513067-10513089 TTTTGAATGAGGTAGGAGGACGG - Intronic
1092844292 12:12569596-12569618 GGGAGACTGAAGCAGGAGGATGG - Intergenic
1093103999 12:15064149-15064171 TTGAGAAATAAGAAAGAGTAAGG - Intergenic
1093105885 12:15086583-15086605 CTGACTTTGAAGAAGGAGGAAGG - Intergenic
1093146293 12:15570650-15570672 TTGGAAATGAATGAGGAGGATGG + Intronic
1093508402 12:19896778-19896800 AGGAGAAGGAAGGAGGAGGAAGG - Intergenic
1093531957 12:20176079-20176101 TTGGGGAGGAAGAAGGATGAAGG - Intergenic
1093558679 12:20510821-20510843 CTGAGAGTGAAGAGGAAGGAAGG + Intronic
1093660716 12:21753474-21753496 TAGAGAATAAGGTAGGAGGATGG + Intronic
1094149273 12:27264347-27264369 GTGAGAATGAAGAATAAGGTGGG + Intronic
1094772758 12:33684498-33684520 TGAAGAAGGAAGAAGGAAGAGGG - Intergenic
1094794288 12:33952478-33952500 TTGAAAATGAGTAAGGAAGATGG - Intergenic
1095538889 12:43285318-43285340 CTGAGAAACAAGAAGGAGGTTGG - Intergenic
1095565465 12:43618206-43618228 TTAAAAATAAAGAAGGAGGCCGG - Intergenic
1095614518 12:44172405-44172427 ATGTGAATGAAGATGGAGGCAGG - Intronic
1095653329 12:44639879-44639901 ATGAGAATGAAGATGTAGGGTGG - Intronic
1095702882 12:45208644-45208666 TAGAGAATGATGACTGAGGAAGG - Intergenic
1095930745 12:47622936-47622958 TGGAGGCTGAAGCAGGAGGATGG + Intergenic
1095932885 12:47646831-47646853 TTTAGAAAGATGAAGGTGGAGGG - Intergenic
1097579320 12:61434239-61434261 ATTAGAGTGAAGAAAGAGGATGG - Intergenic
1097879886 12:64677120-64677142 GTGTAAATGAAGAATGAGGAAGG - Intronic
1098194935 12:67989723-67989745 GGGAGGAAGAAGAAGGAGGAAGG + Intergenic
1098307751 12:69118460-69118482 TGGAGGATGAAGAGAGAGGAGGG - Intergenic
1098525253 12:71480065-71480087 TTAAGAATGAGGAAGGAGGCTGG + Intronic
1098657984 12:73057215-73057237 TTGAGAAAGAATAAGAAGAATGG - Intergenic
1098777323 12:74636889-74636911 CTGAGAATGAACAAATAGGAAGG - Intergenic
1098952335 12:76653817-76653839 GTGAGACTGAGGAAGGAGGATGG + Intergenic
1099601266 12:84741244-84741266 CTGAGAAAGAAGAAAGATGAAGG + Intergenic
1100127407 12:91445032-91445054 TTGAGAAAGAAGAACGAAGCTGG + Intergenic
1100604440 12:96140077-96140099 TCAAGAATGAAGGAAGAGGAAGG + Intergenic
1101386364 12:104261457-104261479 TTAAGAAAGAACAAGGGGGACGG - Intronic
1101585739 12:106083984-106084006 GAGAGAAAGAGGAAGGAGGAGGG + Intronic
1101627748 12:106462127-106462149 TGTAGCATGAAGCAGGAGGAGGG - Intronic
1102295255 12:111731348-111731370 TGGAGAAAGAAGATGGAGGAGGG - Intronic
1102899321 12:116624097-116624119 AAGAGAATGAAGAAGGAAGAAGG + Intergenic
1103046722 12:117741721-117741743 TTAAAAATAAAGAAGGAGAAGGG + Intronic
1103058891 12:117842982-117843004 TTGGGAAGGAGGGAGGAGGAAGG + Intronic
1103059784 12:117849100-117849122 TTGAGGACTAAGAAGGAGAAAGG + Intronic
1103454042 12:121050766-121050788 TTTAGAGTCAGGAAGGAGGATGG - Intergenic
1103741867 12:123096562-123096584 TGGAGAAGGAAGAAAGAGGGAGG + Intronic
1104400660 12:128473335-128473357 GTGAAGATGAAGAAGGAGGCTGG - Intronic
1104690575 12:130822986-130823008 TTTAAAATGAGGAAGGAGGTAGG - Intronic
1105483580 13:20803509-20803531 TTGGGAGTGAAGATGGAGAAAGG - Intronic
1106190223 13:27445907-27445929 TTGGGAATGAAAAGGGAAGAGGG + Intronic
1106470696 13:30051727-30051749 TCTAGGAGGAAGAAGGAGGAAGG + Intergenic
1106925083 13:34605437-34605459 TTGAGAAAACAGAAGCAGGAAGG + Intergenic
1107366820 13:39688224-39688246 ATGAGAATGAAAAAAGAGGCTGG - Intronic
1107376466 13:39809984-39810006 TCGAAGAGGAAGAAGGAGGAGGG - Intergenic
1107581119 13:41787545-41787567 TGGAGGATGAAGAGGGAGGAAGG + Intronic
1108156326 13:47589017-47589039 GGGAGACTGAGGAAGGAGGATGG + Intergenic
1108223644 13:48265215-48265237 ATGGGACTGAGGAAGGAGGATGG - Exonic
1108577120 13:51800104-51800126 TAGGGAATAAAGGAGGAGGATGG + Intronic
1108732872 13:53253265-53253287 TTAACCATGAGGAAGGAGGAAGG + Intergenic
1108854630 13:54777249-54777271 GAGAGAAGGAAGAAGGAGGAAGG + Intergenic
1109391625 13:61702602-61702624 TGGAGGCTGAAGAAGGAGGATGG + Intergenic
1109792522 13:67268378-67268400 TGGAGAAGGGAGAAAGAGGAAGG + Intergenic
1110093408 13:71484264-71484286 ATGAGGATGAGGCAGGAGGATGG - Intronic
1110640386 13:77817185-77817207 TAGAGAATGAAAAAGAAGAATGG + Intergenic
1110683317 13:78342020-78342042 TTGAGGAAGAAGCAGGAGCATGG - Intergenic
1110954863 13:81541436-81541458 GTGACACTGAAGAAGTAGGAAGG - Intergenic
1111038897 13:82717855-82717877 TTGAGAAATAAAAAGGATGATGG - Intergenic
1111410233 13:87866836-87866858 TTGAGATTGTTGGAGGAGGAAGG + Intergenic
1111598521 13:90441991-90442013 GTGTGAAAGGAGAAGGAGGAGGG - Intergenic
1112407558 13:99134691-99134713 TGGAGGATGAAAATGGAGGATGG - Intergenic
1112497532 13:99916534-99916556 TGGGGGATGAAGAGGGAGGAAGG - Intergenic
1112536550 13:100262698-100262720 AAAAGAAGGAAGAAGGAGGAGGG - Intronic
1112819832 13:103319338-103319360 TTCAGAAGAAAAAAGGAGGAGGG - Intergenic
1113612216 13:111655123-111655145 TGGGGAGTGAAGATGGAGGAAGG + Intronic
1114492189 14:23109999-23110021 ATGAAGATGAGGAAGGAGGAAGG + Intergenic
1114638773 14:24205110-24205132 TAGGGATTGAGGAAGGAGGAAGG + Intronic
1114744886 14:25136471-25136493 GTGAGACTGATGAAGAAGGAGGG + Intergenic
1115087190 14:29531918-29531940 AGGAGAATGGAGATGGAGGAAGG - Intergenic
1115489139 14:33942037-33942059 TAGATAATGAAGAAGGAGCATGG + Intronic
1116001090 14:39243567-39243589 TTCAGAATGAAGAACCAGGCTGG + Intronic
1116237675 14:42300185-42300207 TAGAGAATAAAGAAGGAGAGAGG + Intergenic
1116447493 14:45027458-45027480 TTGAGAATGAAAAAGATGTAAGG + Exonic
1116530636 14:45968457-45968479 TAGAGAGTGAAGAAAGAAGATGG - Intergenic
1116628404 14:47297387-47297409 GAGAGAAAGAAGAAAGAGGAAGG + Intronic
1116721592 14:48503502-48503524 TTGAGAAGGAAGAAGCACGCTGG - Intergenic
1116908812 14:50435359-50435381 TTAAAAAGAAAGAAGGAGGACGG - Intronic
1117050477 14:51854945-51854967 TGGAGATTGAAGAAGGCGGCTGG - Intronic
1117232851 14:53739438-53739460 TTGAGGAAGGAGAAGGAGCAAGG + Intergenic
1117232963 14:53741042-53741064 TTGAAGAAGAAGAAGGAGCAAGG - Intergenic
1117339031 14:54778199-54778221 TTCAGTATGAACAAAGAGGAAGG - Intronic
1117553334 14:56858110-56858132 GAGAGAAAGAAGGAGGAGGAGGG + Intergenic
1117818674 14:59625114-59625136 TTAAAAATGATGAAGAAGGAAGG + Intronic
1118082379 14:62375493-62375515 TGGAGGCTGAAGTAGGAGGATGG + Intergenic
1118363110 14:65072305-65072327 TTGAGAAGGAAGAAAGCTGAGGG - Intronic
1118404520 14:65410888-65410910 TTAAGATAGAAGAAGCAGGAAGG - Exonic
1118477806 14:66134719-66134741 TTGAGAAAGAAGAAGGAGTCAGG - Intergenic
1118509463 14:66455130-66455152 TTGAGAATTTTGAAGAAGGAGGG + Intergenic
1118749004 14:68793242-68793264 TTCAAAAGGAAGAAGGGGGAGGG + Intronic
1119094807 14:71819541-71819563 TTAAGAAAGAAGAAAGAGGGTGG - Intergenic
1119491403 14:75036943-75036965 TGGAGAATGGAGTAGGAGTAGGG - Intronic
1119972300 14:78984851-78984873 ATGAGACTGGAGAAGGAGGCAGG + Intronic
1119996841 14:79262487-79262509 AGGAGAATGAGGAAGGAGAAAGG + Intronic
1119997651 14:79271382-79271404 AGGGGAAGGAAGAAGGAGGAAGG - Intronic
1120020264 14:79522200-79522222 TTGACACTGGAGAAGTAGGAGGG + Intronic
1120511579 14:85421887-85421909 CTGATAATGAAGAAGTAGAATGG - Intergenic
1120540888 14:85748969-85748991 TTGAAAATGAAGAAGGTGAAGGG + Intergenic
1120616334 14:86709713-86709735 TTTAGAATGGAGAAGAAGTAAGG + Intergenic
1120856855 14:89220088-89220110 ATGAGAAGAAAGGAGGAGGAAGG - Intronic
1121186149 14:91971565-91971587 GGGAGAATAAAGAAGGAGAAGGG + Intronic
1121574463 14:94972197-94972219 GTGAGAATGCAGAGGGAAGAAGG + Intergenic
1121654952 14:95588380-95588402 ATGAGGATGAAGACGGGGGAAGG + Intergenic
1121950043 14:98163687-98163709 TAGAGAAGAAAGTAGGAGGATGG - Intergenic
