ID: 1022282778

View in Genome Browser
Species Human (GRCh38)
Location 7:28927626-28927648
Sequence GTTTGTCACAGCTTGGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 465
Summary {0: 2, 1: 1, 2: 16, 3: 71, 4: 375}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022282771_1022282778 12 Left 1022282771 7:28927591-28927613 CCAAGGAACATTTGGCCTTGTCT No data
Right 1022282778 7:28927626-28927648 GTTTGTCACAGCTTGGGGGATGG 0: 2
1: 1
2: 16
3: 71
4: 375
1022282770_1022282778 13 Left 1022282770 7:28927590-28927612 CCCAAGGAACATTTGGCCTTGTC No data
Right 1022282778 7:28927626-28927648 GTTTGTCACAGCTTGGGGGATGG 0: 2
1: 1
2: 16
3: 71
4: 375
1022282769_1022282778 16 Left 1022282769 7:28927587-28927609 CCTCCCAAGGAACATTTGGCCTT No data
Right 1022282778 7:28927626-28927648 GTTTGTCACAGCTTGGGGGATGG 0: 2
1: 1
2: 16
3: 71
4: 375
1022282773_1022282778 -3 Left 1022282773 7:28927606-28927628 CCTTGTCTGGAGAGATTTGTGTT No data
Right 1022282778 7:28927626-28927648 GTTTGTCACAGCTTGGGGGATGG 0: 2
1: 1
2: 16
3: 71
4: 375

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022282778 Original CRISPR GTTTGTCACAGCTTGGGGGA TGG Intergenic
900121166 1:1049236-1049258 GTTTGACACAGGTTCGGGGCCGG + Exonic
900793711 1:4695085-4695107 GGTTGTCACAACTTGGGAGAGGG + Intronic
901062166 1:6476690-6476712 TGTGGTCACAGCATGGGGGAGGG - Intronic
901407426 1:9058525-9058547 GGTTGTCGCAGCTGGGGAGAGGG - Intronic
901439929 1:9271737-9271759 GTGTGACACAGCTTGGAGGTAGG - Intergenic
901536540 1:9886056-9886078 TTTTGTTACAGTATGGGGGATGG + Intronic
902128965 1:14241907-14241929 GTTTGGCACACTTTGGGGGTGGG - Intergenic
902249579 1:15145349-15145371 GATTGTCACAGCTGGGGAAAGGG + Intergenic
902311260 1:15583568-15583590 GGTTGTTACACCTTGGAGGAAGG - Intronic
903736362 1:25532170-25532192 GTATGTCTCAGCATAGGGGAAGG + Intergenic
904210252 1:28882595-28882617 CTTTGCCACAGCGTGGGGCAGGG - Intergenic
904813234 1:33177653-33177675 GATTGTCACAACTTGCGGGGTGG + Intronic
904958140 1:34306146-34306168 GTATGTCAAGCCTTGGGGGATGG - Intergenic
905295008 1:36948744-36948766 GCTTGTCAATGCCTGGGGGAAGG + Intronic
905399598 1:37691967-37691989 GTTTGACAGAGCAAGGGGGACGG - Intronic
905519404 1:38586693-38586715 GGTTGTTACAACTTGCGGGAAGG - Intergenic
907502838 1:54895301-54895323 GGTTGTCACAACTCGGTGGAGGG - Intergenic
908160867 1:61407274-61407296 GTTTGGCAGAGGTTGGGGTAGGG + Intronic
908523101 1:64963937-64963959 GGTTGTTACAACTTGGGGGAAGG - Intronic
908772177 1:67607305-67607327 GGTTGTCATAGCTGGGGGGCAGG - Intergenic
909220042 1:72946393-72946415 GATTGTCACAACTTGGGGCAGGG - Intergenic
909356150 1:74712333-74712355 GGTTGTCACAACTTGGGGAAGGG - Intronic
910439512 1:87238308-87238330 GGTTGCCACAGCATGGGGGCAGG + Intergenic
910976900 1:92916093-92916115 GGTTGTCAGAGGCTGGGGGAGGG + Intronic
911167456 1:94736822-94736844 GGTTGTTACAACTAGGGGGAAGG - Intergenic
911365100 1:96928601-96928623 TTTTTTCACAGGTTGGGGGGCGG - Intergenic
912082699 1:105957041-105957063 GTTTGCCAGAAATTGGGGGAAGG - Intergenic
913335641 1:117707086-117707108 TTTTGTCACAATTTAGGGGACGG - Intergenic
914798040 1:150938358-150938380 GATTGCCAGAGTTTGGGGGAGGG + Intronic
914814872 1:151056038-151056060 GTTTCTCAAGGATTGGGGGAGGG - Intronic
914985948 1:152457296-152457318 GATTGCCACAGCATGGGGCAGGG - Intergenic
916466096 1:165075922-165075944 TATTGTCACAGCTTGTTGGAGGG + Intergenic
918076990 1:181178012-181178034 GATTGTCAGGGCTTGGAGGAGGG + Intergenic
919587015 1:199451434-199451456 GATTGTCAAAACTTGGGGGTGGG + Intergenic
921501457 1:215909271-215909293 GTTTGCCAGGGGTTGGGGGAGGG + Intronic
923637402 1:235713590-235713612 GATTCTCACAACTGGGGGGATGG + Intronic
923834195 1:237591569-237591591 GGTTCTCACAGTTTGGGGGATGG - Intronic
1063601195 10:7482866-7482888 GGTTGTCACAGCTCGGGGGAAGG + Intergenic
1064014381 10:11761269-11761291 GATTGTCACAGCTTGGTGGGGGG + Intronic
1064462266 10:15546518-15546540 GGTTGTCACACCTGGGGTGAGGG + Intronic
1065425216 10:25595709-25595731 GTTTGTCACAGGCTGGAGGAAGG + Intronic
1065517844 10:26542926-26542948 GATTGTCATAGCTTGGGGCATGG + Intronic
1067089217 10:43258105-43258127 GTGGCTCACAGCTTCGGGGAGGG + Intronic
1067159241 10:43809184-43809206 TTTTGTCACAGCTTAAGGGCAGG - Intergenic
