ID: 1022290425

View in Genome Browser
Species Human (GRCh38)
Location 7:28997252-28997274
Sequence GTGAATAAACGTATGCAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 209}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022290422_1022290425 16 Left 1022290422 7:28997213-28997235 CCATATGTGGAGAATGGACAGGA 0: 1
1: 0
2: 1
3: 11
4: 165
Right 1022290425 7:28997252-28997274 GTGAATAAACGTATGCAAAAAGG 0: 1
1: 0
2: 0
3: 14
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022290425 Original CRISPR GTGAATAAACGTATGCAAAA AGG Intronic
901115782 1:6842618-6842640 GTGGTTAAAAGTAAGCAAAAGGG + Intronic
903025105 1:20423062-20423084 GTGCATCAACATATGCATAATGG + Intergenic
904791474 1:33025311-33025333 CTGAATAAACATTTGCCAAAGGG + Intronic
905147741 1:35901334-35901356 GAGAATACATGTATGCACAACGG + Intronic
907145638 1:52228536-52228558 GGGAAGAAAGGTGTGCAAAAGGG - Intronic
908642114 1:66236680-66236702 GAGAGTAAATGTATGCAGAAGGG + Intronic
909722961 1:78797527-78797549 GTGAGTATAGGTAAGCAAAATGG - Intergenic
910184728 1:84525883-84525905 GTGAATAAACATTTCCTAAATGG - Intergenic
910207261 1:84760263-84760285 GTGTATATAAGTATACAAAAAGG + Intergenic
913139769 1:115929280-115929302 GTGAATGAATGAATGCATAAAGG + Intergenic
916755339 1:167763930-167763952 GAGAATAAACATTTGCAAGATGG + Intronic
917172845 1:172196667-172196689 GTCAATAAACATATAAAAAAAGG - Intronic
917274261 1:173314521-173314543 GATAATAGAAGTATGCAAAATGG - Intergenic
918500973 1:185195759-185195781 GTCAACAAACATATGGAAAAAGG - Intronic
1065268875 10:24006325-24006347 ATGGATAAAAGTATGGAAAAAGG - Intronic
1066479716 10:35783881-35783903 CTGAATAAACATTTGCACAACGG + Intergenic
1070255852 10:74812771-74812793 GCGAATAAACATATGAAAAATGG - Intergenic
1070291069 10:75114445-75114467 GTGAATAAGCTTTTGCAGAAGGG - Intronic
1070482294 10:76894699-76894721 GTTAATAAACTTATGCAAAGAGG + Intronic
1072396472 10:95048199-95048221 GTGAATAATCATAAGCCAAATGG - Intronic
1072474638 10:95748270-95748292 GTCAGTAGACATATGCAAAATGG - Intronic
1073648059 10:105327331-105327353 GTGAATTAACAAATGCAAAAAGG - Intergenic
1075137713 10:119800649-119800671 GTCAGTAGATGTATGCAAAAGGG + Intronic
1078548661 11:12264801-12264823 CTGAATAAATGAATGCATAAAGG - Intergenic
1078974523 11:16457032-16457054 ATGAATAAATGAATACAAAAGGG + Intronic
1079198913 11:18357323-18357345 GTGAATAAATATAGCCAAAAGGG - Intronic
1079748611 11:24165325-24165347 GTGAATAAATGTTTGGAAAAGGG - Intergenic
1081913547 11:46716769-46716791 GTGAGTAAAAGTCTGCAAAGAGG + Intergenic
1082245074 11:49911885-49911907 GTCAAAAAACATATGAAAAAAGG - Intergenic
1082792709 11:57358121-57358143 GTCAATAAACGTTTGCTGAATGG - Intronic
1084175233 11:67419385-67419407 GTGAGTAAACTGAGGCAAAAGGG - Intronic