1121986391 14:98510509-98510531 TTCAGAATGAAGTAGCAGAAAGG + Intergenic
1122157864 14:99761374-99761396 TGGAGACTGCAGAAGAAGGAAGG + Intronic
1122206024 14:100148440-100148462 TTCTGAATGAGAAAGGAGGAAGG - Intronic
1122453282 14:101829346-101829368 TGGAGATTGAAGAAGGAAGCAGG - Intronic
1202932145 14_KI270725v1_random:47560-47582 GTGAGAATGAAGAATAAGGTGGG + Intergenic
1124897597 15:33791480-33791502 TTGGGAATGAAGATGGGGAAAGG + Intronic
1124939296 15:34203195-34203217 TTGAGAAATTGGAAGGAGGATGG - Intronic
1125283343 15:38067033-38067055 TTGAGAATGAAGTAGCCAGAAGG - Intergenic
1126423281 15:48498592-48498614 TTCAGAATGCAGATGGAGAATGG + Intronic
1126551084 15:49930238-49930260 TTAGGGATGAAGAGGGAGGATGG + Intronic
1126880497 15:53090293-53090315 TGAAGAAGGAAGAAGGAAGAAGG - Intergenic
1126880498 15:53090300-53090322 TAGAAAATGAAGAAGGAAGAAGG - Intergenic
1127707459 15:61561447-61561469 TTGAAATTGAAGAGAGAGGAGGG - Intergenic
1127994267 15:64143672-64143694 CTGAGAATGAAGATGGGGAAGGG - Intronic
1128127715 15:65205225-65205247 GTGAGGCTGAAGAATGAGGAGGG - Intronic
1128378810 15:67096192-67096214 TTGAAAATGATGACGGAAGAAGG + Intronic
1128430016 15:67583700-67583722 TTTAGACTGAACAAGTAGGAAGG + Intronic
1128617121 15:69118828-69118850 GTTAGAATGAGGTAGGAGGAAGG - Intergenic
1128768573 15:70265723-70265745 TGGAGAATGGAGAAGGAAGATGG + Intergenic
1128940860 15:71786733-71786755 GAAAGAAAGAAGAAGGAGGAGGG + Intergenic
1129261093 15:74367721-74367743 TTGAGCCTGCAGCAGGAGGAAGG - Exonic
1130029531 15:80299000-80299022 TTAAGAATGAAGAGGTAGGAGGG + Intergenic
1130271294 15:82450304-82450326 TAGAGAAGGAAGAAAGTGGAGGG + Intergenic
1130424969 15:83787826-83787848 TTGAGAAAGGAGAAAGAGGAGGG - Intronic
1130489040 15:84417143-84417165 TAGAGAAGGAAGAAAGTGGAGGG - Intergenic
1130693393 15:86105577-86105599 TTGAGAAGGAAGAAGGTGAGGGG + Intergenic
1131837752 15:96408184-96408206 ATAAGAATAAAGAAGGAGGTGGG - Intergenic
1132068091 15:98750094-98750116 TTGAGAATGACAAAAGAGAAAGG - Intronic
1132078629 15:98845479-98845501 AGGAGAAGGAAGGAGGAGGAGGG - Intronic
1132114044 15:99123000-99123022 TGGAGGATGTAGAAGGAGGTGGG + Intronic
1132200166 15:99947465-99947487 AAGAGCATGAAGATGGAGGAGGG - Intergenic
1132759974 16:1504019-1504041 TTGAGGCTGAGGCAGGAGGATGG + Intronic
1133354402 16:5125380-5125402 ATGAGAATGAAGGAAGAGAATGG - Intergenic
1133422115 16:5654768-5654790 GAAAGAAGGAAGAAGGAGGAAGG - Intergenic
1133686980 16:8174771-8174793 TCAAGTATGTAGAAGGAGGATGG - Intergenic
1133816323 16:9200037-9200059 AAAAGAAGGAAGAAGGAGGAAGG - Intergenic
1133818911 16:9219177-9219199 TTAAGAATGAAGGAGGCGGGTGG - Intergenic
1133970524 16:10564578-10564600 TTGATAATGAGGTAGGAGGTGGG - Intronic
1134071952 16:11265758-11265780 TTGCGAAAGAGGAATGAGGAAGG + Intronic
1134287165 16:12871984-12872006 GGGAGGAGGAAGAAGGAGGAAGG - Intergenic
1134287185 16:12872041-12872063 AAGAGGAAGAAGAAGGAGGAGGG - Intergenic
1134322168 16:13174053-13174075 TTGAGAATGAAGGGTGGGGATGG - Intronic
1134345818 16:13390617-13390639 ATGAGACTGAAGAAAGAGGCAGG - Intergenic
1134661354 16:15986876-15986898 TAGAGAATGTGGAAGGAGGCCGG + Intronic
1135431849 16:22391133-22391155 TTGAAAAAGAAGAACGAGGCTGG - Intronic
1135738386 16:24952392-24952414 TTGAGTATGAAAAAGGGGTAAGG + Intronic
1135748474 16:25037359-25037381 TTGAGAATGAAGAAGGGGTGGGG - Intergenic
1135758201 16:25115581-25115603 TTGAGAATGAAAAAGGAGTGGGG - Intronic
1135930098 16:26728991-26729013 TTGAGAAGTAAGGTGGAGGAGGG + Intergenic
1136021127 16:27440752-27440774 TTGAAAGTGAAGAAGGTGGCTGG + Intronic
1136051922 16:27657225-27657247 TTGAGAAGGAAAAAGTGGGAGGG + Intronic
1136072035 16:27793154-27793176 TTGAGGATGGAGAAGGAACAAGG - Intronic
1136498516 16:30658452-30658474 CTGAGGAGGAAGAGGGAGGAGGG + Exonic
1136589080 16:31206353-31206375 GAAAGAAAGAAGAAGGAGGAAGG - Intergenic
1136616238 16:31400231-31400253 TGGTGATTGAAGAAGCAGGAAGG + Intronic
1137532445 16:49287949-49287971 CTGAAGATGGAGAAGGAGGAAGG - Intergenic
1137576530 16:49603853-49603875 TGGAGGATGAGGAAGGAGGGAGG - Intronic
1138124928 16:54430860-54430882 GCGAGCATGAAGAAGGAAGAAGG - Intergenic
1138830946 16:60373969-60373991 TCCAGAAGGAAGAAGCAGGAAGG - Intergenic
1139285682 16:65811590-65811612 TTGAGAATAAAGGAGAATGATGG + Intergenic
1139870760 16:70107212-70107234 TAGAGGAGGAAGAAGAAGGAGGG + Intergenic
1140004838 16:71064675-71064697 TTAATACTGAAGAAGGAGAAAGG + Intronic
1140155982 16:72427186-72427208 ATGGGAGTGAAGGAGGAGGAGGG + Intergenic
1140376116 16:74446665-74446687 TAGAGGAGGAAGAAGGAGGAGGG - Intergenic
1140556372 16:75926045-75926067 TTAAGAAAGAAGAATGATGAAGG + Intergenic
1140919246 16:79521566-79521588 TTGACTATGTAGAAGAAGGAGGG - Intergenic
1141104100 16:81219000-81219022 TTGAGAATGGACAAGGAGGCTGG - Intergenic
1141427140 16:83951880-83951902 GAGAGAAGGAGGAAGGAGGAAGG - Intronic
1141845119 16:86603377-86603399 AGGAGGAGGAAGAAGGAGGAGGG - Intergenic
1142269157 16:89080134-89080156 TGGAGAAAGCAGAGGGAGGAAGG + Intergenic
1142529637 17:571205-571227 TAGAGGCTGAAGTAGGAGGAGGG + Intronic
1142597752 17:1037769-1037791 TCCAGAATGAAGAAAGAGCAGGG - Intronic
1142796786 17:2314152-2314174 TTGAGAATGCAGAAGGAGCCGGG + Intronic
1142798078 17:2324666-2324688 GTGGGTATGAAGGAGGAGGATGG - Exonic
1143100932 17:4504344-4504366 TTGAAAAGGAAGCAGGAGCAAGG - Intronic
1143105142 17:4525980-4526002 TAGAGAAAGATGAAGGAAGAAGG + Intronic
1143224638 17:5290382-5290404 TTAAGAATAATCAAGGAGGACGG - Intronic
1143364381 17:6396317-6396339 CAGAGAAGGAAGAAGGAGAAAGG + Intronic
1143701118 17:8660913-8660935 AAGAGAAAGAAGAGGGAGGAAGG - Intergenic
1144051165 17:11498268-11498290 TTGGGGATGGAGGAGGAGGAAGG - Intronic
1144212108 17:13024456-13024478 TTCAGGATGAAGTAGGATGAAGG + Intergenic
1145247858 17:21281399-21281421 TAGAGGAAGAAGAAAGAGGAAGG + Intergenic
1145299643 17:21623900-21623922 TAGAGAGTAAAGAAGGACGAAGG + Intergenic
1146130292 17:30267608-30267630 TTAATAATGAAGATGGAAGAAGG - Intronic
1146274179 17:31504735-31504757 TTGAGGATAAACAAGGAGGATGG - Intronic
1146673679 17:34758586-34758608 AGGAGAAAGAAGAAGGAGGAAGG + Intergenic
1147043791 17:37737987-37738009 TTCAGAAAGGAGAAGGAGGCAGG - Intronic
1147263938 17:39224172-39224194 TCAAGATGGAAGAAGGAGGAAGG + Intronic
1147356033 17:39897485-39897507 TTCAGAAAGCAGAGGGAGGAGGG + Intergenic
1147429283 17:40361815-40361837 GGGAGGATGAAGATGGAGGAGGG + Intronic
1147484756 17:40801861-40801883 ATGGAAGTGAAGAAGGAGGATGG + Intergenic
1147490941 17:40865488-40865510 TTGAGCATGGAAAAGGAGGAAGG + Intronic
1147498812 17:40942527-40942549 AAGAGAAGGAAGAAGGAAGAAGG - Intergenic
1147498863 17:40942820-40942842 AAGAGAAGGAAGAAGGAAGAAGG - Intergenic
1147753848 17:42755075-42755097 TGGAGAAGGAAGGAGGAGGAGGG + Intergenic
1147791659 17:43017738-43017760 TTTTGAATGAAGAAGGGGTAGGG - Intronic
1147978992 17:44263210-44263232 TAGAGAATGAAGGAGGGAGATGG - Intronic
1148018787 17:44540167-44540189 TTGAGAGTGGAGAAGGAGGGGGG - Intergenic
1148056697 17:44802263-44802285 TTGAGAATGATACAGGGGGAAGG - Exonic
1148511004 17:48169777-48169799 TAGATAATGGAGAAGGAGCAGGG + Intronic
1148789050 17:50162964-50162986 GAGAGAAGGAAGAAGAAGGAGGG + Intergenic
1148789058 17:50162994-50163016 GAGAGAAGGAAGAAGAAGGAGGG + Intergenic
1149062328 17:52437565-52437587 TTGAGGATGAAGAAGAAGAATGG - Intergenic
1149222348 17:54429552-54429574 TTGAGAAGGCAGAAGGCAGATGG + Intergenic
1149526695 17:57361724-57361746 ATGAGAAGGAAGAAGAGGGATGG + Intronic
1149604637 17:57916202-57916224 CTGAGAATGCAGAAGGCCGAGGG + Intronic
1149664397 17:58355612-58355634 TTGAGAAGGAAGATGGGGGCTGG + Intronic
