ID: 1022282776

View in Genome Browser
Species Human (GRCh38)
Location 7:28927621-28927643
Sequence TTTGTGTTTGTCACAGCTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022282769_1022282776 11 Left 1022282769 7:28927587-28927609 CCTCCCAAGGAACATTTGGCCTT No data
Right 1022282776 7:28927621-28927643 TTTGTGTTTGTCACAGCTTGGGG No data
1022282773_1022282776 -8 Left 1022282773 7:28927606-28927628 CCTTGTCTGGAGAGATTTGTGTT No data
Right 1022282776 7:28927621-28927643 TTTGTGTTTGTCACAGCTTGGGG No data
1022282771_1022282776 7 Left 1022282771 7:28927591-28927613 CCAAGGAACATTTGGCCTTGTCT No data
Right 1022282776 7:28927621-28927643 TTTGTGTTTGTCACAGCTTGGGG No data
1022282770_1022282776 8 Left 1022282770 7:28927590-28927612 CCCAAGGAACATTTGGCCTTGTC No data
Right 1022282776 7:28927621-28927643 TTTGTGTTTGTCACAGCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022282776 Original CRISPR TTTGTGTTTGTCACAGCTTG GGG Intergenic
No off target data available for this crispr