1085099272 11:73786714-73786736 GTGACTATAGGTTTGCAAAAGGG - Intergenic
1087646959 11:100819166-100819188 ATGAATAAAGGTATACAGAACGG + Intronic
1087910430 11:103746757-103746779 GTGCATAGAGGTATGCATAATGG + Intergenic
1091128502 11:133123684-133123706 CTGAATAACCATATGCCAAAAGG + Intronic
1092025988 12:5240981-5241003 TTGATTAAAAGTATGGAAAAAGG + Intergenic
1093509663 12:19911531-19911553 CTGGATATCCGTATGCAAAAAGG - Intergenic
1093514410 12:19969068-19969090 GTTTATACAAGTATGCAAAATGG - Intergenic
1095703545 12:45215548-45215570 CTAAATAAACGTGTGCACAAAGG - Intergenic
1097962820 12:65549058-65549080 ATGAATAAATGTATGCATGAAGG + Intergenic
1098797409 12:74908243-74908265 GTTAGTAAACGTATGCATAGTGG + Intergenic
1098963000 12:76758681-76758703 GTGGATATCCATATGCAAAAAGG + Intergenic
1100086575 12:90918038-90918060 GAGAAAATACCTATGCAAAAAGG - Intronic
1100247313 12:92772429-92772451 GTAAATAAATTAATGCAAAATGG + Exonic
1100683762 12:96961747-96961769 GTGAAAAAACATATGCATTATGG + Intergenic
1101398744 12:104370411-104370433 GTGAAGGAAGGTAGGCAAAATGG + Intergenic
1102396689 12:112592006-112592028 GTGATTTAAAGTATGCAAAGAGG - Intronic
1104501500 12:129290599-129290621 GTGTATAAAAGTATAGAAAAAGG + Intronic
1106071412 13:26415572-26415594 GTGAATAAACAAATGCAGCAAGG + Intergenic
1106530447 13:30585788-30585810 ATGAATACACGTATGTAAACAGG + Intronic
1106959317 13:34979203-34979225 GTGCATAAAGGCATGAAAAAGGG - Intronic
1107260960 13:38490574-38490596 GATAATAAAAGTATGTAAAAAGG - Intergenic
1109117948 13:58413513-58413535 GTGAATAAATATATGCAGTAGGG + Intergenic
1110522519 13:76497426-76497448 GTGAAGAGATGTATCCAAAATGG + Intergenic
1111238249 13:85437763-85437785 GTGAATAAAAGTAGGTAAAAGGG + Intergenic
1111909854 13:94298986-94299008 TTCAATAAATGTTTGCAAAAGGG + Intronic
1113214534 13:108023449-108023471 GTGAATAAATGTGTGTGAAAAGG + Intergenic
1113397284 13:109960370-109960392 GTAAATGAATGCATGCAAAATGG - Intergenic
1114663420 14:24365496-24365518 GTTAATAAAGGCATACAAAATGG + Intergenic
1114913997 14:27239094-27239116 GTGAATAAAGAAATGCAAGAGGG + Intergenic
1115105308 14:29753938-29753960 GAGAACATACGTATGCAAAAGGG + Intronic
1116578098 14:46601820-46601842 GTGAATGAAGATATGCAAGATGG + Intergenic
1120291932 14:82585828-82585850 GTGAAAATACCTATCCAAAATGG - Intergenic
1121072031 14:91032861-91032883 GCCAATAAACATATGAAAAATGG + Intronic
1123203296 14:106688417-106688439 CTGAGTACACGTATCCAAAATGG + Intergenic
1124122806 15:26905377-26905399 GAGAAGAAACTTATGCACAAGGG - Intronic
1124832702 15:33164466-33164488 ATGAAAAAACGTACACAAAAAGG - Intronic
1124943421 15:34239757-34239779 GGGAATAATGGTATGGAAAATGG + Intronic
1126237669 15:46405056-46405078 GTGAATAAACTTAAGTAATAAGG - Intergenic
