ID: 1022277180

View in Genome Browser
Species Human (GRCh38)
Location 7:28866781-28866803
Sequence TGAGTTCTCTATGCCTGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022277180_1022277183 -5 Left 1022277180 7:28866781-28866803 CCTGACCAGGCATAGAGAACTCA No data
Right 1022277183 7:28866799-28866821 ACTCATCTAATGAAGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022277180 Original CRISPR TGAGTTCTCTATGCCTGGTC AGG (reversed) Intergenic
No off target data available for this crispr