1070118698 10:73554263-73554285 GTTTGTCACACCTTTGCAGAAGG - Intronic
1070687918 10:78503410-78503432 GATTGTCACAACTAGGGAGAGGG + Intergenic
1071471188 10:85985076-85985098 GGTTGTTACAGCTGGGGGGTTGG - Intronic
1072240284 10:93489521-93489543 GATTGTCACCACTTGGGGCAAGG - Intergenic
1072814616 10:98492986-98493008 GGTTGCCAGAGATTGGGGGAGGG - Intronic
1072894110 10:99350944-99350966 GGTTGTCACAACTTGGGGCAGGG - Intronic
1074466254 10:113683504-113683526 GGTTGTCAGAGGTTGGGGGTGGG - Intronic
1075408025 10:122207486-122207508 GGTTGTCACAGCTGGGGTAAGGG + Intronic
1075732988 10:124647369-124647391 GATTGTCGCAGCTTGGGGAGTGG - Intronic
1076107646 10:127835911-127835933 GCTTGTCACAGCTGGGGGCAGGG + Intergenic
1076992928 11:284947-284969 GTTTGTCAGAGGCTGGGGGAGGG - Intronic
1077321139 11:1942595-1942617 GTCTATCACAGCTCTGGGGAGGG + Intergenic
1077369929 11:2177103-2177125 GGTTCTTCCAGCTTGGGGGATGG - Intergenic
1078689279 11:13562683-13562705 GTTTGTCTCATGTTGGAGGAGGG - Intergenic
1078692629 11:13597364-13597386 GTTTGTCTCATGTTGGAGGAGGG + Intergenic
1078882161 11:15462874-15462896 GTTTGGCAAAGAGTGGGGGAAGG + Intergenic
1082866102 11:57901564-57901586 GGTTGCCACAGCTGGTGGGAGGG + Intergenic
1083032853 11:59610140-59610162 GGTTGTCACAGCTGAAGGGAGGG - Intronic
1084433529 11:69124364-69124386 GGTTTTCACTGCATGGGGGAGGG - Intergenic
1084570579 11:69957198-69957220 GTTTGTCAGAGGCAGGGGGAGGG - Intergenic
1085391299 11:76183642-76183664 CTTTGTCACAGATGTGGGGACGG + Intergenic
1087220323 11:95540061-95540083 GTTTAGGAGAGCTTGGGGGAGGG - Intergenic
1087609569 11:100417782-100417804 GGTTGTTACAGTTTGGGAGAGGG - Intergenic
1087646783 11:100817248-100817270 GGTTGTCACAACTAGGGAGAAGG - Intronic
1088326812 11:108609180-108609202 GATTGTCACAGCTCCAGGGATGG + Intergenic
1088468583 11:110169311-110169333 GTTTGTGACAGGTGGGAGGATGG + Exonic
1089831631 11:121334022-121334044 GTCTGTTTCAGCTTGTGGGAAGG - Intergenic
1090768164 11:129895315-129895337 GTTAGGCACGGCGTGGGGGAGGG - Intronic
1092217394 12:6693008-6693030 GTGGGGCACAGATTGGGGGAGGG + Intergenic
1092566014 12:9666063-9666085 GTTTGTGACAGCATGATGGATGG - Intronic
1095173802 12:39066748-39066770 GTTAGTAAAAGCTTGTGGGATGG - Intergenic
1098260164 12:68661644-68661666 GGTTGCCACAACTTGGGGGCTGG - Exonic
1099105794 12:78494826-78494848 GTTTGTGAAATTTTGGGGGAGGG + Intergenic
1101925456 12:108967763-108967785 GATTGTCACACGTTGGGGGAGGG - Intronic
1102021531 12:109686731-109686753 CTTTGCCACAGCAAGGGGGATGG + Intergenic
1102082350 12:110108574-110108596 GGTTGTCACAACTAGGGGGAGGG + Intergenic
1102528010 12:113525674-113525696 GATTGTCACAGCTAGGAGGTGGG - Intergenic
1102900554 12:116633289-116633311 GGTTGTCACAGCTTGGGTGGGGG - Intergenic
1103043398 12:117714758-117714780 GGGTGTCACAACTTGGGGGCAGG + Intronic
1103064956 12:117889789-117889811 GGTTGTCACAACTTGGAAGATGG + Intronic
1103065898 12:117897176-117897198 ATCTGTCACAGCTTGGGAGCTGG - Intronic
1103364830 12:120374301-120374323 GGTTGTCAGGGGTTGGGGGAGGG - Intergenic
1103847979 12:123912566-123912588 GGATGTCACAGCTTGGAGGGAGG - Intronic
1106031791 13:26011213-26011235 GTTTGTCACAGTCTGGAGGCTGG + Intronic
1106382695 13:29255693-29255715 GTTGATCACAGCCTGGGGGGTGG + Intronic
1107041061 13:35948022-35948044 GTTTGGCAGAGCTTGGGTGGTGG - Intronic
1110291656 13:73814741-73814763 GATTGTCACAACTTGGGGCGGGG + Intronic
1112514369 13:100039247-100039269 GGTTGTCACAACTTGGAGGTAGG + Intergenic
1113977760 13:114242854-114242876 GTTTGTCACAGCTTAGGGGCAGG + Intronic
1114181693 14:20373392-20373414 GTTTGGCACACCTAGGAGGAAGG + Exonic
1114272376 14:21109413-21109435 GGTTGTCACAACTGGAGGGAGGG - Intergenic
1115408350 14:33045024-33045046 CTTTGACACAGCTTGAGGGAAGG + Intronic
1116495625 14:45556398-45556420 GTATGTCTCATCTTGGGGAAAGG - Intergenic
1116560319 14:46370351-46370373 GATTGTCATAACTTGGGGGAAGG + Intergenic
1117602335 14:57389241-57389263 CTTTGTCACAGCCTGGTGGCTGG - Intergenic
1117928013 14:60805571-60805593 GTTTGTCAGGGGTTGGGGTAGGG - Intronic
1118769175 14:68930136-68930158 GTCTGTCTGAGCTTGGGGGCAGG - Intronic
1118769533 14:68932853-68932875 GCTTGTCATAGCTTGGGGTTGGG - Intronic
1119224308 14:72933146-72933168 GTTTGTCACAGCTCGGGAGAAGG - Intronic
1119346916 14:73933265-73933287 GGTTGTCACAGCTGGGGAGAGGG + Exonic