1150204531 17:63392357-63392379 TTGAAAATCCAGAAAGAGGAGGG - Intronic
1150386467 17:64765519-64765541 CTGAGAATGGGGAGGGAGGAGGG - Intergenic
1150465196 17:65386681-65386703 AAGAGAAAGAGGAAGGAGGATGG - Intergenic
1150576607 17:66436170-66436192 TTGAGAATCAAGAGGTTGGATGG + Intronic
1151107924 17:71639628-71639650 TTGGCAATGGAGAAGGAGCAAGG + Intergenic
1151157567 17:72137121-72137143 TGGAGAGTGAAGAGGGAGGAAGG + Intergenic
1151762751 17:76115695-76115717 AGGAGAATGAGGCAGGAGGATGG + Intronic
1151918466 17:77136376-77136398 TTCAAAAGAAAGAAGGAGGAAGG - Intronic
1152365630 17:79854736-79854758 GGCAGACTGAAGAAGGAGGAAGG + Intergenic
1203168922 17_GL000205v2_random:128709-128731 CAGAGACTGAAGCAGGAGGATGG + Intergenic
1153640397 18:7151867-7151889 TTCAGACTTATGAAGGAGGAAGG + Intergenic
1153733806 18:8043802-8043824 ATGAGAATGAGGGAGTAGGAAGG + Intronic
1154031293 18:10756308-10756330 TGGAGGATGAAGAGGAAGGATGG + Intronic
1155337502 18:24779821-24779843 TTGACAATGAAGATGGAGACGGG - Intergenic
1155384750 18:25265535-25265557 GTGAGAATGAATGAGGAGGATGG - Intronic
1155474000 18:26220096-26220118 TACAGAATGAAGAAGGAGCAAGG + Intergenic
1155620503 18:27773011-27773033 TTGAGAGTGAAAAGGGGGGATGG - Intergenic
1155908386 18:31479561-31479583 ATCAGATTTAAGAAGGAGGAAGG - Intergenic
1155969617 18:32070005-32070027 GAGAGAGAGAAGAAGGAGGAAGG - Exonic
1156126541 18:33912214-33912236 TTGAGAATGAGGAAGGACTCAGG - Intronic
1156179348 18:34584801-34584823 TTCAGAGAGAAGAAGGAGGGAGG + Intronic
1156835258 18:41545842-41545864 TAGAGACTGAGGCAGGAGGATGG - Intergenic
1156971984 18:43167624-43167646 TGGAGGCTGAAGAAGGAGAATGG - Intergenic
1156996744 18:43478380-43478402 TTGACAATGGATAAGGAGGAAGG - Intergenic
1157096478 18:44689773-44689795 TTGGGAATGTAGAGGGAGAAAGG + Intronic
1157182752 18:45511971-45511993 TTGACCCTGAAGAAAGAGGAAGG + Intronic
1157329551 18:46693342-46693364 TTGAGAAGGGAGAAAGAGAAGGG - Intronic
1157467433 18:47959221-47959243 TGGAGACTGAAGCAGGAGAATGG + Intergenic
1157497907 18:48169615-48169637 TTGATAAAGAAGAAAGTGGACGG - Intronic
1157583177 18:48785106-48785128 AAGAGAAGGAAGAAGGAAGATGG - Intronic
1157651613 18:49338463-49338485 TTGACAATAAAGAATGAAGAGGG + Intronic
1158318415 18:56237379-56237401 CTGGGTTTGAAGAAGGAGGAAGG + Intergenic
1158403418 18:57140911-57140933 GTGTCAGTGAAGAAGGAGGAAGG + Intergenic
1158617515 18:59001765-59001787 ATAAGTATGAAGAAAGAGGAAGG - Intergenic
1158621853 18:59039871-59039893 TTGAGAATGACTGAGGAGAAAGG + Intergenic
1158724759 18:59960783-59960805 ATGAGACTGAAGTAGGGGGATGG - Intergenic
1158882327 18:61792476-61792498 TTTAGAATGAAGAAAGGAGATGG - Intergenic
1159321636 18:66858497-66858519 TTGAGAAAGAAGAACGAAGCTGG - Intergenic
1159362821 18:67427352-67427374 GTAGGAATGCAGAAGGAGGAAGG - Intergenic
1159540303 18:69766241-69766263 TAGACACTGAAGAAGGAGGAGGG + Intronic
1159657350 18:71048073-71048095 CTGAGATTGAGGAAGGAAGAAGG - Intergenic
1159802034 18:72913028-72913050 TTGAGAATAATGAGGGATGAAGG + Intergenic
1160062093 18:75540103-75540125 TTGAATCTGCAGAAGGAGGAAGG + Intergenic
1160264594 18:77329314-77329336 TTGAGAAAGAAAAAGAAAGATGG + Intergenic
1161133262 19:2604365-2604387 TGGAGGCTGAAGCAGGAGGATGG + Intronic
1161358775 19:3834469-3834491 GTGACTATGAAGGAGGAGGAGGG - Intronic
1161503312 19:4629733-4629755 ATAAGAAGGAAGAAGGAGGCTGG - Intergenic
1162099282 19:8330099-8330121 TTGAGAAGGAAGAGGGTGAAAGG + Intronic
1162207989 19:9070330-9070352 CTCAGAATGGAGGAGGAGGAGGG + Intergenic
1162789012 19:13053590-13053612 TTGGGAATGAGGATGGAGGATGG - Intronic
1163387241 19:17007379-17007401 AGAAGAAAGAAGAAGGAGGAAGG + Intronic
1165281993 19:34805643-34805665 TTGAGAGTGAGGGAGGAGGCAGG - Intergenic
1166264556 19:41670873-41670895 ATGAGAAGGAAATAGGAGGAGGG - Intronic
1166278633 19:41774411-41774433 ATGAGAAGGAAGTAGGAGGAGGG + Intergenic
1166397935 19:42456156-42456178 ATGAGAAGGAAGCAGGAGGAGGG - Intergenic
1166442923 19:42831733-42831755 ATGAGAAGAAAGTAGGAGGAGGG - Intronic
1166462608 19:43002495-43002517 ATGAGAAGAAAGTAGGAGGAGGG - Intronic
1166675523 19:44738466-44738488 TTGAGAATCTAGACAGAGGAGGG + Intergenic
1167448948 19:49556100-49556122 TTGAAAAGGAAGGAGGAGGCGGG + Intronic
1167474543 19:49692144-49692166 CTGGGTATGAAGGAGGAGGAGGG + Intronic
1167802899 19:51756870-51756892 TGGAGAATGAGGAAGCATGAAGG - Intronic
1168369065 19:55816121-55816143 TTTAGAATGAAGAAGTAGTTTGG - Intronic
925008755 2:466775-466797 TTAACAGTGAAGAAGGATGAAGG - Intergenic
925179766 2:1809661-1809683 TTGAGACTGGGGAAGCAGGAGGG - Intronic
926234497 2:11028986-11029008 TTGGGAATGGAGCAGGGGGAGGG - Intergenic
926316775 2:11715802-11715824 ATGAAAATGGAGGAGGAGGATGG + Intronic
926339877 2:11896133-11896155 TGGTGTAGGAAGAAGGAGGATGG + Intergenic
926587070 2:14698591-14698613 TTCAGAGTGAAGGAGGAGCATGG + Intergenic
926938758 2:18113821-18113843 TTGAGAATGGAGAAAGACGCTGG - Intronic
927170942 2:20368820-20368842 GGGAGACTGAAGTAGGAGGATGG + Intergenic
927291014 2:21405088-21405110 TTGGGAATGGAGAATGAAGAGGG + Intergenic
928275663 2:29898008-29898030 GTGAAAATGAAGTTGGAGGATGG + Intronic
929377705 2:41309715-41309737 TTGAGAAAGAAGACTGAGAATGG - Intergenic
929421191 2:41791555-41791577 CTGAAAATGAAAAAGGAGAATGG + Intergenic
929687495 2:44047227-44047249 CTGAGAGTGAAGGGGGAGGATGG + Intergenic
929823636 2:45292922-45292944 ATGGGAATGAGGAAGGAGCAAGG - Intergenic
929910952 2:46089178-46089200 ATAAGAATGAGGAGGGAGGAAGG - Intronic
930152140 2:48069917-48069939 TCCAGAATGAGGAAGGAGCAGGG + Intergenic
930338297 2:50079008-50079030 TTAATAATGTAGAAGGATGATGG - Intronic
930950130 2:57131331-57131353 TGGAGACTCAAAAAGGAGGAGGG - Intergenic
930966696 2:57337249-57337271 TGGAGAATAAAGAGGTAGGATGG + Intergenic
931638724 2:64362972-64362994 TTGGGAATGAGGAAGAAGGCAGG - Intergenic
931795529 2:65705678-65705700 TTGAGAAAGAAGAAGAAAGTGGG + Intergenic
931878579 2:66541675-66541697 TGGAGAATTAAGAAAGCGGATGG + Intronic
932279432 2:70477215-70477237 ATAAAAAGGAAGAAGGAGGAAGG + Intronic
933231071 2:79808263-79808285 AGGAGAAGGGAGAAGGAGGAAGG + Intronic
933351993 2:81165152-81165174 GGGAGACTGAAGCAGGAGGATGG + Intergenic
934324750 2:92001952-92001974 GTGAGAATGAAGAATAAGGTGGG + Intergenic
934463128 2:94232657-94232679 GTGAGAATGAAGAATAAGGTGGG + Intergenic
934879340 2:97960344-97960366 TTAAACATGAAGAAGGTGGATGG - Intronic
935130746 2:100259117-100259139 TTGGGAATGCCGAAGAAGGAAGG + Intergenic
935358145 2:102223852-102223874 TAGAGGATGAGGAAGCAGGAAGG + Intronic
935403233 2:102682150-102682172 TGTAGAATGAAACAGGAGGATGG - Intronic
935813587 2:106825226-106825248 CTGAGAAAGAGCAAGGAGGAAGG - Intronic
935870713 2:107446183-107446205 TTGAGAATGAAGAACTGGTAGGG + Intergenic
936936592 2:117844609-117844631 TTGAGCATGAAATAGGAGAAGGG - Intergenic
936941166 2:117885896-117885918 TAGAGAATAACGGAGGAGGATGG + Intergenic
936994076 2:118395385-118395407 GTGAGAATGAAGAAAGAGAGGGG + Intergenic
937382712 2:121395052-121395074 TTGACAATGAGGAAGGAAGGAGG + Intronic
937573359 2:123390985-123391007 AGGAGAATGAAGAAGGAGAATGG - Intergenic
937662422 2:124445942-124445964 TTGAGAGAGAAGGAGGCGGAGGG + Intronic
937699610 2:124849475-124849497 TTGAGAAAGAAGAACAAGGCTGG - Intronic
937843859 2:126555674-126555696 TAGAGAAGGAAGAAAGAGGAAGG + Intergenic
937896356 2:126979371-126979393 TTGAGAGTGAGGAAGGAGTAGGG - Intergenic
938130462 2:128710998-128711020 TTGAGAAAGAGGAAGGGGGCAGG + Intergenic
938146769 2:128841064-128841086 TTTATAATGAAGAATGAGCAGGG + Intergenic
938739338 2:134216399-134216421 TAGAGAATGAAGAAGAATGAAGG + Intronic
939076924 2:137614278-137614300 ATGAGAAAGAAGAATGGGGATGG - Intronic
