ID: 1022283174

View in Genome Browser
Species Human (GRCh38)
Location 7:28930874-28930896
Sequence CAGCTTTTCTTGGGGACAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022283174_1022283181 5 Left 1022283174 7:28930874-28930896 CCATCTGTCCCCAAGAAAAGCTG No data
Right 1022283181 7:28930902-28930924 GAAAGTCATCTGACTTGCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022283174 Original CRISPR CAGCTTTTCTTGGGGACAGA TGG (reversed) Intergenic
No off target data available for this crispr