ID: 1022283194

View in Genome Browser
Species Human (GRCh38)
Location 7:28931064-28931086
Sequence CACCATCTAGGTTTTAAGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022283191_1022283194 5 Left 1022283191 7:28931036-28931058 CCATGGTGGTTTGCTGCACCTAT 0: 2771
1: 7061
2: 7370
3: 18035
4: 9070
Right 1022283194 7:28931064-28931086 CACCATCTAGGTTTTAAGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022283194 Original CRISPR CACCATCTAGGTTTTAAGCC CGG Intergenic
No off target data available for this crispr