939246270 2:139627152-139627174 TTGTGCATGAAAAAGGAGGCTGG + Intergenic
939459434 2:142480234-142480256 TTGGGCATGAAAAATGAGGAAGG + Intergenic
940543667 2:155055028-155055050 TTGACAAAGAAAAAGGAAGATGG + Intergenic
940912288 2:159219193-159219215 TGGAAAATGCAGCAGGAGGATGG + Intronic
941047742 2:160695537-160695559 TTGAAAATGAAGATGGGAGAAGG + Intergenic
941063817 2:160878370-160878392 CTGAGCTTGAAGATGGAGGAAGG - Intergenic
941328932 2:164152657-164152679 TGGAGATTGAAGAAGGGGAAAGG + Intergenic
941726350 2:168864852-168864874 ACGAGAAAAAAGAAGGAGGATGG + Exonic
941960642 2:171250055-171250077 TTGGGAATGAGGTGGGAGGATGG + Intergenic
942234680 2:173892531-173892553 TTGAGAATTAAGAATGTGAAGGG + Intergenic
942524800 2:176841775-176841797 TGGAGAAGGAAGGAGGAGGAAGG - Intergenic
942752464 2:179303440-179303462 GGGAGAATGAGTAAGGAGGAAGG - Intergenic
942756311 2:179345428-179345450 TTGTACAAGAAGAAGGAGGAAGG - Intergenic
942912213 2:181257960-181257982 TGGAGCATGAAGGAGGAGGCAGG + Intergenic
943426310 2:187739781-187739803 TTGACTTTGAAGATGGAGGAAGG - Intergenic
943612291 2:190047286-190047308 ATGGGAAAGAAGAAGGAAGAAGG - Intronic
944680666 2:202073844-202073866 TTGAGTTTCATGAAGGAGGAAGG - Intronic
944832910 2:203550596-203550618 TTAGGAATGAAGAATGAGGTGGG + Intergenic
945138360 2:206655512-206655534 AAGAGACTGAAGCAGGAGGATGG - Intronic
945324996 2:208471830-208471852 TTGTGAAAGAAGCAGGAGGGGGG + Intronic
945441474 2:209885182-209885204 TTGAGAATAAAGTATGAGCAAGG + Intronic
945615820 2:212064769-212064791 TAGAGAAAGAAAAAGGAGAAAGG + Intronic
946262648 2:218507676-218507698 ATGAGAATGATGGAGGTGGAGGG + Intronic
946546337 2:220748667-220748689 ATTTGTATGAAGAAGGAGGAAGG + Intergenic
946669587 2:222088603-222088625 TTGAAATTGAAGGGGGAGGAGGG + Intergenic
946915081 2:224510815-224510837 TACAGAATGGAAAAGGAGGAAGG - Intronic
947308515 2:228774576-228774598 TTGAGAAAGAAGAAAGAGCAGGG - Intergenic
947491495 2:230599289-230599311 TTGAGAAAGAAGAATGAAGATGG + Intergenic
948003947 2:234592082-234592104 TAGAGACTGAACAAGGAGAAAGG + Intergenic
948091864 2:235301984-235302006 AGGAGGATGAAGAGGGAGGAGGG - Intergenic
948157308 2:235793644-235793666 TTGAGCAGCAAAAAGGAGGAAGG + Intronic
948293852 2:236846787-236846809 TTGAGAAAGAAGAAGGCAAAGGG + Intergenic
948564222 2:238873363-238873385 CTGAGAAGGAAGCAAGAGGATGG + Intronic
948599062 2:239097702-239097724 ACGAGACTGAAAAAGGAGGAGGG + Intronic
948807306 2:240458628-240458650 CTGAGGATGGGGAAGGAGGAAGG - Intronic
1168848340 20:960106-960128 GTGAGAAAGAAGAGGAAGGAAGG + Exonic
1168904341 20:1391807-1391829 TTGAGAAAGGGGAAGGAGGAGGG + Intronic
1169614576 20:7425797-7425819 TTGGGAATGAAGAAGTAGAAGGG - Intergenic
1169873766 20:10274134-10274156 TTGAGAAGGAAGGAGGAAGGAGG + Intronic
1169938977 20:10916598-10916620 TGGTGAATGCAGAAGGAAGAAGG - Intergenic
1170034311 20:11973852-11973874 AAGAGGAGGAAGAAGGAGGAAGG + Intergenic
1170075419 20:12413540-12413562 TTGAGAACAATGAAGGAGAATGG - Intergenic
1170803096 20:19606679-19606701 CTGAGAATGCAGAGGGAAGAAGG + Intronic
1170819712 20:19746566-19746588 TAGAGAAAGAAGAGGGAGGCTGG + Intergenic
1171305175 20:24098979-24099001 TGGAGAAAGAAGAAGGAAAATGG + Intergenic
1171326734 20:24300910-24300932 CTGAGCTGGAAGAAGGAGGAGGG + Intergenic
1171385425 20:24766518-24766540 TTGAGAATGAACCAGCAGGGTGG + Intergenic
1172659727 20:36559405-36559427 TTGAGAACGAAAAATGAGGCTGG + Intergenic
1173285217 20:41664705-41664727 TAGAGAAAGAGGAAGGAGAAAGG + Intergenic
1173533923 20:43794334-43794356 TGAAGAAGGAAGAAGGAGAAAGG + Intergenic
1174018185 20:47506164-47506186 TTCAGAATTAAGGTGGAGGAGGG + Intronic
1174747244 20:53075667-53075689 ATGAGAATGAAGGTGGAGGAAGG + Intronic
1174749906 20:53101332-53101354 TTAATAATGAAAAAGGAGGGGGG + Intronic
1175616640 20:60405359-60405381 TTTGGAATGGAGAAGGGGGAAGG + Intergenic
1175617555 20:60414019-60414041 TTGAGAATCAGAAAGGGGGAGGG - Intergenic
1175732067 20:61360940-61360962 ATGAAAATGTAGCAGGAGGAGGG + Intronic
1175829829 20:61957560-61957582 TGGAGAATCAAAGAGGAGGAGGG + Intronic
1175853835 20:62108317-62108339 TTGAAAAGGAAGAAGTAGGCTGG + Intergenic
1175868718 20:62196563-62196585 TTGGGGCTGAAGCAGGAGGATGG + Intronic
1176287351 21:5025147-5025169 TTGAGAAGCAAGAAGGAGCCTGG - Intronic
1176402832 21:6330445-6330467 CAGAGACTGAAGCAGGAGGATGG - Intergenic
1176434325 21:6658659-6658681 CAGAGACTGAAGCAGGAGGATGG + Intergenic
1176458587 21:6985729-6985751 CAGAGACTGAAGCAGGAGGATGG + Intergenic
1176594174 21:8675698-8675720 GTGAGAATGAAGAATAAGGTGGG + Intergenic
1177323065 21:19546758-19546780 TTGAGAGTGTAGCAGGAGAAAGG + Intergenic
1177720994 21:24906803-24906825 GCGAGAATGAACAAAGAGGATGG - Intergenic
1177994347 21:28077180-28077202 TTAAGAATGAGAATGGAGGAAGG + Intergenic
1178972244 21:37190427-37190449 TTGAAAATGAAGAAGGGGCCGGG - Intronic
1179072885 21:38089482-38089504 TTGAAGATGAAGATGGAGGAAGG + Intronic
1179335985 21:40454534-40454556 TCTAGAATGAAGAGGAAGGATGG + Intronic
1179869830 21:44238328-44238350 TTGAGAAGCAAGAAGGAGCCTGG + Intronic
1180277027 22:10652828-10652850 GTGAGAATGAAGAATAAGGTGGG + Intergenic
1180507525 22:16028209-16028231 ATGAGGGTGGAGAAGGAGGACGG - Intergenic
1180614642 22:17119623-17119645 TTGAGCATGAAGATGGAGAGGGG + Exonic
1180661691 22:17473058-17473080 TTGAGGGTGGAGAAGGTGGAAGG + Intronic
1181455858 22:23059799-23059821 TTGAGACTGCACAAGGAGGAGGG - Intronic
1181654491 22:24284987-24285009 TTGAAGAGGAAGATGGAGGAAGG + Intronic
1181725427 22:24807570-24807592 CTGAGACTGAAGAATGGGGAGGG - Intronic
1182658794 22:31910509-31910531 TGGAGGATGATGGAGGAGGAAGG - Intergenic
1182791109 22:32953830-32953852 ATGTTGATGAAGAAGGAGGAGGG - Intronic
1184082052 22:42229121-42229143 AGGAGAGTGAAGAAGTAGGAAGG + Intronic
1184799521 22:46751281-46751303 TGGAGAAGGAGGGAGGAGGAAGG - Intergenic
949214219 3:1545971-1545993 TTGAGAATTAAGAAATATGAGGG - Intergenic
949401396 3:3668681-3668703 ATGACTTTGAAGAAGGAGGAAGG - Intergenic
949551631 3:5116634-5116656 ATGTGGATGGAGAAGGAGGAAGG - Intergenic
949618446 3:5782837-5782859 TTTAGAATGATGTAGGAGGATGG + Intergenic
949721142 3:6991560-6991582 TTGAGAAAGAAGAAGAAAAATGG + Intronic
949914310 3:8945764-8945786 TTAAAAATGAAGATGGAGGCCGG - Intronic
950683492 3:14601448-14601470 TTGAGATTGAGGGAGGAGGCAGG - Intergenic
950704876 3:14773436-14773458 GTAAGAAAGAAGATGGAGGAGGG + Intergenic
950832084 3:15885040-15885062 GTGGGAAGGAAGAAAGAGGAAGG + Intergenic
951313296 3:21157312-21157334 CTGACATTGAAGATGGAGGAAGG - Intergenic
951594444 3:24301896-24301918 TTGACTTTGAAGATGGAGGAAGG + Intronic
951741061 3:25923841-25923863 TAGAGGATGAAGAAGGACGAAGG + Intergenic
952347365 3:32501328-32501350 AAGAGAAGGAAGAAGGAAGAAGG + Intronic
953022866 3:39127081-39127103 TTGAGAAGGGAGAAGGTGAAAGG - Intronic
953735036 3:45486408-45486430 CTGAGAATGAACAAAGAGAAGGG + Intronic
953871295 3:46629705-46629727 AGGAGAATGGAGGAGGAGGAGGG + Intergenic
954348863 3:50025662-50025684 GGGAGACTGAAGCAGGAGGACGG - Intronic
954701645 3:52453811-52453833 TTGAGGATGCAGAAGGGGTAGGG - Intronic
954723335 3:52584753-52584775 TTGACAATAAAGAAGCAAGATGG - Intronic
954858571 3:53667894-53667916 TTCATAAAGAGGAAGGAGGAAGG + Intronic
955083465 3:55679169-55679191 ATGAGGATGGAGAAGAAGGAAGG - Intronic
955877193 3:63504427-63504449 TGCAGAGTGAAGAAGGAAGATGG - Intronic
955887234 3:63613474-63613496 GAGAGAAGGAAGAAGGAGGGAGG + Intronic
956369339 3:68541254-68541276 TTGAGAAGGAGGGAGGAGGGAGG - Intronic
956678784 3:71759007-71759029 TTGAGAATGTAGAGGGCTGATGG - Intergenic