1126309937 15:47304083-47304105 GAGAAAAAATGTATGCATAATGG - Intronic
1126711072 15:51456776-51456798 ATGAATAAACAGATACAAAATGG - Intronic
1127329918 15:57928701-57928723 GCCAATAAACATATGAAAAAAGG - Intergenic
1133988120 16:10683911-10683933 GTAAATAAATGTATGATAAAAGG + Intronic
1134385528 16:13768580-13768602 GTGAATAAAAGTATGGAAGCTGG + Intergenic
1134621479 16:15692721-15692743 ATGAAATAAAGTATGCAAAATGG - Intronic
1136645861 16:31614282-31614304 GTGAACAAACATACGAAAAAAGG + Intergenic
1137397974 16:48130360-48130382 GTGAATAAATGAATGAATAAAGG + Intronic
1139314623 16:66057742-66057764 GTGTGTGAACGTATGCAGAATGG - Intergenic
1140392733 16:74601775-74601797 GTTTATAAATGTATGCTAAATGG - Intronic
1143589121 17:7870056-7870078 CTGAATAATCCTATACAAAATGG - Intronic
1149025965 17:52027671-52027693 GTGAATGAGGGTCTGCAAAAGGG - Intronic
1149149825 17:53548027-53548049 GTGAGAAAATCTATGCAAAACGG + Intergenic
1157165995 18:45359003-45359025 GTTAATAAACATCTGCAAAATGG + Intronic
1161018778 19:1997777-1997799 GTGAATAAATGCATGCATATGGG - Intronic
1166867436 19:45848534-45848556 GTGAATAAACGGATGGTCAATGG + Intronic
1167650629 19:50726716-50726738 GGGAGTAAAGGTATGAAAAATGG - Intergenic
1168191721 19:54743556-54743578 GAGAATAAAAGAATCCAAAAAGG + Intronic
1168704434 19:58461132-58461154 GGGACTAAACATATGTAAAAAGG - Intergenic
924984050 2:252459-252481 GAGAAAAAGCCTATGCAAAAGGG + Intronic
925566267 2:5257790-5257812 GAGAATAAACCAATGCAAAAAGG - Intergenic
930483390 2:51979155-51979177 GTGAAAAAACAAATCCAAAAAGG + Intergenic
932949361 2:76274493-76274515 GTGAATTAATAAATGCAAAATGG + Intergenic
933500409 2:83103612-83103634 GTGAATGATATTATGCAAAATGG + Intergenic
935590188 2:104841072-104841094 GTAAATATACATATGCACAAGGG - Intergenic
936665841 2:114594414-114594436 GTGAATACATATATGTAAAAGGG + Intronic
937104957 2:119302432-119302454 CTTAATACAGGTATGCAAAAAGG + Exonic
939476061 2:142687657-142687679 GTGTATAAACATGTCCAAAATGG - Intergenic
939874879 2:147566305-147566327 GTGTATAAATGTATACAGAAAGG + Intergenic
940665119 2:156599684-156599706 GTGAAGAAACGGAGGTAAAAAGG + Intronic
941973787 2:171381628-171381650 GCCAATAAACATATGAAAAAAGG + Intronic
943620146 2:190140002-190140024 GTAAATACACCTATCCAAAATGG + Intronic
944604335 2:201337342-201337364 CTGAATAACCATATGCAGAAGGG - Intronic
944779078 2:202999051-202999073 GTGAATAATCAGATGAAAAATGG - Intronic
945188012 2:207159234-207159256 GTGAATACACATATCCATAATGG - Intronic
945521653 2:210834482-210834504 GTGAATAATCATAGCCAAAATGG - Intergenic
945798562 2:214395449-214395471 GTGAATAAGCATATGAAAAGAGG - Intronic
945828877 2:214758916-214758938 CTGCAAAAACATATGCAAAAAGG + Intronic
945977654 2:216283255-216283277 ATGAATAAATGAATGCAGAAAGG - Intronic