1119677844 14:76569238-76569260 GATTGTCACAACTTAGGGGAAGG + Intergenic
1120061087 14:79983524-79983546 GTTTGTCACTGCTTCTAGGAAGG - Intergenic
1121233638 14:92376813-92376835 GGTTGTCACAACCTGGGGCAAGG + Intronic
1121827097 14:97019204-97019226 GTTGGTGACGTCTTGGGGGAAGG + Intergenic
1122082086 14:99273407-99273429 GTTGGCCACAGCCTGGGGAATGG - Intergenic
1123038283 14:105480164-105480186 GATTGTCTCTGCTTGTGGGATGG + Intronic
1126468825 15:48985335-48985357 ATTTCTCACTACTTGGGGGAGGG + Intergenic
1127776633 15:62269303-62269325 GTTGCTCACAGGTTGGGGCAGGG + Intergenic
1129918517 15:79296762-79296784 GGTTGTCACAACTGGGGAGAGGG - Exonic
1130759494 15:86803807-86803829 GGTTGTCACAACTTGGGGCAGGG + Intronic
1130919995 15:88335787-88335809 GGTTGTCACAACTGGGTGGAGGG + Intergenic
1131153562 15:90061740-90061762 TGCTGTCACAGCTTGGGGAAGGG + Intronic
1131687384 15:94784328-94784350 TTTTATCACAGCTTTGGGGTAGG + Intergenic
1131775596 15:95794629-95794651 GTTTCTGCCAGCTTGGGGGATGG - Intergenic
1132220500 15:100101618-100101640 GTGTGTCAGAGGATGGGGGAAGG - Intronic
1132410574 15:101575493-101575515 GTTAGTGGCAGCTTGGGGGGTGG - Intergenic
1133447088 16:5870872-5870894 GTTTGTCTCTACTTGGGGGTGGG - Intergenic
1133984633 16:10659112-10659134 GGTTGTCACAGCTTGCGGGGTGG - Intronic
1134052165 16:11144854-11144876 GCTTGTCATGCCTTGGGGGACGG + Intronic
1134200929 16:12198152-12198174 GATTGTCAAAGCATGGAGGAAGG + Intronic
1134628821 16:15742033-15742055 GATTGTCACAGCTGGGGTGGGGG + Intronic
1134634290 16:15780258-15780280 GCTTGTCACATGTTGGGGGGGGG + Intronic
1134635135 16:15786206-15786228 GGTTGTCACAACTGGAGGGAAGG + Intronic
1135028100 16:19014286-19014308 GATTGTCACAACTTGGGGGAGGG - Intronic
1135070019 16:19343696-19343718 GGTTGTCACAACTTGATGGAGGG + Intergenic
1135911809 16:26568022-26568044 GGTTGTCACAACTTGGGAGTGGG + Intergenic
1137346361 16:47665708-47665730 TTTTGTCACAGCTTGGTGGCAGG + Intronic
1138421745 16:56903468-56903490 GTTTGTCACAACTCGGGGGTGGG + Intronic
1139413108 16:66781983-66782005 GATTCTCACACCTTGGGGGTAGG - Intronic
1140676100 16:77331649-77331671 GGTTGTCACAGTTTGGTGGGTGG + Intronic
1140823933 16:78688666-78688688 AATTGTCACAACTTGGGGAAGGG + Intronic
1141440001 16:84024104-84024126 GGTTGTCACAACTTGGGGGAGGG - Intronic
1141484855 16:84331979-84332001 GGTGGTCCCAGCTTGGGGGAGGG - Intergenic
1141743025 16:85906798-85906820 GGTTGTCACAGCTAGGGGAGGGG + Intronic
1142383549 16:89747857-89747879 GTTGGTCAGAGCTGGGGAGACGG - Intronic
1143416902 17:6756925-6756947 GCTTGTGGCAGCTTGGGAGAAGG - Intronic
1143946066 17:10593522-10593544 GATTGTCACATCTCAGGGGAAGG - Intergenic
1145179079 17:20729215-20729237 GATTGTCACAGCTTGGGGGAGGG + Intergenic
1145414541 17:22703931-22703953 ATCTGTCACAGCCTGTGGGAGGG - Intergenic
1145785708 17:27592601-27592623 CTTTGTCAGTGCTTTGGGGAGGG - Exonic
1146443117 17:32914382-32914404 GGTTGCCAGAGGTTGGGGGAGGG - Intergenic
1146816339 17:35944976-35944998 GTTTGCCACAGCTAGGGGGCTGG - Intergenic
1146852643 17:36236556-36236578 CACTGTCACAGCTTGGGAGAGGG - Intronic
1146868553 17:36360431-36360453 GATTGTCACAGCTTGGGAGAGGG - Intronic
1147071428 17:37961055-37961077 GATTGTCACAGCTTGGGAGAGGG - Intergenic
1147082955 17:38040581-38040603 GATTGTCACAGCTTGGGAGAGGG - Intronic
1147098898 17:38164552-38164574 GATTGTCACAGCTTGGGAGAGGG - Intergenic
1147127625 17:38383003-38383025 GATTGTCACAGCTTGGGGTGGGG - Intronic
1147741737 17:42674117-42674139 GGTTCCCACAGCCTGGGGGAGGG - Intronic
1148360592 17:47009441-47009463 GTTTGTCATAGCTGGGGAGCTGG + Intronic
1148495760 17:48052739-48052761 GGTTGTCACATCTTGGGGCGGGG + Intronic
1149013032 17:51877149-51877171 GGTTGCTAAAGCTTGGGGGAGGG - Intronic
1149838741 17:59938828-59938850 GATTGTCACAGGTTGGGGGAGGG + Intronic
1150080431 17:62233592-62233614 GATTGTCACAGGTTGGGGGAGGG - Intergenic
1151103447 17:71583389-71583411 CATTGTCACAGAGTGGGGGAGGG + Intergenic
1151233608 17:72702397-72702419 GGTTGTCACAACTAGGGGGAAGG + Intronic
1151661008 17:75517907-75517929 GCTTGTCGCAGGTTGGGGGTGGG + Intronic
1151997364 17:77618412-77618434 GGTTGTCAGAGCTGGGGAGAGGG - Intergenic
1152079352 17:78176853-78176875 TTTTGTCGCAGCTGGGGGGTGGG - Intronic
