ID: 1022282773

View in Genome Browser
Species Human (GRCh38)
Location 7:28927606-28927628
Sequence AACACAAATCTCTCCAGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022282773_1022282778 -3 Left 1022282773 7:28927606-28927628 CCTTGTCTGGAGAGATTTGTGTT No data
Right 1022282778 7:28927626-28927648 GTTTGTCACAGCTTGGGGGATGG 0: 2
1: 1
2: 16
3: 71
4: 375
1022282773_1022282780 -1 Left 1022282773 7:28927606-28927628 CCTTGTCTGGAGAGATTTGTGTT No data
Right 1022282780 7:28927628-28927650 TTGTCACAGCTTGGGGGATGGGG No data
1022282773_1022282777 -7 Left 1022282773 7:28927606-28927628 CCTTGTCTGGAGAGATTTGTGTT No data
Right 1022282777 7:28927622-28927644 TTGTGTTTGTCACAGCTTGGGGG No data
1022282773_1022282779 -2 Left 1022282773 7:28927606-28927628 CCTTGTCTGGAGAGATTTGTGTT No data
Right 1022282779 7:28927627-28927649 TTTGTCACAGCTTGGGGGATGGG No data
1022282773_1022282774 -10 Left 1022282773 7:28927606-28927628 CCTTGTCTGGAGAGATTTGTGTT No data
Right 1022282774 7:28927619-28927641 GATTTGTGTTTGTCACAGCTTGG No data
1022282773_1022282775 -9 Left 1022282773 7:28927606-28927628 CCTTGTCTGGAGAGATTTGTGTT No data
Right 1022282775 7:28927620-28927642 ATTTGTGTTTGTCACAGCTTGGG No data
1022282773_1022282776 -8 Left 1022282773 7:28927606-28927628 CCTTGTCTGGAGAGATTTGTGTT No data
Right 1022282776 7:28927621-28927643 TTTGTGTTTGTCACAGCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022282773 Original CRISPR AACACAAATCTCTCCAGACA AGG (reversed) Intergenic
No off target data available for this crispr