946598363 2:221331876-221331898 TTAAATAAAAGAATGCAAAATGG - Intergenic
1169158845 20:3358588-3358610 TTGAATCTACGTATTCAAAAGGG - Intronic
1169556182 20:6752677-6752699 GTGTATAAACCTTTGCACAAAGG - Intergenic
1170175355 20:13462802-13462824 GTAAATAAACTTAACCAAAAAGG + Intronic
1171177552 20:23064243-23064265 CAGAACAAATGTATGCAAAATGG - Intergenic
1172017332 20:31885470-31885492 CTGGATAAACATATGGAAAATGG + Intronic
1173716690 20:45213829-45213851 GTGTAAAAACATATGCATAATGG - Intergenic
1173719704 20:45245149-45245171 GTGTAAAAACATATGCATAATGG - Intergenic
1174680656 20:52403736-52403758 GAGAAAAAAAGTGTGCAAAATGG - Intergenic
1175389124 20:58615336-58615358 GTGAACAAAGGCAAGCAAAATGG - Intergenic
1176039544 20:63057183-63057205 GTGAATGAATGAATGAAAAAAGG - Intergenic
1177090671 21:16763551-16763573 GAAAATACACGTATGCACAATGG + Intergenic
1177098868 21:16874430-16874452 AAAAATAAACGTATGTAAAATGG - Intergenic
950141244 3:10617544-10617566 GTGAAGAAACGAAGGCACAAAGG + Intronic
951327377 3:21319444-21319466 CTGAATAAATGTAGGAAAAACGG - Intergenic
951468219 3:23025712-23025734 GCCAAGAAACGTATGAAAAAAGG + Intergenic
953131967 3:40148832-40148854 GTGAATAAAGGTAACCAACATGG + Intronic
954768490 3:52943571-52943593 GTGGACACACGTTTGCAAAATGG - Exonic
955366781 3:58317509-58317531 GTGGATGAACGTTTCCAAAATGG - Exonic
956642374 3:71427276-71427298 ATGAATAAATGGATACAAAACGG + Intronic
957027337 3:75197533-75197555 GGAAATAAACGCATGAAAAAAGG + Intergenic
957282897 3:78176668-78176690 GTGAAGTAATGTATGCCAAATGG + Intergenic
957471912 3:80668955-80668977 GTGAATATACCTGTTCAAAAGGG - Intergenic
958496805 3:94854554-94854576 TTGAATAAAAGCATGTAAAAAGG - Intergenic
958993743 3:100877424-100877446 GTGTATAAACATGTGCAGAATGG - Intronic
959399432 3:105881845-105881867 GGGAACAAACGTAGGAAAAAAGG + Intergenic
964018351 3:151975848-151975870 GTAAATGAATGAATGCAAAATGG + Intergenic
964318425 3:155468528-155468550 GAAAATAAACGGATGGAAAAAGG + Intronic
965338059 3:167452549-167452571 GTGAATTAACATTTGCAAATTGG + Intronic
966172906 3:177102305-177102327 GTGAATAAATATGTGAAAAATGG + Intronic
966700247 3:182841520-182841542 ATGAATAAATGTTTTCAAAATGG - Intronic
974598402 4:64043152-64043174 GCCAATAAACATATGAAAAAAGG - Intergenic
974728323 4:65826220-65826242 GTGAAGTAACTTATACAAAAAGG - Intergenic
975616209 4:76250321-76250343 GTGAACAAACATATGAAAAAAGG - Intronic
976517974 4:85993632-85993654 GTGAAGAAAATGATGCAAAAAGG - Intronic
976697413 4:87932548-87932570 AGGAATAAACTTATGCAAAGAGG - Intergenic
977186252 4:93941014-93941036 GTCAAGAAATGTATGAAAAAAGG - Intergenic
979323797 4:119355159-119355181 GTGAATAAATGCATGGAAAATGG - Intergenic
979662029 4:123267576-123267598 GTGAATAAAAATATGCCAAAAGG - Intronic