1152294047 17:79456427-79456449 GGTTGTCACAGCTGGGGAGGGGG - Intronic
1153284400 18:3444981-3445003 GTTTGTCACAGCTTGGGGGAAGG + Intronic
1155234918 18:23809696-23809718 CATGGTAACAGCTTGGGGGAGGG + Intronic
1156536015 18:37865346-37865368 AGTTGTCATAACTTGGGGGAAGG - Intergenic
1156633397 18:38996653-38996675 GAAGGTCACAGCTTGGGGCAAGG - Intergenic
1158328558 18:56336755-56336777 GTTTGTCACAATTTGGGGGAAGG - Intergenic
1158501413 18:58005488-58005510 GGTTGTCACAACTTGGGGGAGGG + Intergenic
1159362420 18:67422762-67422784 GGTTGCCAGAGGTTGGGGGAGGG - Intergenic
1160800201 19:964132-964154 GGTTGTCACAGCCTGGGCGGGGG + Intronic
1160947102 19:1648774-1648796 GGTTGAAACAGGTTGGGGGAGGG - Intronic
1161048561 19:2150398-2150420 CTAGGTCACAGGTTGGGGGAAGG + Intronic
1161113460 19:2483144-2483166 GGTTGTCAGGGGTTGGGGGAGGG - Intergenic
1161366628 19:3883633-3883655 TTTTGTCACAACTGAGGGGAAGG - Intronic
1161744611 19:6048063-6048085 GATTGCCACAGCTTGGGGAGGGG - Intronic
1161751397 19:6099891-6099913 GGTTGTCACCACTTGGGGAAAGG + Intronic
1162834215 19:13305643-13305665 GGTTGTCACAGCTAGGGAGAGGG - Intronic
1163470197 19:17492120-17492142 AATTGTCACAACTTGGGGGAAGG - Intronic
1165044583 19:33094686-33094708 AACTGTGACAGCTTGGGGGAGGG - Intronic
1166039532 19:40193221-40193243 GGTTGTCATAGCTGGGGAGAGGG - Intronic
1166555284 19:43695477-43695499 GGTTGCCAGAGGTTGGGGGACGG + Intergenic
1167950332 19:53021418-53021440 GTGTGTCACTGCTTGTGAGATGG - Intergenic
1168260838 19:55193554-55193576 GGTTGTCACAGCTTGGAAGTGGG + Intronic
1168318133 19:55493182-55493204 GGTTGTCGCAGCTAGGGGGAGGG + Intronic
1168343436 19:55639180-55639202 GGTTGTCACAACTTGGGGTTGGG + Intronic
1168664376 19:58192290-58192312 GTATGTCACAGATTGGAGGCAGG + Intronic
924959926 2:25482-25504 GGTTGTCAGAGGTTGGAGGAGGG - Intergenic
925378580 2:3407134-3407156 GGATGTCACAGCCTGGGAGAAGG + Intronic
926900158 2:17742078-17742100 GGTTGTCACAACTTAGGGGCAGG - Intronic
927234179 2:20855314-20855336 GGGTGTCACAGGTCGGGGGAGGG + Intergenic
927317914 2:21707153-21707175 GGTTGTCACAGCTGGGGACAGGG + Intergenic
927473137 2:23391199-23391221 GTTTATCACATCTTGTGGCATGG + Intronic
928621183 2:33089438-33089460 AGTTGTCATGGCTTGGGGGAGGG + Intronic
929156246 2:38791170-38791192 GGTTTTCACAGCTTGTGGGGTGG - Intergenic
929210353 2:39350031-39350053 GGTTGTCACAACTAGGGGAAAGG + Intronic
929587585 2:43126145-43126167 GATTGTCACAACTTGGGGAGGGG - Intergenic
930570333 2:53077920-53077942 GCTTGTCAGGGGTTGGGGGACGG - Intergenic
931234837 2:60404351-60404373 GGTTGTCACAACTCGGGGGAGGG + Intergenic
931242584 2:60466474-60466496 CTTAGGCCCAGCTTGGGGGAAGG + Intronic
931703182 2:64925196-64925218 GGTTCTCACATCTTGGGTGAGGG + Intergenic
933025680 2:77255336-77255358 GTTTATCACTGCTTGAGAGATGG - Intronic
933791905 2:85889544-85889566 TTTTGTAACAGCTTGGCGCAGGG + Intergenic
935282228 2:101528080-101528102 GTTTGACACAGCTGGGTGGGTGG - Intergenic
936393899 2:112103634-112103656 GCTTGTCACAGGTTAGAGGAGGG + Intronic
937348587 2:121143998-121144020 GGTTGTCACAGCTGGGTGGAGGG - Intergenic
940196064 2:151095206-151095228 GTTTTTCATAGATTAGGGGAAGG + Intergenic
940238368 2:151535515-151535537 GTTTGGCAGAGCTTGTTGGATGG + Intronic
941506266 2:166349189-166349211 GATGGTCACAGCTTGGGGGAGGG - Intronic
941975356 2:171398485-171398507 GTTTGGCAGAGGTTGGGGAAGGG + Intronic
942201995 2:173580557-173580579 GGTTGCCAGAGCCTGGGGGAGGG - Intergenic
942600561 2:177636773-177636795 GGTGGTCACAACTTTGGGGAGGG - Intronic
943088898 2:183350711-183350733 CTCTGCCACAGCCTGGGGGAGGG - Intergenic
943576176 2:189633549-189633571 GGTTGTTACAACTTGGAGGATGG + Intergenic
944356039 2:198788998-198789020 GGTTGTCACAACTGGGGGAATGG + Intergenic
944405220 2:199376470-199376492 GGTTGTCACAACTGGGGGAAGGG + Intronic
944983586 2:205149855-205149877 AATTGTCACAGCTTGGGGAAGGG + Intronic
945201016 2:207281599-207281621 GGATGTCACAACTTGGGGAAAGG - Intergenic
945259896 2:207833674-207833696 GGTTGTCACAACTGGGAGGAGGG - Intronic
945319898 2:208409009-208409031 GGTTGTCTCAGTTAGGGGGAGGG - Intronic
945755451 2:213840396-213840418 GTTTGTCTGAGATTGTGGGAGGG - Intronic
947868398 2:233417820-233417842 GTTTGTCACAGTTGTGGGTATGG + Intronic
948334133 2:237194367-237194389 GGTTGTCCCAGCTTGGGCCAGGG - Intergenic