957058298 3:75461067-75461089 ATGAGAATGAAGGAAGAGAATGG - Intergenic
957144054 3:76398869-76398891 CTGAGTATGAAGATGGAAGAAGG + Intronic
957307809 3:78480833-78480855 TAGAGAGTGAACAAGGTGGAGGG - Intergenic
957362380 3:79175975-79175997 TTGAGTATGAAAGTGGAGGAAGG - Intronic
957415237 3:79893329-79893351 TTAAGAAGGAGGAAAGAGGAAGG + Intergenic
957439161 3:80220146-80220168 TTAAAAATGTAGAAGGAGAATGG + Intergenic
957645090 3:82911820-82911842 TTGAGAATTAAAAAAGAGTATGG + Intergenic
957800921 3:85079905-85079927 TTGAGAAGGAAGGATGATGAAGG + Intronic
957810597 3:85215939-85215961 TAGAGAATGAGGGAGGAGGAGGG + Intronic
957825133 3:85431874-85431896 TTTAGACTGAAGAAAGAGCATGG - Intronic
958457784 3:94354298-94354320 TTAGAAATGAAGAAGGAAGAAGG + Intergenic
958648684 3:96906957-96906979 TGGAGAATAATGAAGGAGAATGG + Intronic
958962358 3:100522409-100522431 CTGTGAATTCAGAAGGAGGATGG - Intronic
959191032 3:103112114-103112136 TTGACTCTGAAGAAGGAAGAAGG + Intergenic
959395292 3:105829563-105829585 TGGAGACTGAGGCAGGAGGATGG + Intronic
960664849 3:120098767-120098789 TTGAAGATGAAGAAAGAAGAGGG + Intergenic
960878033 3:122315975-122315997 CTGAGAATGAAGATGGAAGATGG - Intergenic
961231858 3:125320167-125320189 TTGAGAAAACAGAGGGAGGAAGG - Intronic
961295144 3:125878630-125878652 ATGAGAATGAAGGAAGAGAATGG + Intergenic
961890756 3:130128532-130128554 ATGAGAATGAAGGAAGAGAATGG - Intergenic
962493195 3:135914031-135914053 TTGGGAATGAACAGGCAGGAAGG - Intergenic
963340854 3:144031295-144031317 TTAAGATTGAAAAAAGAGGAAGG - Intronic
963375511 3:144458626-144458648 TTAAAAATGAAGAAAGAGGCTGG + Intergenic
963673256 3:148278954-148278976 TTGAGGATGCAGAAGCAGGGAGG + Intergenic
964004397 3:151811139-151811161 ATGAGAATGAAGAATGTGGTAGG - Intergenic
964414673 3:156434793-156434815 CTGAGAAAGAAGAAGGAGTTGGG + Intronic
965264009 3:166517874-166517896 GTGAGACTGAAGCAGGAGAACGG + Intergenic
965664907 3:171082861-171082883 TTTTGATTCAAGAAGGAGGAAGG - Intronic
965697841 3:171427959-171427981 TTGAGCTTGAGGAATGAGGAGGG + Intronic
966014082 3:175119487-175119509 TTGAGAAAGACAAAGGAGGTGGG + Intronic
966058882 3:175731832-175731854 TTAAAAAAGAAAAAGGAGGAGGG - Intronic
966521913 3:180882416-180882438 AGGAGAAGGAGGAAGGAGGAAGG - Intronic
966843112 3:184105549-184105571 TTTAGGATGAAGAATGAGGCTGG - Intronic
967112273 3:186304365-186304387 GAGAGAATGAAGCAGGAAGAAGG - Intronic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
967426234 3:189330467-189330489 TTTAGGATAAATAAGGAGGAAGG - Intergenic
968020812 3:195387104-195387126 TTGGCAATGAAGAGGGAGGGAGG + Intronic
968141869 3:196264711-196264733 TTGAGAAAAAAGGAGTAGGAAGG - Intronic
968914402 4:3490996-3491018 ATGAGCAGGAAGAAGAAGGAAGG - Intronic
969002141 4:3990947-3990969 GTGAGAATGAAGGAAGAGAATGG - Intergenic
969096467 4:4736265-4736287 TGGAAAATGAAGAAGGAAGTTGG + Intergenic
969568816 4:7996026-7996048 CTGGGCATGAAGGAGGAGGAAGG - Intronic
969751862 4:9117563-9117585 ATGAGAATGAAGGAAGAGAATGG + Intergenic
969973474 4:11072603-11072625 GTGAGAATGAAGCCGCAGGATGG - Intergenic
970209702 4:13696598-13696620 TTTTGAAGGAAGGAGGAGGATGG + Intergenic
970586289 4:17517601-17517623 CTAAGAAGGAAGAAGGAGGAAGG - Intronic
970904245 4:21196930-21196952 TTGAGTGGGAAGAAGGATGAGGG - Intronic
970998918 4:22300793-22300815 TGGAGAATAAAGAGGGAAGAAGG - Intergenic
971477184 4:27083517-27083539 TAGAGACTTCAGAAGGAGGATGG - Intergenic
974009040 4:56590566-56590588 GTGAGGCTGAAGCAGGAGGATGG - Intronic
974229283 4:59088962-59088984 TAGAAAAAGAAGAAGGAGGAGGG - Intergenic
974794496 4:66731275-66731297 TTCAGAATGAAGCTAGAGGAAGG - Intergenic
975583872 4:75930980-75931002 TAGAGAGTGAAGGAGGAGGTGGG - Intronic
975967592 4:79993352-79993374 GAGAGAATAAAGAAGGAGGAAGG + Intronic
977242565 4:94590879-94590901 TAGAAAATGAAGAAGCAGGGAGG + Intronic
977255020 4:94731139-94731161 TAGAGTATAAAGAAGGAGTATGG + Intergenic
977328353 4:95605504-95605526 ATGACAAAGAAGAAGGAGAACGG - Intergenic
977466376 4:97387043-97387065 TGATGAATGATGAAGGAGGAAGG + Intronic
977492575 4:97733424-97733446 TTTAGAATGTAGAAGGGGGAGGG + Intronic
977560712 4:98530844-98530866 AGGAGGATGAAGCAGGAGGATGG - Intronic
977711361 4:100129626-100129648 CTGAGATTCAACAAGGAGGATGG + Intergenic
977922382 4:102659886-102659908 TGGAGAAGGAAGAATCAGGAAGG - Intronic
978785756 4:112607834-112607856 TGGAGGCTGAAGCAGGAGGATGG + Intronic
978858321 4:113418646-113418668 GAGAAAAAGAAGAAGGAGGAGGG - Intergenic
980153558 4:129078912-129078934 TTCAGAATGCAGAAGGTGAAGGG + Intronic
981823946 4:148917907-148917929 TTGAGAATGAACAAGCAGCCAGG + Intergenic
982134036 4:152256981-152257003 TTGTGAAGGAAGAAAGAGCAAGG - Intergenic
982507411 4:156238170-156238192 TTGAGAATGAAGGAAGAGAGTGG + Intergenic
982735520 4:159002954-159002976 TGGAAATTGAAGAAGCAGGAAGG - Intronic
983640759 4:169942127-169942149 TTGAAAAAGCAGAAGCAGGAAGG + Intergenic
984153175 4:176160166-176160188 TTGAGCATGTAGAAGGGAGAAGG + Intronic
984187564 4:176564578-176564600 TTAAGAGTAAAGAAGGAGGTCGG - Intergenic
984447974 4:179861596-179861618 TTGCAAATCAAGGAGGAGGAAGG + Intergenic
984459284 4:180012525-180012547 ATGAGCAGGAAGAAGGAGAAAGG - Intergenic
984476114 4:180237205-180237227 ATGAGAAGCAAGAAGTAGGAAGG + Intergenic
984511963 4:180689872-180689894 TTGAGACTGATTAAAGAGGAGGG + Intergenic
984591815 4:181625707-181625729 GGGAGACTGAAGAAGGAGAATGG + Intergenic
984791318 4:183617390-183617412 TTGAAAAAAAAGAAAGAGGAAGG - Intergenic
984809108 4:183778457-183778479 TTGACAATCAAGAAGAATGAAGG - Intergenic
985104388 4:186486624-186486646 TTTAGGATGAAGAAGAAGGCAGG + Intronic
985117277 4:186604817-186604839 GTGAGGAGGAAGAGGGAGGAGGG + Intronic
986296671 5:6445079-6445101 CTGAGATGGAAGAAGGAGGGGGG + Intergenic
987022387 5:13888004-13888026 TTGAGTATGACGAGGAAGGATGG - Intronic
987293622 5:16530992-16531014 GGGAGAATAAGGAAGGAGGAAGG + Intronic
987586326 5:19861548-19861570 TTGAGAATAAAGAGGGACAAAGG + Intronic
987700755 5:21395073-21395095 TTTAGATTGAAAAAGGAGGCAGG - Intergenic
988459395 5:31419165-31419187 TTGTGTTTCAAGAAGGAGGAGGG + Intronic
988907431 5:35803596-35803618 GTGAGAATGAAGAAGGTGAGTGG - Intronic
989411911 5:41129301-41129323 GAGAGAAAGAAGAAGGAAGAAGG - Intergenic
989487949 5:42013587-42013609 GTGAGAATGGAGAGGGAGAAAGG - Intergenic
989629771 5:43469737-43469759 TTGAGAATAAAATAGGAGGCAGG - Intronic
989756213 5:44958748-44958770 AGGAGAAGGAAGAAGGAAGAAGG - Intergenic
990082845 5:51938057-51938079 TAGAGAATGAGGTATGAGGATGG + Intergenic
990153675 5:52849464-52849486 ATGAAAATGAAGAAGGAAAATGG + Exonic
990165093 5:52986164-52986186 TTGACAATGAAGAATGGGAAAGG + Intergenic
990279238 5:54231945-54231967 TTGAGATTGGAGAGGGAGTATGG - Intronic
990325108 5:54667536-54667558 TTGAGGATGCAGAAGGGTGAGGG - Intergenic
990682413 5:58260066-58260088 TGAAGTATGAAGAAGTAGGAAGG + Intergenic
990691099 5:58364859-58364881 TTGAGGATGAAAGAGGAGAATGG - Intergenic
990736569 5:58869932-58869954 TTGATTTTGAAGAAGGAGAATGG + Intergenic
990812784 5:59747904-59747926 TTGAGAAAGAAGCAGCAGAAAGG - Intronic
990839169 5:60056369-60056391 ATGTGAATGATGAAGGAAGACGG + Intronic
992071724 5:73154786-73154808 CTGGGAATGGAGAAGGAGGGAGG - Intergenic
992133615 5:73720344-73720366 TTGAAAAAGAAGAAAAAGGAAGG + Intronic
992453228 5:76892013-76892035 TTCAGAATGAAGGAGGAGGAAGG + Intronic
992912667 5:81412601-81412623 ATGAGAATGGAGGAGGAGGAGGG - Intergenic
993014498 5:82520240-82520262 GTGAGAATAAAGAAGATGGATGG + Intergenic
993639961 5:90390782-90390804 TTGAGAATGAAGGAGCTAGAGGG - Intergenic
994178210 5:96734985-96735007 TTGAGAAGGAAGAGGAAGGTGGG + Intronic