979954920 4:126940609-126940631 GTGGATAAAATTATTCAAAATGG - Intergenic
980436573 4:132783570-132783592 GTGAATACAAGTAAGCAAAAGGG - Intergenic
981775577 4:148363367-148363389 GTGAATAAATGACTGAAAAATGG - Intronic
982178351 4:152727610-152727632 GTGACAAAACAAATGCAAAAGGG - Intronic
982180932 4:152747879-152747901 GTAAATTAACTTATGCTAAACGG + Intronic
982983955 4:162180213-162180235 ATGAATAAATATATGTAAAATGG + Intergenic
985900396 5:2784403-2784425 GTGCACAAACGTATGCACACAGG + Intergenic
987651959 5:20752838-20752860 GTAAATAAAGGTATTCATAAAGG - Intergenic
988743604 5:34108640-34108662 GTAAATAAAGGTATTCATAAAGG + Intronic
993502969 5:88682769-88682791 GTGAATAAGCATATTCATAAAGG + Intergenic
993743233 5:91564868-91564890 GTAAATAAACCTATTCTAAATGG + Intergenic
997047027 5:130330784-130330806 GTAAATAAACCTATTCCAAAAGG - Intergenic
998617693 5:143758752-143758774 GTGCATAAACCTGTGCAGAATGG + Intergenic
1000781554 5:165488885-165488907 GTAAATAAACGTATTCTAGAAGG - Intergenic
1003411694 6:5869623-5869645 GTGAATGAATGAATGAAAAATGG - Intergenic
1005869438 6:29963445-29963467 GTCAACAAACATATGAAAAAAGG + Intergenic
1008097471 6:47353785-47353807 GTGAATAAAGGTATGGATGATGG - Intergenic
1008167981 6:48164089-48164111 GTGTTTAAAAGTAGGCAAAAAGG - Intergenic
1008469626 6:51869286-51869308 GTGAATAGAAGTTTGCAAGAAGG - Intronic
1009334915 6:62475051-62475073 GTGCACCAACATATGCAAAATGG + Intergenic
1011001889 6:82599488-82599510 TTGAATAAACATAAGCACAAAGG + Intergenic
1011120207 6:83943504-83943526 GAGGAAAAACCTATGCAAAAAGG + Intronic
1012200577 6:96401520-96401542 GTGGATAAACGTGTTCAATATGG - Intergenic
1012286265 6:97392634-97392656 ATGAATAAAGGTTTGCCAAAAGG + Intergenic
1012563883 6:100621467-100621489 GTCAACAAACATATGAAAAAAGG + Intronic
1013815922 6:114097305-114097327 GTGGATATACTTATGAAAAAAGG + Intronic
1014358402 6:120442259-120442281 GGGAATAAATGCATGCAAATTGG + Intergenic
1016733396 6:147450058-147450080 GTTAATAAATGTATTAAAAACGG + Intergenic
1018309793 6:162495879-162495901 GTGAATGAATGTATGGAAAGGGG - Intronic
1020661587 7:10990565-10990587 GTTAATAAAAGAATGGAAAATGG + Intronic
1021164142 7:17313367-17313389 GTGAATAACAGGATGCAAACAGG + Intronic
1022139057 7:27476315-27476337 GTGAGGAAACACATGCAAAAGGG - Intergenic
1022290425 7:28997252-28997274 GTGAATAAACGTATGCAAAAAGG + Intronic
1022702351 7:32773461-32773483 GACAACAAACGTATGAAAAAAGG + Intergenic
1028768729 7:94590345-94590367 GTGAATGAAAGCATGCTAAATGG - Intronic
1030848275 7:114450213-114450235 TTGAATAAAAGTATGCATAGAGG - Intronic
1031231382 7:119111954-119111976 GAGAATAAAGGAATGGAAAAGGG - Intergenic
1036006444 8:4669721-4669743 GTGAATAAAACTATGTAAAGAGG - Intronic