948762174 2:240199057-240199079 GGTTGCCACACCTTGGAGGAGGG + Intergenic
1171426903 20:25054592-25054614 GCTTGTCACAGCATGGTGGCTGG - Intronic
1172335950 20:34115556-34115578 GGTTGTCACAACTAGGGGGAGGG - Intergenic
1172411667 20:34728466-34728488 GATTGTCACAACTTGGGGAGAGG + Intronic
1173204431 20:40981511-40981533 GTTTTCCACAGATTGGGGTAAGG - Intergenic
1173563827 20:44025354-44025376 GTTGGCCAGAGATTGGGGGATGG + Intronic
1173591363 20:44227597-44227619 GGCTGTCACAACTTGGGGGATGG + Intergenic
1173764250 20:45592750-45592772 AATTGTCACAACTTGGGGGTTGG - Intergenic
1173924707 20:46771966-46771988 GTTTGTCACAGCTGGGAAGGAGG + Intergenic
1174172996 20:48628603-48628625 GGTTGTCACAACTTAGGGGAGGG - Intronic
1174212637 20:48892054-48892076 AGTTGTCACAACTTGGGGGGAGG - Intergenic
1174238897 20:49117103-49117125 GTACGTCACACCTTGGGTGAGGG - Intronic
1174411989 20:50342325-50342347 GGTTGTCACAGCTGGGTGGAGGG + Intergenic
1174565026 20:51458341-51458363 GGTTGTCACAGCTGGGGGGTAGG - Intronic
1174756932 20:53168272-53168294 GTCTGTCACAGCCTGGGGTGAGG - Intronic
1175019137 20:55825903-55825925 GGTGGTCACAGATTGGGGGCGGG + Intergenic
1175197270 20:57252903-57252925 GGTTGTCAGATCCTGGGGGAAGG + Intronic
1175263360 20:57688436-57688458 GGTTGTCACAACCTGGGGCATGG - Intronic
1175282198 20:57811430-57811452 GTTTGGAACTGCTGGGGGGAGGG - Intergenic
1175324857 20:58116522-58116544 GCTTATCCCAGCTTGGGGAAGGG + Intergenic
1175721861 20:61292516-61292538 GGTTGTCACAGCTTGGGGAGGGG + Intronic
1175815966 20:61883404-61883426 GGTTGTCACAGCTCGGTGGGGGG + Intronic
1176661025 21:9635006-9635028 GTTTGTCACCGCTAGGGGAGGGG - Intergenic
1177301031 21:19245652-19245674 CATTGTCACAGCTTTGGGGTAGG - Intergenic
1178244581 21:30938168-30938190 GGTTGTCATAACTTGGGGGGAGG + Intergenic
1178277005 21:31247989-31248011 GGTTGTCACAACTTGGGGGAAGG + Intronic
1178299363 21:31439102-31439124 GTCTGCCACAGGTTGGGGAAGGG + Intronic
1179326038 21:40346936-40346958 GGTTGTAACAACTTGGAGGAAGG + Intronic
1180878219 22:19185231-19185253 GGTTGTCACAGCTTAGGGCGTGG - Intronic
1181661888 22:24357011-24357033 GGTTGTCACAACTGGGGGAATGG + Intronic
1182227334 22:28809145-28809167 GGTTGTCACAACTTGGAGGAGGG - Intergenic
1182335288 22:29580059-29580081 CCTTTTCACAGGTTGGGGGAGGG + Intronic
1182423215 22:30258380-30258402 CTTTGTCACAGCTGGGAGGTGGG + Intergenic
1182756274 22:32682163-32682185 GGTTGTCACAACTTGGGAGTGGG + Intronic
1182805931 22:33070401-33070423 GGTTCTCACAGCTTGTGGGGTGG + Intergenic
1183020505 22:35022654-35022676 GCTTGTCACAACTGGGTGGAGGG - Intergenic
1183318350 22:37149093-37149115 GTTTGTAGCACCTCGGGGGAGGG - Intronic
1183396738 22:37575978-37576000 GGTTGTCACCGCTCAGGGGAGGG - Intronic
1183797862 22:40135121-40135143 GTTTCTCACAGCATGGTGGCAGG + Intronic
1184746591 22:46459684-46459706 GGTTGTCACAGCTGGGGGTGGGG - Intronic
1185004340 22:48266924-48266946 GTTTGTGCCACCTTGGGAGATGG + Intergenic
1185039955 22:48498736-48498758 GGTTGTCACAACTGGGAGGAGGG - Intronic
1185382204 22:50514754-50514776 GTTTGTCAGATCTGGGAGGAAGG - Intronic
949481510 3:4498399-4498421 GTTTGTGACATGTTGGAGGAAGG + Intronic
949754874 3:7397790-7397812 CATTGTCACAACTTGGGGGCTGG + Intronic
950685882 3:14618366-14618388 GTTTGTGAGAGGTAGGGGGAAGG + Intergenic
950915883 3:16644842-16644864 GCTTGTCACAACTTGGGTGTAGG - Intronic
951466572 3:23006371-23006393 GGTTGTCACAACTTGGGGAGAGG + Intergenic
951921667 3:27861408-27861430 GTTTGTCAGAGCTAGGGAGGAGG + Intergenic
952161173 3:30694893-30694915 GGTTGTCACAGCTGTGGGGTGGG - Intergenic
952182823 3:30936382-30936404 CTTTGACACTGCTTGCGGGAAGG - Intergenic
953016319 3:39080204-39080226 GGTTGCCACACCTAGGGGGAGGG - Intronic
953243918 3:41173893-41173915 GGTTGTCATAACTTAGGGGAGGG + Intergenic
953661538 3:44894646-44894668 TGTTGTCAAATCTTGGGGGAGGG - Intronic
955156649 3:56423432-56423454 GACTGTTACAACTTGGGGGATGG - Intronic
955685553 3:61545158-61545180 GGTTGTCACATCTTAGGGGAGGG + Intergenic
955872033 3:63449517-63449539 GGTTGTCACAACCTGGGGGTTGG - Intronic
955993633 3:64655351-64655373 GGTTGTCACACCTGAGGGGAGGG + Intronic
956314315 3:67917004-67917026 GATTGTCACAACTTGGGAGGAGG - Intergenic
958819847 3:98960808-98960830 AGTTGTCACAGCTCAGGGGAGGG + Intergenic