994253325 5:97563088-97563110 TGGAGAAGGAAGAAGGAAGGGGG + Intergenic
994672393 5:102778121-102778143 TAGAGAATTAAAAAGGAGGCGGG + Intronic
994731046 5:103490672-103490694 GGGAGAATGAAGGAGGAGGGAGG - Intergenic
995037764 5:107554586-107554608 TTCAGAATTAAAAAGGAGGTAGG + Intronic
995328325 5:110917648-110917670 TGGAGAAAGAAGCAGGAGAAGGG + Intergenic
995616392 5:113969057-113969079 TGGGGAATGAAGGAGAAGGATGG + Intergenic
995915998 5:117245624-117245646 GAGAGAATGAAGAAGGAGATGGG + Intergenic
996546804 5:124688027-124688049 TTCAGAATAAAGAAGGATGAAGG - Intronic
996583761 5:125062090-125062112 TGGAGAATGGAAAAGGAGGGTGG + Intergenic
996685434 5:126274851-126274873 TTGAGAATGAACACGGAAAAGGG - Intergenic
996845881 5:127898566-127898588 GTGAGAAGGAGGGAGGAGGAAGG + Intergenic
997084266 5:130778491-130778513 TTTAAAAAGAAAAAGGAGGAAGG + Intergenic
997428032 5:133817638-133817660 AAGAGAATGAGGAAGAAGGAAGG + Intergenic
997506599 5:134422729-134422751 TTGAGAAAGCAGCAAGAGGAAGG + Intergenic
997572154 5:134938632-134938654 GTGAGAGTGGAGAAGGGGGAGGG + Intronic
997832496 5:137162952-137162974 TTGGGAATGGAGAAGCAGAAAGG + Intronic
998511576 5:142718550-142718572 TTGAGAGTGAAAAAGAAGGCAGG - Intergenic
998604066 5:143615599-143615621 GAAAGAAGGAAGAAGGAGGAAGG - Intergenic
998630065 5:143888356-143888378 CTCAGAGTGAAGAAGGAGGAGGG + Intergenic
999134016 5:149305749-149305771 TTTAGAAGGAAGTAAGAGGAAGG + Intronic
999585537 5:153085747-153085769 GAGAGAAGGAAGAAGGAAGAAGG + Intergenic
999651106 5:153768243-153768265 GTGAGAAAGAAGAAGAAAGAAGG - Intronic
1000674923 5:164108861-164108883 TAGAGAATGAAGCAGAATGAAGG + Intergenic
1002062434 5:176633711-176633733 TAAAGAAAGATGAAGGAGGATGG + Intronic
1002151138 5:177232002-177232024 GTGAGACTGAAGCAGGAGGATGG - Intronic
1002209050 5:177585099-177585121 CAGAGAAAGAAGGAGGAGGAAGG + Intergenic
1002452830 5:179329220-179329242 TTGAGGCTGAAGCAGGAGAATGG + Intronic
1002650762 5:180691508-180691530 TTGATAATGAAGCTGGAGGTTGG - Intergenic
1002883302 6:1271896-1271918 TTCAAAATGAGGAAGGAGGAGGG - Intergenic
1002969138 6:1996155-1996177 ATGAGAAAGAGGAAGGAGGAAGG - Intronic
1003046439 6:2737448-2737470 CAGAGACTGAAGAAGGAGAATGG - Intronic
1003517284 6:6827593-6827615 TTGTGAAAGAAAAAGGAGGCCGG + Intergenic
1003872543 6:10413723-10413745 TTCAGAAAGAAAAGGGAGGAGGG + Intronic
1004144742 6:13054874-13054896 TTGAGGATGTAGAGGGAAGAAGG - Intronic
1004886512 6:20056440-20056462 TTGAGAATAAAGAGGGAGCATGG + Intergenic
1005195282 6:23276077-23276099 TGGAGAATGAGGAATGAAGAGGG + Intergenic
1005211306 6:23467444-23467466 TTGAGGATGTAAAGGGAGGATGG + Intergenic
1005267413 6:24126431-24126453 TTATGCATGAAGAAGGAGGAAGG - Intronic
1005706253 6:28456616-28456638 AAAAGAATGAAGAAGGAGAAAGG + Intergenic
1006510634 6:34519318-34519340 TTGAGGAGGAAGGAGGAGGATGG - Intronic
1006735147 6:36268073-36268095 TGGAGAATGAGGAAGGAGGATGG - Intronic
1006808386 6:36803950-36803972 ATGAGAATACAGCAGGAGGAAGG + Intronic
1007139239 6:39554827-39554849 TGGAGAAAGATGGAGGAGGAGGG - Intronic
1007235661 6:40390006-40390028 AGGAGAGTGAGGAAGGAGGAAGG + Intergenic
1007377440 6:41466538-41466560 AAGAGAGGGAAGAAGGAGGAAGG + Intergenic
1007663188 6:43498952-43498974 CTGAGAAGCAAGAAGGAGGCAGG - Intronic
1007987937 6:46225956-46225978 TTGTGTATAAAGTAGGAGGAAGG + Intronic
1008134608 6:47759433-47759455 TTGAGAATGAAGAAGTAACAGGG + Intergenic
1008639205 6:53444228-53444250 TTGAGGTTGATGAAGGAGAAAGG - Intergenic
1009334354 6:62467502-62467524 GTAAGAAAGAAGAAGGAGGAAGG + Intergenic
1009915360 6:69988698-69988720 TTGAGACTGCTGAGGGAGGAGGG - Intronic
1010063459 6:71652213-71652235 TAGAGAATGAATAAGGAGGCTGG - Intergenic
1010126967 6:72443710-72443732 AAAATAATGAAGAAGGAGGAAGG + Intergenic
1010130716 6:72490342-72490364 CTGAGAATGAAGAAGGTGTAAGG + Intergenic
1010462166 6:76125994-76126016 TTAAGAAGGAAGACGAAGGAAGG + Intergenic
1010672321 6:78700562-78700584 TTTATAATTAGGAAGGAGGATGG - Intergenic
1010828695 6:80504164-80504186 TTGAGACTGTTGAAAGAGGAGGG + Intergenic
1011140627 6:84151681-84151703 TTGGGGATGGAGAAGGAAGAAGG + Intronic
1011152726 6:84291607-84291629 TTGAGAAGGAAGAAGACTGATGG - Intergenic
1011426275 6:87234880-87234902 TTGAGAATAGACAAGTAGGAAGG + Intronic
1011450542 6:87487262-87487284 TTGAGAATGAATTAGAAGTAGGG + Intronic
1011635040 6:89363911-89363933 TTGAGGATGCAAAAGGAGGGCGG - Intergenic
1011771285 6:90676225-90676247 TTGGGGAGGGAGAAGGAGGATGG + Intergenic
1011980232 6:93365642-93365664 TTGAGAATGAACAGCGAGCAGGG + Intronic
1012289691 6:97437480-97437502 GTGTGCATGATGAAGGAGGAAGG - Intergenic
1012762768 6:103322784-103322806 TAAAGATTGGAGAAGGAGGAGGG - Intergenic
1012954597 6:105555188-105555210 TTGAGGATGAAGCAGGAACAAGG + Intergenic
1013764526 6:113559212-113559234 TTGGGCATGAAGAAGGAAGTGGG + Intergenic
1014715558 6:124861048-124861070 CTGAGAAGGGACAAGGAGGAAGG - Intergenic
1014720955 6:124917829-124917851 TTGAGAACTAAAAGGGAGGAAGG - Intergenic
1014758013 6:125323231-125323253 TAGAGGATGAAGAAGGAGCTTGG + Intergenic
1014808609 6:125859969-125859991 TTGAGAGGGAAGTAGGAGAAAGG + Intronic
1015011696 6:128357074-128357096 TTAAGAATGAGGATGGAGGCTGG + Intronic
1015223367 6:130829723-130829745 TTTGGAATGAAGAAAGGGGAAGG - Intronic
1015450968 6:133365584-133365606 GTCAGGATGCAGAAGGAGGAAGG + Intronic
1015863426 6:137704143-137704165 AGGAGATTGAAGCAGGAGGATGG - Intergenic
1016229553 6:141786077-141786099 AAGAGAAGGAAGAAAGAGGAAGG - Intergenic
1016361282 6:143269998-143270020 TAGTGAAGGAAGAAGAAGGAAGG + Intronic
1016860876 6:148717545-148717567 TTAAGAATGACAAAGGAGGCTGG - Intergenic
1017407256 6:154133804-154133826 TTGAGAATGAAGCACTTGGAGGG - Intronic
1017495059 6:154976440-154976462 CTGAGAATGTAGAAGGATGTTGG + Intronic
1017703746 6:157100456-157100478 CTCAGAATGAAGAAGCAGGCTGG - Intronic
1017716391 6:157216720-157216742 TTCAGAATGAAAAAGCACGATGG - Intergenic
1017865780 6:158442043-158442065 GGGAGAATGAGGGAGGAGGAGGG - Intronic
1018005219 6:159615801-159615823 ATAAGAATGAGGAAGGAGGATGG + Intergenic
1018153208 6:160960059-160960081 TTTAGAATGAGGAAGAAGAAGGG + Intergenic
1018317458 6:162570809-162570831 TTGGGAAGGTAGAGGGAGGATGG + Intronic
1018561072 6:165101348-165101370 TAGAGAAGGAAAAAGAAGGAAGG - Intergenic
1018657369 6:166051302-166051324 TGGAGACTGAAGCAGGAGGATGG + Intergenic
1019101525 6:169634767-169634789 TACAGGCTGAAGAAGGAGGACGG - Intronic
1019289272 7:242438-242460 CTGAGAAAGCAGAAGGAGGAGGG + Intronic
1019484068 7:1280430-1280452 AGAAGAAGGAAGAAGGAGGAAGG + Intergenic
1019484074 7:1280472-1280494 AGAAGAAGGAAGAAGGAGGAAGG + Intergenic
1019484079 7:1280499-1280521 AGAAGAAGGAAGAAGGAGGAAGG + Intergenic
1019484085 7:1280526-1280548 AGGAGGAAGAAGAAGGAGGAAGG + Intergenic
1019484100 7:1280601-1280623 GGGAGAAGGAAGAAGGAGGAAGG + Intergenic
1019484117 7:1280690-1280712 AGAAGAAGGAAGAAGGAGGAAGG + Intergenic
1019484130 7:1280762-1280784 AGAAGAAGGAAGAAGGAGGAAGG + Intergenic
1019484136 7:1280796-1280818 AGAAGAAGGAAGAAGGAGGAAGG + Intergenic
1019484153 7:1280881-1280903 GGGAGAAGGAAGAAGGAGGAAGG + Intergenic
1019484165 7:1280949-1280971 AGAAGAAGGAAGAAGGAGGAAGG + Intergenic
1019484182 7:1281034-1281056 GGGAGAAGGAAGAAGGAGGAAGG + Intergenic
1019484188 7:1281068-1281090 AGAAGAAGGAAGAAGGAGGAAGG + Intergenic
1019549245 7:1594006-1594028 GAGGGAAAGAAGAAGGAGGAGGG - Intergenic
1019951543 7:4377105-4377127 GGGAGGTTGAAGAAGGAGGATGG + Intergenic
1020254165 7:6492773-6492795 TAGAGGAGGAAGGAGGAGGAGGG + Intergenic
1021255518 7:18387555-18387577 TAGAAAATGAGGAAGGAGGTAGG + Intronic
