ID: 1022277181

View in Genome Browser
Species Human (GRCh38)
Location 7:28866786-28866808
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022277181_1022277183 -10 Left 1022277181 7:28866786-28866808 CCAGGCATAGAGAACTCATCTAA No data
Right 1022277183 7:28866799-28866821 ACTCATCTAATGAAGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022277181 Original CRISPR TTAGATGAGTTCTCTATGCC TGG (reversed) Intergenic
No off target data available for this crispr