958963776 3:100536067-100536089 GGTTGTCACATCTAGGGGGAAGG + Intronic
959235385 3:103715309-103715331 GGTTATAAAAGCTTGGGGGATGG - Intergenic
960510919 3:118547934-118547956 GGTTGTCACAATTTGGGGGAAGG - Intergenic
960700242 3:120432335-120432357 GGATGTCACAGCTGGGGGGAAGG + Intronic
961039188 3:123664951-123664973 GGTTGTCAGGGCCTGGGGGAAGG + Intronic
961118130 3:124349300-124349322 GGTTGTCAGAGGCTGGGGGAAGG + Intronic
961721832 3:128902443-128902465 CTTTCTCCCAGCTTGAGGGAAGG + Intronic
963846073 3:150159414-150159436 TTATGTCACAGCTTTGGGAAAGG + Intergenic
964501383 3:157351909-157351931 CATTGTCACAGCTTGGGAGTGGG - Intronic
964800507 3:160551927-160551949 GGTTGTCACAACTGGGGGGGGGG + Intronic
965564341 3:170096487-170096509 GGTTGTCACAGCTTGGGGGTGGG - Exonic
965688422 3:171329970-171329992 GGTTGTCACAGATGGGGGAAAGG + Intronic
966300046 3:178468766-178468788 GATTGTCAGGGGTTGGGGGAGGG + Intronic
967440260 3:189499636-189499658 GGTTGTCAGAGACTGGGGGATGG + Intergenic
967935962 3:194727854-194727876 GCTTGTGACTACTTGGGGGATGG + Intergenic
968040465 3:195584694-195584716 GTCTGTCACTGCTTGGGGGTGGG + Intergenic
968589751 4:1451443-1451465 GTTTGGCACTGCTTGGGGTCAGG + Intergenic
969625320 4:8301940-8301962 GATTGGAGCAGCTTGGGGGATGG + Intronic
970376350 4:15461117-15461139 GGTTGTCACAACTTGGTGGGGGG - Intergenic
970709517 4:18845454-18845476 GGTTGTCACAACTTAGGGGAGGG + Intergenic
971214662 4:24651904-24651926 GATTGTCACAACTTGGGGAAAGG + Intergenic
971809309 4:31403203-31403225 CATTGTCACAGCTTGGAGGAGGG + Intergenic
971847348 4:31936631-31936653 CTTTTACACTGCTTGGGGGATGG - Intergenic
972117633 4:35657170-35657192 GCTTGTCACAGTTTGGGGAAAGG + Intergenic
973288603 4:48447197-48447219 GATTGCCAGAGCTGGGGGGAGGG - Intergenic
973748352 4:53986631-53986653 CTTTGTGAAAGCTTGTGGGAAGG - Intronic
973907260 4:55545261-55545283 GGTTTTCAAAGCTTGGGGGAAGG - Intronic
973964540 4:56148123-56148145 TTTTCTCACAGTTTGGGAGATGG - Intergenic
975430152 4:74280333-74280355 GTTTCTCACAGCTTGGCAGCTGG - Intronic
975649170 4:76574804-76574826 AGTTGCCACAGGTTGGGGGAGGG + Intronic
975758215 4:77592409-77592431 GGTTGTCAGGGGTTGGGGGAAGG + Intronic
976625450 4:87176345-87176367 GGTTGTCACAGCTTGGGGATGGG - Intronic
978234035 4:106436140-106436162 TTTTGTCACAGGATGGGGCAGGG + Intergenic
978727918 4:111991919-111991941 TGTTGTAACAGATTGGGGGAAGG + Intergenic
979161106 4:117462553-117462575 GTTTGCAAGAGCTTTGGGGATGG - Intergenic
979809429 4:125017127-125017149 GTGTGTGACAGCTTCTGGGAGGG + Intergenic
980042706 4:127957226-127957248 GTTTGCTAGGGCTTGGGGGATGG + Intronic
980467139 4:133201403-133201425 TATTCTCACAGCCTGGGGGAAGG + Intronic
981799138 4:148635767-148635789 GGTTGTCACAACCTGTGGGAGGG - Intergenic
982011893 4:151113587-151113609 ATTTGTCACAACTAGAGGGAAGG - Intronic
983641395 4:169946867-169946889 GTTTCTCACAGCATGGTGGTGGG + Intergenic
983657330 4:170096629-170096651 GTCAGTCAAAGCTTGAGGGATGG + Intergenic
983715405 4:170776221-170776243 CCTTGGCACAGCTTGGGGGATGG + Intergenic
984357007 4:178674059-178674081 GGTTGTCACAACCTGGAGGATGG - Intergenic
985105911 4:186500053-186500075 GGTTTTCACAGCTCAGGGGAGGG - Intronic
985414373 4:189721530-189721552 GTTTGTCACCGCTAGGGGAGGGG + Intergenic
986021794 5:3811589-3811611 GGTTGTCAGGGGTTGGGGGAAGG + Intergenic
986420508 5:7576269-7576291 GTTTATGACTCCTTGGGGGAGGG + Intronic
989513577 5:42316489-42316511 GGTTGTCACAACTTGGAGGAGGG + Intergenic
990206606 5:53436281-53436303 GATTGTAACAACTTGGGAGAAGG + Intergenic
990680238 5:58234685-58234707 GATTGTCACAACTTGGGGAGGGG + Intergenic
990815175 5:59776603-59776625 CTGAGTCACAGCTTGGGAGATGG + Intronic
991994676 5:72375507-72375529 GATATTCACAGCTTGGGTGATGG + Intergenic
992095055 5:73355302-73355324 GGTTGTCAGAGTCTGGGGGAGGG - Intergenic
992157508 5:73969582-73969604 GTTGCTCACTGCTTGGGAGATGG - Intergenic
995744367 5:115388423-115388445 GGTTGTCACAGCTGGGGGTGGGG - Intergenic
996038847 5:118788201-118788223 GTTTGTCATAACTTGGGGAGGGG - Intergenic
996135514 5:119837247-119837269 TTTTGTCACAACTTGGGTGGAGG - Intergenic
997356118 5:133264068-133264090 GGTTGTCACAACTTGGGGAGGGG + Intronic
998859226 5:146426441-146426463 GGTTATTACAGCTTGGGGGGTGG + Intergenic
999821452 5:155233023-155233045 GGTTGTCACAACTTAGGGAAGGG + Intergenic