1021301642 7:18980792-18980814 AGGAGAAGGAAGAAGGAAGAAGG - Intronic
1021345601 7:19524448-19524470 CTGAAAATGAAGAAGCAGAAAGG + Intergenic
1021368260 7:19808661-19808683 TTGAGAATGAAAAAGGGAAATGG + Intergenic
1021381108 7:19967509-19967531 GTGAAAATGAAGAGGGATGACGG - Intergenic
1021750218 7:23791312-23791334 TTAAGAATTAAGAAGTTGGATGG + Intronic
1022037814 7:26550591-26550613 AGGAGGAAGAAGAAGGAGGAAGG + Intergenic
1022270976 7:28807810-28807832 TTGAGAATGAAGAAGGAGGAAGG + Intronic
1022597000 7:31722245-31722267 TTGAGCATGAAGTGGGAGCAAGG - Intergenic
1022633216 7:32105640-32105662 GGGAGGATGAAGAGGGAGGATGG - Intronic
1022891936 7:34710136-34710158 TTGAGACTGAAGAGGGATCAGGG - Intronic
1023063705 7:36353775-36353797 TTAAGAATAAACAAGGAGGCTGG - Intronic
1023234408 7:38068673-38068695 TTGAGAATAAATAATGAAGAGGG - Intergenic
1023263660 7:38382499-38382521 TTGAAAATGAAGGAGATGGAGGG - Intergenic
1023282258 7:38583091-38583113 TTGAAAATGAATAAGCGGGATGG - Intronic
1023614096 7:42000944-42000966 TTAAGAAAAAAAAAGGAGGAGGG + Intronic
1023792226 7:43762114-43762136 TTGAGGAGGAACAAGGAGGAAGG + Intronic
1023910663 7:44553352-44553374 GCGAGGAGGAAGAAGGAGGAGGG + Intergenic
1023968794 7:44977188-44977210 CTGAGAGTGGAGAAGGAAGAAGG + Intronic
1023968798 7:44977195-44977217 TGGAGAAGGAAGAAGGGGGCAGG + Intronic
1024564992 7:50673573-50673595 CTGAGGATGAAGAAGGAGGGGGG - Intronic
1024778218 7:52813875-52813897 TTGAGAAAGAAGAATGAAGCAGG - Intergenic
1024833370 7:53487653-53487675 AGGGGAATGAAGAAGGAAGAAGG - Intergenic
1024903965 7:54354693-54354715 GTAAGAGGGAAGAAGGAGGAGGG - Intergenic
1024911916 7:54456248-54456270 ATGAGAATGAAGAGGAGGGAAGG + Intergenic
1026206297 7:68260709-68260731 AAGGGAAAGAAGAAGGAGGATGG - Intergenic
1026217663 7:68364018-68364040 GAGAAAAAGAAGAAGGAGGAGGG - Intergenic
1026474904 7:70726893-70726915 AAGAGAATGAGGAAGGGGGATGG - Intronic
1026556366 7:71412107-71412129 TAGAGAATGTAGAAGGAAGAAGG - Intronic
1026575991 7:71571905-71571927 TGGAGACTGAGGTAGGAGGATGG + Intronic
1026893264 7:73995549-73995571 TTGAGCCTGAGGCAGGAGGATGG + Intergenic
1027466400 7:78520002-78520024 TTAAGAATCAAAAAAGAGGAAGG + Intronic
1028847792 7:95501789-95501811 ATGAGAAGGAAGAAAGAGGTAGG + Intronic
1028921376 7:96314108-96314130 AGGAGGAGGAAGAAGGAGGAAGG + Intronic
1029124626 7:98287686-98287708 TGGAGAATTAGGAAGCAGGAGGG + Intronic
1029422082 7:100477099-100477121 CAGAAAATGAAGTAGGAGGAAGG + Intronic
1030740890 7:113108583-113108605 TTGAAAATGAAGAAGTAGTTTGG + Intergenic
1031142225 7:117956031-117956053 TGGAGAAAGAAGGAGGATGAGGG + Intergenic
1031153795 7:118085523-118085545 TTGAAAATGGAGGAGGAGTAGGG - Intergenic
1031424170 7:121585597-121585619 TTGACAAAGAAAAAGGAAGATGG - Intergenic
1031863850 7:127015129-127015151 AGGAGAAGGAAGAAGGAAGAAGG + Intronic
1031984184 7:128152254-128152276 TTGGGGTTGAAGGAGGAGGAAGG - Intergenic
1032486071 7:132288378-132288400 TTGAGAATGAAGTGGGAAGTGGG + Intronic
1032790892 7:135241672-135241694 GTGAAAATGTACAAGGAGGAGGG - Intronic
1032876071 7:136039613-136039635 TATAAAATGGAGAAGGAGGAAGG - Intergenic
1033602469 7:142898095-142898117 TTAAGAATCATGAAGGAGGCTGG + Intergenic
1033755873 7:144398230-144398252 TTGAGATTGAGGAAGGTGGGAGG - Intronic
1033890469 7:146006537-146006559 TAGAAGAAGAAGAAGGAGGAGGG - Intergenic
1034075970 7:148231549-148231571 ATGAGAATGAAAAAGAGGGAGGG - Intronic
1034194808 7:149238517-149238539 TTGAGTATTGAGATGGAGGATGG + Intergenic
1034244826 7:149636279-149636301 TTGAGACAGAAGGAGGAGAATGG - Intergenic
1034261787 7:149761438-149761460 TGGAGATTAGAGAAGGAGGAGGG + Intergenic
1034749008 7:153551228-153551250 TTGAAAATGCAGAAGGAGCAGGG - Intergenic
1034902923 7:154918735-154918757 GTGTGAATGAAGAATGAGGAGGG + Intergenic
1035138941 7:156737891-156737913 TTAAGACTGAAGCAGTAGGAGGG + Intronic
1035143323 7:156786226-156786248 AAGAGAAGGAGGAAGGAGGAAGG + Intronic
1035863711 8:3058885-3058907 TTCAGAATGGAGGAGGAGGTGGG - Intronic
1035920406 8:3669882-3669904 TTAAGAAAGAAGAAGGAAGGAGG - Intronic
1036053610 8:5226862-5226884 AGGAAAATGAAGAAGGAGGGAGG - Intergenic
1036375071 8:8192993-8193015 ATGAGAATGAAGGAAGAGAATGG + Intergenic
1036625296 8:10466114-10466136 TTGACTTTGAAGATGGAGGAAGG + Intergenic
1036673492 8:10809790-10809812 ATTAGAATGATGAACGAGGATGG - Intronic
1036854471 8:12230155-12230177 ATGAGAATGAAGGAAGAGAATGG - Intergenic
1036875830 8:12472655-12472677 ATGAGAATGAAGGAAGAGAATGG - Intergenic
1037317454 8:17612342-17612364 AGGAGAAGGAAGAAGGAAGAGGG - Intronic
1037638605 8:20722527-20722549 CTGAGAATGAAGTGGTAGGATGG + Intergenic
1038076082 8:24076644-24076666 AGAAGAAAGAAGAAGGAGGAAGG - Intergenic
1038281854 8:26172967-26172989 TTGAAAATGAAGATGGAGTGGGG - Intergenic
1038654366 8:29435794-29435816 TTCAGCAGGAAGAAGAAGGAAGG + Intergenic
1038694598 8:29795148-29795170 TAGAGGAGGAAGAAGGAGGATGG - Intergenic
1038795226 8:30703747-30703769 AGGAGAAAGAAGAAGAAGGAAGG + Intronic
1039343888 8:36682547-36682569 TTGAGACTGAAGAGGGAAGTTGG + Intergenic
1039555258 8:38470531-38470553 TGGAGGCTGAAGAAGGAGGATGG + Intergenic
1039747784 8:40445633-40445655 TTAAGAAAAAAGAAAGAGGAAGG - Intergenic
1039830299 8:41208094-41208116 TTGAGGATGAAGAAGGAGACAGG - Intergenic
1039860524 8:41453301-41453323 AAGAGAATGAAGAATGGGGATGG + Intergenic
1040033978 8:42851079-42851101 GTGAGGTTGAAGAAGCAGGAAGG - Intronic
1040595124 8:48830677-48830699 TGGAGAATGAGAAAGGAAGAAGG - Intergenic
1040829238 8:51659515-51659537 TTGAGGATGAAGAAAAGGGATGG + Intronic
1041158471 8:55012203-55012225 ATGAAAATGAAGAAGGATCATGG - Intergenic
1042100564 8:65271510-65271532 GTGAAGATGAAAAAGGAGGACGG + Intergenic
1042255851 8:66802743-66802765 GTAGGAAGGAAGAAGGAGGAAGG + Intronic
1042317573 8:67440148-67440170 TAGAGAATTCAGAAGGTGGATGG - Intronic
1042334117 8:67612480-67612502 TTGAGAAAGAAGAAAGGAGAAGG - Intronic
1042588765 8:70373946-70373968 TTGAAAATGAAGAATAAGGTTGG - Intronic
1043021859 8:75011994-75012016 TTGTGAAGGAAGAAAGAGTAGGG + Intronic
1043506271 8:80906441-80906463 GTGAGAAAGAATAAGGAAGAGGG - Intergenic
1043803575 8:84643033-84643055 TGGAGAATGAAGTTGGAAGAAGG + Intronic
1044374033 8:91448399-91448421 GGGAGAATGGAGAAGGAGAAGGG - Intergenic
1045199273 8:99962593-99962615 TTCAGAATGTACAGGGAGGAAGG - Intronic
1045224227 8:100229109-100229131 TTAAGAATGAGGAAGTAGGCCGG + Intronic
1045301949 8:100918942-100918964 TAGAGGAGGAAGAAAGAGGAAGG + Exonic
1045500818 8:102743123-102743145 TTGAGAACAAAGAAGGAGTCAGG + Intergenic
1045607923 8:103799001-103799023 TTGAGTTTGAAGATGGGGGAAGG + Intronic
1045840039 8:106569245-106569267 TTGAGAAGAAAGAAGAAGGGGGG - Intronic
1046175818 8:110573604-110573626 TTGAGAATGATGCAGGAGAGTGG - Intergenic
1046525712 8:115379995-115380017 GAGAGAGAGAAGAAGGAGGAAGG + Intergenic
1046526190 8:115384945-115384967 TTTAAAAGGAAGAAGGAGGTGGG + Intergenic
1046815090 8:118574270-118574292 TTGACAATGTAAAAGGAGGGCGG - Intronic
1048557629 8:135496138-135496160 ATGAGAAAGCAGAAGTAGGAAGG + Intronic
1048731686 8:137448991-137449013 TTGATAAAGAGGATGGAGGAAGG + Intergenic
1048837862 8:138538306-138538328 CTGAGAGTGGAGAAGAAGGAAGG + Intergenic
1048951530 8:139500876-139500898 TTGTGAATGGAGGAGGAGGAAGG + Intergenic
1049303281 8:141883159-141883181 AAGAGAAGGAAGAAGCAGGAGGG + Intergenic
1049580721 8:143409313-143409335 TTGAGACTGAAGGAGGGTGAAGG - Intergenic
1050475915 9:6040960-6040982 AGAAGAAAGAAGAAGGAGGAAGG - Intergenic
1050610438 9:7346871-7346893 TGGAGGATGGAGGAGGAGGATGG - Intergenic
1050628946 9:7538555-7538577 TTGAGAGTGAAGATGGAGGCAGG + Intergenic
