ID: 1022277177

View in Genome Browser
Species Human (GRCh38)
Location 7:28866753-28866775
Sequence CTCTGCTCCTGTAAGCTATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022277177_1022277183 23 Left 1022277177 7:28866753-28866775 CCTCATAGCTTACAGGAGCAGAG No data
Right 1022277183 7:28866799-28866821 ACTCATCTAATGAAGGAAGAAGG No data
1022277177_1022277182 16 Left 1022277177 7:28866753-28866775 CCTCATAGCTTACAGGAGCAGAG No data
Right 1022277182 7:28866792-28866814 ATAGAGAACTCATCTAATGAAGG No data
1022277177_1022277178 -8 Left 1022277177 7:28866753-28866775 CCTCATAGCTTACAGGAGCAGAG No data
Right 1022277178 7:28866768-28866790 GAGCAGAGCCTGTCCTGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022277177 Original CRISPR CTCTGCTCCTGTAAGCTATG AGG (reversed) Intergenic
No off target data available for this crispr