ID: 1022283373

View in Genome Browser
Species Human (GRCh38)
Location 7:28932803-28932825
Sequence CACGTAATGTACTCTGTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022283367_1022283373 13 Left 1022283367 7:28932767-28932789 CCAGCAGCTAACACACCGTGAGT No data
Right 1022283373 7:28932803-28932825 CACGTAATGTACTCTGTGCTGGG No data
1022283370_1022283373 -2 Left 1022283370 7:28932782-28932804 CCGTGAGTTCTGGGTTCTCACCA No data
Right 1022283373 7:28932803-28932825 CACGTAATGTACTCTGTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022283373 Original CRISPR CACGTAATGTACTCTGTGCT GGG Intergenic
No off target data available for this crispr