1051711643 9:19936376-19936398 TGGAGGCTGAAGAAGGAGGATGG - Intergenic
1052152872 9:25140908-25140930 TTGAGAAAGAAGAATGAAGTTGG + Intergenic
1052427076 9:28319253-28319275 TTGAGAATGGAGGAGGAGAGGGG - Intronic
1052483950 9:29071294-29071316 GGGAGACTGAAGAAGGAGGATGG - Intergenic
1052968141 9:34357875-34357897 TGAAGAAGGAAGAAGGAGGAAGG - Intergenic
1053086998 9:35233608-35233630 TGGAGAAGGAAAAAGGAGAACGG - Intronic
1053107787 9:35427137-35427159 TGAAGAAAGAAGAAGGAGAAAGG - Intergenic
1053154227 9:35763961-35763983 TTGAGAAAGGAGAGAGAGGAGGG + Intergenic
1054747362 9:68868245-68868267 AGGATAAAGAAGAAGGAGGATGG + Intronic
1054845597 9:69793695-69793717 TTGAGAAAGAAACAGAAGGAAGG - Intergenic
1054924424 9:70575182-70575204 TTTAAAATGAGGAGGGAGGATGG - Intronic
1054961472 9:70974970-70974992 GGGAGACTGAGGAAGGAGGATGG - Intronic
1055097690 9:72430809-72430831 TTGAGGATGAAGAGGGAGATGGG - Intergenic
1055791660 9:79929067-79929089 CTGGGCATGAAGAAGGAGGTGGG - Intergenic
1056118688 9:83465470-83465492 TGGAGAAGGAAGACAGAGGAAGG - Intronic
1056164496 9:83928136-83928158 TTGAGAAGGAATGAGGAAGATGG + Intergenic
1056318518 9:85414920-85414942 TTGAGAGAGAGGAAGGAGAAGGG + Intergenic
1056560879 9:87728022-87728044 TCTAGAATGAAGAAGGATGGAGG + Exonic
1056566024 9:87772874-87772896 TCTAGAATGAAGAAGGATGGAGG + Intergenic
1056574512 9:87844575-87844597 TTTAGAATGAAGAAGGATGGAGG + Intergenic
1056831019 9:89917684-89917706 TTGAAAATGAGGAATGTGGATGG - Intergenic
1056838012 9:89973384-89973406 TGGAGAAGGAAGATTGAGGAAGG - Intergenic
1056861309 9:90185637-90185659 TTGAAAATGAAGAATAAAGATGG - Intergenic
1056878272 9:90360244-90360266 TTGAAAATGAGGAATGAGGTGGG - Intergenic
1056958262 9:91099764-91099786 TAGAAAATGAAAGAGGAGGAGGG + Intergenic
1057007445 9:91573122-91573144 GTGAGACAGGAGAAGGAGGAAGG + Intronic
1057226654 9:93296431-93296453 GGGAGGATGGAGAAGGAGGAAGG - Intronic
1057226662 9:93296458-93296480 GGAAGGATGAAGAAGGAGGAAGG - Intronic
1057345445 9:94246753-94246775 TTGACACTGTGGAAGGAGGAGGG - Intergenic
1057664867 9:97037598-97037620 TCTAGAATGAAGAAGGATGGAGG - Exonic
1057737152 9:97673778-97673800 TTGAAAATGAAAGATGAGGAAGG + Intergenic
1057856050 9:98601605-98601627 ATAAGAAGGAAGGAGGAGGAGGG + Intronic
1057878367 9:98774591-98774613 TTGGGAGTGAAGAAGGAAGCAGG + Intronic
1058069276 9:100585199-100585221 GAGGGAATGAAGAAGGAGGAGGG + Intronic
1058102379 9:100931679-100931701 ATGGGAATGAAGAACTAGGAGGG + Intergenic
1058151802 9:101471985-101472007 TAGAGCCTGAAGAATGAGGATGG - Intergenic
1058164848 9:101607550-101607572 GTGAGCAGGGAGAAGGAGGAGGG + Intronic
1058634242 9:107020929-107020951 TTAAGTATGAAGATGGAAGATGG + Intergenic
1058947565 9:109873036-109873058 TTGAGAGTCAAGAAAGAGGAAGG + Intronic
1059266239 9:113034089-113034111 CTGAGAATGAATAATGAAGAAGG + Intergenic
1059303396 9:113333950-113333972 AGGAGAAGGAAGAAGGAAGAAGG - Intronic
1059562626 9:115349946-115349968 TAGAGAAGGAAAAAGGAGCACGG + Intronic
1059624952 9:116053472-116053494 CTGAGAATGAGGATGGAGAAAGG - Intergenic
1059639618 9:116203949-116203971 TTGAGGTTGTAGAAGGAAGAAGG + Intronic
1059807800 9:117822826-117822848 TAGAGAGTGAAGAGGGTGGAGGG - Intergenic
1060108244 9:120888275-120888297 ATGAGTGTGAAGAAGGAGGCTGG - Intronic
1060203178 9:121664335-121664357 TTGAGAAAGAAGAAACAGGTTGG - Intronic
1060912878 9:127364530-127364552 TTGAAAATCAAGAAGGACCAAGG + Intronic
1060937522 9:127524294-127524316 TTGAGAATGAAATTGAAGGAGGG - Intronic
1061244773 9:129395854-129395876 ATGAGAAGGTGGAAGGAGGATGG + Intergenic
1061585258 9:131563018-131563040 TTAAGAATGAAAAGGGAGGGAGG - Intergenic
1062438565 9:136558261-136558283 TGGAGACTGAAGCAGGAGAATGG - Intergenic
1203437211 Un_GL000195v1:149983-150005 CAGAGACTGAAGCAGGAGGATGG - Intergenic
1203624309 Un_KI270749v1:155932-155954 GTGAGAATGAAGAATAAGGTGGG + Intergenic
1185871958 X:3672088-3672110 TGGAGGCTGAGGAAGGAGGATGG + Intronic
1185884976 X:3774403-3774425 CTGAGCATGATGAAGGAGAAAGG - Intergenic
1186588878 X:10906987-10907009 TTGAGAAAGAAGAAGAAAGCAGG - Intergenic
1187025729 X:15433863-15433885 AGGAGAAAGAAGGAGGAGGAAGG + Intronic
1187025761 X:15433998-15434020 AGGAGAAAGAAGGAGGAGGAAGG + Intronic
1187025765 X:15434018-15434040 AGGAGAAAGAAGGAGGAGGAAGG + Intronic
1187025774 X:15434061-15434083 AGGAGAAAGAAGGAGGAGGAAGG + Intronic
1187025785 X:15434101-15434123 AGGAGAAAGAAGGAGGAGGAGGG + Intronic
1187049113 X:15678643-15678665 TTGGGGGTGAAGAAGGAGGGAGG + Intergenic
1187527390 X:20066386-20066408 GTGGGAATGAGGAAGGGGGATGG + Intronic
1187572625 X:20520394-20520416 TTGAGAAAAATGAAGGGGGAAGG - Intergenic
1187824738 X:23323660-23323682 TGGAAGAAGAAGAAGGAGGAGGG - Intergenic
1189224796 X:39403623-39403645 TGGAGAATCTGGAAGGAGGAAGG - Intergenic
1189409442 X:40756749-40756771 TTGAAAATGAAGAACGAAGTTGG - Intergenic
1189737772 X:44089068-44089090 TTTTGGATGAAGAAGGAGGAGGG + Intergenic
1190066062 X:47242523-47242545 GTGAGACTGCAGAAGGAGGCTGG + Intronic
1190087689 X:47409943-47409965 TAAAAAATGAAGAAGGAGGCTGG - Intronic
1191054984 X:56232309-56232331 CTGAGAAGGAGGAGGGAGGAAGG - Intergenic
1191108379 X:56786596-56786618 AGGAGAAAGAAGAAGGAGGAGGG - Intergenic
1192082287 X:68060072-68060094 TGGGTAATGAAGAGGGAGGAGGG - Intronic
1192143953 X:68668206-68668228 AAGAGAAAGAAGAAGGAGGAGGG - Intronic
1192234177 X:69285608-69285630 AAGAGAATGGAGAAGGGGGAAGG + Intergenic
1192234180 X:69285615-69285637 TGGAGAAGGGGGAAGGAGGAGGG + Intergenic
1192367317 X:70484795-70484817 TTGAGACAGACAAAGGAGGAAGG + Intronic
1192531276 X:71888850-71888872 TTGGCTTTGAAGAAGGAGGAAGG + Intergenic
1192577906 X:72257646-72257668 TTGAAGATGATCAAGGAGGAAGG + Intronic
1193083631 X:77428778-77428800 CTGAGAATAAAGAAGTAAGAAGG + Intergenic
1193103008 X:77636935-77636957 AGGAGAAGGAAGAAGGAGGAAGG + Intronic
1193370035 X:80684637-80684659 TTTAAAATCAAGAAGGAGAAAGG - Intronic
1193384457 X:80854291-80854313 CTAAGAATGAAGAAAGAGGCTGG - Intergenic
1193523469 X:82559682-82559704 TGGACAATGAAGATGGAGAAAGG - Intergenic
1194640055 X:96392915-96392937 CTGAGTATGAAGCAGTAGGAGGG + Intergenic
1195652072 X:107295457-107295479 GTGGGAATGAAGCAGGAGAATGG + Intergenic
1197503402 X:127270486-127270508 TGGAGAAAGAACAAGGAGGGAGG - Intergenic
1197634008 X:128893673-128893695 GGGAGAATGAAGAACGAAGAAGG - Intergenic
1197759233 X:130015917-130015939 GTGAAAATGGAGAAGGTGGATGG + Exonic
1197801508 X:130354407-130354429 TTAAGAATGAAAAAGGCGGTCGG - Intronic
1198217406 X:134568577-134568599 TTCAGAAGGAACAAAGAGGAAGG - Intronic
1198256007 X:134924965-134924987 TTGCCAAGGAAGAAGGAAGAAGG + Intergenic
1198802217 X:140459567-140459589 TGGAGAATAGAGGAGGAGGAGGG + Intergenic
1199059817 X:143341641-143341663 TTCAAAATGCAGAAGGAAGATGG - Intergenic
1199093408 X:143715619-143715641 TTGAGACTGATGAAGGAAAATGG - Intronic
1199193840 X:145003745-145003767 CTGAAGATGGAGAAGGAGGAGGG + Intergenic
1199214924 X:145252547-145252569 TTGAGACTGATGAAGGAAAATGG + Intronic
1199297049 X:146171219-146171241 AGGAGAAAGGAGAAGGAGGAAGG - Intergenic
1199351904 X:146811257-146811279 TTGAGAATGATGGTGGAGGTAGG - Intergenic
1199352003 X:146813236-146813258 TTGAGAATGATGGTGGAGGTAGG + Intergenic
1199611635 X:149621750-149621772 TTGACTTTGAAGATGGAGGAAGG - Intronic
1199868054 X:151872084-151872106 TTGAGGGTGAAGAGGTAGGAAGG + Intergenic
1199870200 X:151891543-151891565 TGGAGAATGAGGCAGGAGAATGG + Intergenic
1200978207 Y:9236328-9236350 GAGAGAAGGAAGAGGGAGGAAGG - Intergenic
1201557845 Y:15283252-15283274 ATGACCATGAAGAGGGAGGAAGG + Intergenic
1201683497 Y:16675788-16675810 CTGAGAATGGAGAAAGAGAATGG + Intergenic