999840652 5:155422289-155422311 GGTTGTCACAGCTGAGGTGAGGG - Intergenic
1001366554 5:171147079-171147101 GGTTGTCACAATTTGGGAGAGGG + Intronic
1001549094 5:172589091-172589113 GATTGTCACAACTTGAGGGGCGG + Intergenic
1001604393 5:172949639-172949661 GGTTGTCACAGCGTGGCGGGGGG + Intronic
1001632532 5:173186723-173186745 GGTTGTCAGGGCCTGGGGGAAGG - Intergenic
1001744058 5:174076757-174076779 GGTTGTCACAGCTGGGGGTAGGG + Intronic
1002417159 5:179126587-179126609 GGTTGTCACAACTGGGGGAAGGG + Intronic
1002424709 5:179168210-179168232 GGTTGTCACGACTAGGGGGAGGG - Intronic
1002878204 6:1229584-1229606 GGTTGTCACAACTTGGGGAGAGG - Intergenic
1003073939 6:2967061-2967083 GTGTGTCACAGCCTGGAGAAAGG - Intronic
1003196800 6:3921753-3921775 GGTTCCCACAGCTTGGGTGAGGG + Intergenic
1003370163 6:5517090-5517112 GTTTCGCACAGTTTGGGAGATGG + Intronic
1003564126 6:7208203-7208225 TTTGGCCACAGCTTGAGGGAAGG + Intronic
1003889222 6:10549070-10549092 GGTTGTCAGAGGTTGAGGGAGGG + Intronic
1004201687 6:13554652-13554674 GGTTGTTACAGCTTGGGGTGGGG + Intergenic
1005425157 6:25695130-25695152 ATTTTTCAGAGCTTGGGGAATGG - Intronic
1005888664 6:30117815-30117837 GTTTGTCACAACTGGGGGATAGG - Intergenic
1006378930 6:33686800-33686822 GTTTGCCACAGCGGGGGTGAAGG + Intronic
1007508231 6:42354152-42354174 TTGTGTCAGTGCTTGGGGGAAGG + Intronic
1008342882 6:50388933-50388955 GTTTATTACAGATTGGAGGAAGG - Intergenic
1008501985 6:52192174-52192196 GTTGGTCACTGATTGGAGGAGGG - Intergenic
1008574326 6:52845347-52845369 GGTTGTCACATCTGCGGGGAGGG + Intronic
1008693968 6:54012509-54012531 GGTGGTCACAGCATTGGGGAGGG - Intronic
1010662145 6:78583775-78583797 GTCTGTTAAAGCTTGGGGGTGGG - Intergenic
1011203288 6:84862249-84862271 GGTTGGCACAACTTGGGTGATGG - Intergenic
1013158541 6:107519232-107519254 GATTGTCACAGCTAGGAGAAGGG + Intronic
1013158741 6:107521058-107521080 GATTGTCACAGCTAGGAGAAGGG - Intronic
1013444940 6:110215574-110215596 GATTGTCAGAGTATGGGGGATGG + Intronic
1013513705 6:110866705-110866727 GTTTTTCAGAGGGTGGGGGAAGG + Intronic
1015365840 6:132397073-132397095 CTTTGTCACAGCATGGTGGCAGG - Intronic
1016491438 6:144608567-144608589 CACTGTCCCAGCTTGGGGGAGGG - Intronic
1019591898 7:1839805-1839827 GCTTCTCACAGCTTGGGAGGTGG + Intronic
1020021520 7:4872252-4872274 GGTTGTTACAACTTGGGGGTGGG + Intronic
1020390590 7:7653821-7653843 GGTTGTCACAGCTGGGGGATAGG + Intronic
1020827408 7:13047282-13047304 CTTTGTCACGACTTGGGGGTAGG - Intergenic
1021409622 7:20315440-20315462 GGTTGTCACAACTGGGGGGAAGG + Intergenic
1022282778 7:28927626-28927648 GTTTGTCACAGCTTGGGGGATGG + Intergenic
1022690626 7:32648919-32648941 GTGTGTCCCAGGTTGGGGGAGGG - Intergenic
1022769974 7:33459343-33459365 GATTGTAACAGCTGGGGAGAAGG + Intronic
1022918183 7:34982761-34982783 GTGTGTCCCAGGTTGGGGGAGGG - Intronic
1023058281 7:36306939-36306961 GGTTGTCACAGCTGGGGTGATGG + Intergenic
1023064149 7:36359235-36359257 GGTTGTCACAACTGGGGAGAGGG + Intronic
1023575988 7:41627491-41627513 GGTTGCCACAACTAGGGGGAGGG - Intergenic
1025031596 7:55561350-55561372 GTTTGGCACAGTGAGGGGGATGG - Intronic
1025629332 7:63254893-63254915 GGTTGTCACAGCTGGGGAGGAGG - Intergenic
1027036911 7:74931764-74931786 GGTGGCCAGAGCTTGGGGGAAGG + Intergenic
1027086652 7:75269695-75269717 GGTGGCCAGAGCTTGGGGGAAGG - Intergenic
1027746788 7:82085274-82085296 GCATGTCACAACTTGGGGGTGGG - Intronic
1028859760 7:95635640-95635662 GGTTGTCACAGCTGGGGTGATGG + Intergenic
1029550554 7:101235024-101235046 GATTGTCACAGCTTGTGGGGAGG - Intronic
1030092249 7:105867846-105867868 GGTTGTCTAAACTTGGGGGAGGG + Intronic
1032800353 7:135312879-135312901 GGTTGTCACATGTTGGGGGAGGG - Intergenic
1032847348 7:135762878-135762900 GATTGACACAGCTGGGGTGAGGG - Intergenic
1032986719 7:137345548-137345570 GGTTGTCGCAACTTGGTGGAAGG + Intergenic
1033982257 7:147179912-147179934 TTTTGTCACAACCTGGGGCAGGG - Intronic
1034513346 7:151553756-151553778 GGTTGTCACAGCTTGGGGTGGGG - Intergenic
1034912408 7:155008093-155008115 GGTTGTCACAACTAGGGGGTAGG + Intergenic
1038488390 8:27952282-27952304 TTTTCTCACAGCTCGGAGGATGG - Intronic
1038653121 8:29423611-29423633 TTTTGTGAGAGGTTGGGGGATGG + Intergenic
1040731758 8:50456330-50456352 TTTTGTTACAGCTGAGGGGATGG - Intronic
