ID: 1022274532

View in Genome Browser
Species Human (GRCh38)
Location 7:28842357-28842379
Sequence GTTGTGGGAGGGCCACAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022274532_1022274544 16 Left 1022274532 7:28842357-28842379 CCCACTTGTGGCCCTCCCACAAC No data
Right 1022274544 7:28842396-28842418 TGCTACTTATTTATCTTATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022274532 Original CRISPR GTTGTGGGAGGGCCACAAGT GGG (reversed) Intergenic
No off target data available for this crispr