1037136530 8:15469383-15469405 GCAAATAAACGTATGAAAATAGG + Intronic
1040027487 8:42795371-42795393 GTGAATAGACGTAACCAAAATGG + Intronic
1040842390 8:51798564-51798586 GTCAACAAACATATGAAAAAAGG + Intronic
1041619160 8:59945230-59945252 GTGAATAAATGTCTTCAATAAGG - Intergenic
1042455023 8:68990882-68990904 ATGAATAAACATATGTGAAATGG + Intergenic
1043289001 8:78572122-78572144 GTGAAGCAAATTATGCAAAAAGG - Intronic
1043826485 8:84935713-84935735 GTGAATAAAGCAAGGCAAAAGGG - Intergenic
1044171084 8:89052667-89052689 GCCAATAAACATATGAAAAAAGG + Intergenic
1046880124 8:119298714-119298736 GTAAATAAACTCATTCAAAATGG + Intergenic
1047274472 8:123395539-123395561 ATGAAGAAACGGATTCAAAAAGG - Intronic
1047703913 8:127478431-127478453 GTGAATAAATGAATGAATAATGG - Intergenic
1049177706 8:141204348-141204370 CTGGATAAACGTATGGAAAAGGG + Intergenic
1050371125 9:4922424-4922446 GTGAATAATTTTATCCAAAAGGG - Intergenic
1050451902 9:5790566-5790588 GTAAATAAAGGTATGAACAAAGG + Intronic
1050584552 9:7097009-7097031 GTGAAAAAACATGAGCAAAATGG - Intergenic
1051988608 9:23122701-23122723 GTGAACAGTTGTATGCAAAATGG - Intergenic
1054885622 9:70195076-70195098 TTGAATAAACGTACTAAAAATGG + Intronic
1055484343 9:76742722-76742744 GTCAATGAACATATGAAAAAAGG + Intronic
1056454879 9:86750773-86750795 TTGCATTAACGTATGGAAAATGG - Intergenic
1058643920 9:107112817-107112839 ATGAATGTACGTATGAAAAAGGG + Intergenic
1059017308 9:110533290-110533312 GTGAATAAAAGCTTGCTAAAGGG - Intronic
1059380355 9:113918926-113918948 GTGAATGAACGAATGAAAACTGG + Intronic
1060566807 9:124599904-124599926 TTGAATAAACATATGGGAAATGG - Intronic
1186962015 X:14746721-14746743 GTTAAGCAAAGTATGCAAAATGG + Intergenic
1188423422 X:30016401-30016423 GTAAATAAACGTCTGAAAGAAGG + Intergenic
1190391089 X:49932378-49932400 GTAAATAAAAGTATAAAAAAAGG - Intronic
1191052217 X:56206439-56206461 ATAAATAAACCTATTCAAAATGG + Intergenic
1191652010 X:63549488-63549510 GCCAATAAACATATGAAAAAAGG - Intergenic
1191871291 X:65747757-65747779 GTGATTTAATTTATGCAAAAGGG - Intergenic
1193466376 X:81852724-81852746 GTAAATAATCTTATTCAAAAAGG + Intergenic
1193669717 X:84369358-84369380 GTGAATAATGGTATGCATATAGG + Intronic
1194620994 X:96171660-96171682 GTGAATAAATGTATGATCAAAGG + Intergenic
1194855631 X:98924835-98924857 ATGCATAAAAGTATGCAACAGGG + Intergenic
1195282666 X:103351148-103351170 GTGAATGAACTCATGTAAAATGG - Intergenic
1197608778 X:128615408-128615430 GTGAAGAAACTAATGCAAATGGG - Intergenic
1199409646 X:147506006-147506028 GTGAAGTACTGTATGCAAAACGG + Intergenic
1201757990 Y:17509681-17509703 TTGAATAAACCTATTCAGAAAGG + Intergenic
1201843565 Y:18396301-18396323 TTGAATAAACCTATTCAGAAAGG - Intergenic
1202043425 Y:20711913-20711935 GCCAATAAACATAGGCAAAAAGG + Intergenic