ID: 1022277183

View in Genome Browser
Species Human (GRCh38)
Location 7:28866799-28866821
Sequence ACTCATCTAATGAAGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022277180_1022277183 -5 Left 1022277180 7:28866781-28866803 CCTGACCAGGCATAGAGAACTCA No data
Right 1022277183 7:28866799-28866821 ACTCATCTAATGAAGGAAGAAGG No data
1022277181_1022277183 -10 Left 1022277181 7:28866786-28866808 CCAGGCATAGAGAACTCATCTAA No data
Right 1022277183 7:28866799-28866821 ACTCATCTAATGAAGGAAGAAGG No data
1022277177_1022277183 23 Left 1022277177 7:28866753-28866775 CCTCATAGCTTACAGGAGCAGAG No data
Right 1022277183 7:28866799-28866821 ACTCATCTAATGAAGGAAGAAGG No data
1022277179_1022277183 0 Left 1022277179 7:28866776-28866798 CCTGTCCTGACCAGGCATAGAGA No data
Right 1022277183 7:28866799-28866821 ACTCATCTAATGAAGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022277183 Original CRISPR ACTCATCTAATGAAGGAAGA AGG Intergenic
No off target data available for this crispr