1040927208 8:52696914-52696936 GATTGTTTCAGCCTGGGGGATGG + Intronic
1041225815 8:55697269-55697291 GGTTGTCACAGCTGGGGAGGTGG - Intronic
1041534828 8:58914531-58914553 GACTGTCACAGCTAGGGGGTGGG + Intronic
1042254077 8:66785567-66785589 GGTTGTCACAACTTGTGGGGTGG - Intronic
1042819023 8:72909829-72909851 ATGTGTCACAGCTTAGGGGAAGG - Intronic
1043508910 8:80930850-80930872 GTCTGTCACAGCATGGTGGCTGG + Intergenic
1043616324 8:82130051-82130073 GTATCTCACAGCCTGGGGCAAGG + Intergenic
1043639017 8:82425667-82425689 GGTTGTCAGGGGTTGGGGGAAGG - Intergenic
1043739688 8:83795149-83795171 GGTTGTCAGGGGTTGGGGGAGGG + Intergenic
1045438550 8:102188083-102188105 GTTTGTCAAAGCTTGGGCCTTGG - Intergenic
1045571658 8:103373715-103373737 GGTTGTCACAACTTGGGAGAGGG - Intronic
1046244864 8:111545925-111545947 GTTTGTCACATAATGTGGGAGGG + Intergenic
1047179045 8:122569688-122569710 GGTTGTCATAGCTGGGGGAAAGG - Intergenic
1047638967 8:126797745-126797767 GGTTGTCACAGCACAGGGGAGGG - Intergenic
1048268700 8:133010824-133010846 GGCTGTCTCAGCATGGGGGAGGG - Intronic
1049025320 8:139984433-139984455 GTTTAGCACAGCCTGGGGGTGGG + Intronic
1049060810 8:140274686-140274708 GTTAGTTCCAGCTTGAGGGAAGG - Intronic
1050357582 9:4797521-4797543 GGTTGTCACAGCTTGGCAGAGGG + Intronic
1050863739 9:10470679-10470701 GCTTGTCACAACTGGGGAGAAGG - Intronic
1052744554 9:32427421-32427443 ATCTGTCTCAGCTTGGGTGAGGG + Exonic
1055468640 9:76590276-76590298 GGTTGTCACAACTGGGAGGAAGG - Intergenic
1057116805 9:92531620-92531642 GGTTGTCACAACTAGGAGGAAGG - Intronic
1058414657 9:104775043-104775065 GTTTGTCTTTGCTTGGGGCACGG - Intronic
1058630567 9:106982269-106982291 GGTTGTCACAGCTGGAGAGAAGG + Intronic
1059284965 9:113164646-113164668 GACTGTCACTGGTTGGGGGAAGG - Intronic
1059562658 9:115350386-115350408 GGTTGTCACAGCTTCTGGGTGGG + Intronic
1059741623 9:117156505-117156527 CATTGTCACAGCTTGGGGAGAGG - Intronic
1059795971 9:117697208-117697230 GTTTGTCGTAACTTGGGGGTTGG - Intergenic
1060806587 9:126581451-126581473 GGTTGTCACAACTGGAGGGAGGG + Intergenic
1061793018 9:133068437-133068459 GATTGTCACAGCTGGGGAGGGGG + Intronic
1061795623 9:133084221-133084243 GATTGTCACAGCTGGGGAGGGGG + Intronic
1061838079 9:133342308-133342330 GATTGTCACAGCTGCGGGCATGG - Intronic
1203638593 Un_KI270750v1:136850-136872 GTTTGTCACCGCTAGGGGAGGGG - Intergenic
1185543674 X:924278-924300 GGTTTTCACAGCTGGGGAGAGGG - Intergenic
1186147296 X:6637640-6637662 GTTTGTTAGAGCTAGGGGAAGGG - Intergenic
1186173324 X:6900313-6900335 GGTTGTCACCACTTGGGGGGGGG + Intergenic
1186330731 X:8529804-8529826 GGTTGTCTCAACTTGGGGGAGGG + Exonic
1186700033 X:12080903-12080925 GTCTGGCACATTTTGGGGGAAGG - Intergenic
1186756490 X:12677180-12677202 GTTTGTCACAACTTGGGGAGAGG - Intronic
1186830343 X:13383867-13383889 GGTTGTCACAACTTGTGGGGAGG - Intergenic
1187361490 X:18631947-18631969 GGTTGTCATAGCTGGGGGGGAGG + Intronic
1187985271 X:24803268-24803290 GGTTGTCACAGCTGGAGAGAAGG + Intronic
1188068102 X:25686409-25686431 TGTTGTCACAACTTGGGGGAAGG + Intergenic
1188443565 X:30234521-30234543 CTTTGTTACAGGTTGGGGGATGG - Intronic
1188723333 X:33550126-33550148 GTGTGTCACTGCTTGTGAGAAGG + Intergenic
1188938490 X:36207672-36207694 GGTTGTCACAATTTGCGGGAGGG - Intergenic
1189074975 X:37905658-37905680 GTTTGGCACAGCCTGCAGGAGGG + Intronic
1189130284 X:38491140-38491162 GGTTGTCACAGCTGGGGAGAGGG + Intronic
1189156102 X:38758287-38758309 GTTTGGCACAGGTTTGGGGTGGG + Intergenic
1189630209 X:42944349-42944371 GGTTGTTACAACTTGGTGGAGGG - Intergenic
1189759583 X:44307148-44307170 ATTTGTCACAGCTGGGGGTGGGG + Intronic
1191001958 X:55669616-55669638 GTTTGTCAAAGATTGGGTGGTGG + Intergenic
1192409935 X:70925145-70925167 GTTTGGCACTGCTGGGAGGAGGG - Intergenic
1193552162 X:82907877-82907899 GTTTGTAAGAGGTTGGAGGAAGG + Intergenic
1194687140 X:96934118-96934140 GTTTATCACAACTTGGGAGCAGG + Intronic
1197400514 X:125983777-125983799 GTCTGTGCCAGCTTGGGAGATGG - Intergenic
1199151958 X:144497726-144497748 GGTTGCCACAGCTCGTGGGAGGG - Intergenic
1199495198 X:148444996-148445018 GGTTGTCAGAGGCTGGGGGAGGG + Intergenic
1201321019 Y:12698813-12698835 GGTCTTCACAACTTGGGGGAAGG - Intergenic
1201432507 Y:13918990-13919012 GGTTGTCTCAACTTGGGGGAGGG - Intergenic