ID: 1022291600

View in Genome Browser
Species Human (GRCh38)
Location 7:29009785-29009807
Sequence TTGCCCTTCCTAATTACCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 141}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022291600_1022291601 1 Left 1022291600 7:29009785-29009807 CCAGGGGTAATTAGGAAGGGCAA 0: 1
1: 0
2: 0
3: 15
4: 141
Right 1022291601 7:29009809-29009831 GTCGTATTTTTTAAACCAGCTGG 0: 1
1: 0
2: 0
3: 6
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022291600 Original CRISPR TTGCCCTTCCTAATTACCCC TGG (reversed) Intronic
904282269 1:29428971-29428993 TTACCTGTCTTAATTACCCCAGG - Intergenic
904799611 1:33083041-33083063 TTGCCTTTCCTGATCGCCCCAGG + Intronic
904928805 1:34069979-34070001 TCCCCCTTCATAATTACTCCAGG + Intronic
905942595 1:41875655-41875677 TTTCCCTTACTCATGACCCCAGG + Intronic
906251238 1:44312451-44312473 CTGCCCTTCCTTATTCCCTCGGG + Intronic
909841243 1:80327393-80327415 TTGCTATCCCTAATTACTCCAGG + Intergenic
910434219 1:87188750-87188772 TTTCCCTTACTCTTTACCCCTGG + Intergenic
911439180 1:97904059-97904081 TAGCCCTTCCTGATTACCCTGGG - Intronic
911768862 1:101713762-101713784 ATTGCCTTACTAATTACCCCTGG - Intergenic
913062703 1:115222558-115222580 ATGACCTTCCTAAATATCCCTGG - Intergenic
913234726 1:116769994-116770016 TTGCCCTTAGTAATTAACTCTGG - Intergenic
913308497 1:117459435-117459457 GTGCCCTTGGTAAATACCCCTGG + Intronic
915119996 1:153623989-153624011 TTGCCCTTCCTCCTCACCTCAGG - Intronic
915900145 1:159840904-159840926 ATTCCCTACCTGATTACCCCAGG + Intronic
916443816 1:164853666-164853688 TCTCCCTTCCTAATGACCACAGG - Intronic
917610419 1:176683737-176683759 TTGCCCTTCCTATTTAGCTCTGG + Intronic
918944998 1:191052181-191052203 TTGCCTTTGATAATTACACCTGG - Intergenic
922217697 1:223534045-223534067 ATGCACTTCCTAATTACACAGGG - Intergenic
1065432512 10:25673871-25673893 TTCCCCTTCCTAATAAACCTGGG - Intergenic
1066698365 10:38099282-38099304 TTTCCCTTCCTCCTTGCCCCTGG + Intronic
1068305966 10:55208710-55208732 TTTCCTTTCCTACATACCCCTGG + Intronic
1072626813 10:97117587-97117609 CTACCCTTCCAATTTACCCCTGG - Intronic
1073285543 10:102385345-102385367 CTGCCCCTCCTAATTTTCCCAGG - Intergenic
1073526208 10:104184649-104184671 TTCCCCACCCTAATCACCCCAGG + Intronic
1074293751 10:112162414-112162436 GTGCCCTTCCTTCTTACCTCTGG - Intronic
1075419660 10:122291230-122291252 TTGCCCTTCCGATTTCCCCCAGG - Intronic
1080694911 11:34595067-34595089 TTGTCCTTCCTAGTTTTCCCAGG - Intergenic
1083183910 11:61006695-61006717 TTTCCCTTCTTTATTACCCTGGG - Intronic
1086412853 11:86559464-86559486 TTTCCCTTCCCATTTCCCCCAGG + Intronic
1090752957 11:129763550-129763572 TAGCCCTCCCCAATGACCCCTGG - Intergenic
1091662256 12:2393163-2393185 TTGCCCCTCCTAGTGAGCCCAGG - Intronic
1092112802 12:5975921-5975943 TTGCCCTTCCTCGTGAACCCGGG + Intronic
1097484610 12:60179923-60179945 TAGCCCTTCAGAATTGCCCCAGG - Intergenic
1099926584 12:89026218-89026240 TGGTCCTTCCTAATTTCTCCTGG - Intergenic
1102286712 12:111663611-111663633 CAGCCCTTCCTGAGTACCCCTGG + Intronic
1103485609 12:121280757-121280779 TTCCCCTTCCTAATAAGCCTGGG - Intronic
1105739045 13:23303111-23303133 TTTCCCTTGCACATTACCCCTGG + Intronic
1107348387 13:39487921-39487943 TTGCTTTTGCTATTTACCCCAGG + Intronic
1107558995 13:41543946-41543968 TTCCTCTGCCTAATCACCCCAGG + Intergenic
1107719945 13:43237885-43237907 TGGCAATTTCTAATTACCCCTGG - Intronic
1109697131 13:65975852-65975874 TTTACTTTCCTAATTACCACTGG - Intergenic
1111035925 13:82674551-82674573 TTGCCCTTCATAAATATCCTGGG - Intergenic
1111967923 13:94879770-94879792 TTCACCTTCCTAATTCCCCCAGG + Intergenic
1118447723 14:65866989-65867011 TTGCCCTTCCCATTAACGCCAGG + Intergenic
1119483999 14:74976695-74976717 TTGGCCTTCCCCAGTACCCCTGG - Intergenic
1122579757 14:102764194-102764216 TTCCACTTCCTAATTACCCTGGG + Intergenic
1123573809 15:21644486-21644508 TTGCCTTCCCTAATCACCCCAGG - Intergenic
1123610427 15:22087071-22087093 TTGCCTTCCCTAATCACCCCAGG - Intergenic
1123667266 15:22617502-22617524 TTGCCCTCGCCAATCACCCCAGG - Intergenic
1124321107 15:28712069-28712091 TTGCCCTCGCCAATCACCCCAGG - Intronic
1124481391 15:30083286-30083308 TTGCCCTCGCCAATCACCCCAGG + Intronic
1124487846 15:30135382-30135404 TTGCCCTCGCCAATCACCCCAGG + Intronic
1124522203 15:30413908-30413930 TTGCCCTCGCCAATCACCCCAGG - Intronic
1124536462 15:30552310-30552332 TTGCCCTCGCCAATCACCCCAGG + Intronic
1124542935 15:30604359-30604381 TTGCCCTCGCCAATCACCCCAGG + Intronic
1124755683 15:32402939-32402961 TTGCCCTCGCCAATCACCCCAGG - Intronic
1124762189 15:32455282-32455304 TTGCCCTCGCCAATCACCCCAGG - Intronic
1124776440 15:32593786-32593808 TTGCCCTCGCCAATCACCCCAGG + Intronic
1130260314 15:82349086-82349108 CTGCCCTTGCCAATCACCCCAGG - Intronic
1130268416 15:82430347-82430369 CTGCCCTTGCCAATCACCCCAGG + Intronic
1130280919 15:82519921-82519943 CTGCCCTTGCCAATCACCCCAGG + Intergenic
1130472289 15:84236102-84236124 CTGCCCTTGCCAATCACCCCAGG + Intronic
1130479782 15:84350673-84350695 CTGCCCTTGCCAATCACCCCAGG + Intergenic
1130483914 15:84387106-84387128 CTGCCCTTGCCAATCACCCCAGG + Intergenic
1130491988 15:84437456-84437478 CTGCCCTTGCCAATCACCCCAGG - Intergenic
1130503604 15:84516496-84516518 CTGCCCTTGCCAATCACCCCAGG - Intergenic
1130594587 15:85240738-85240760 CTGCCCTTGCCAATCACCCCAGG + Intergenic
1131058658 15:89391217-89391239 TAGCCCTTCAGAATAACCCCAGG + Intergenic
1131554443 15:93384957-93384979 TTCCCCTCCCTAATTTCCACTGG + Intergenic
1202982674 15_KI270727v1_random:378825-378847 TTGCCTTCCCTAATCACCCCAGG - Intergenic
1138881625 16:61022941-61022963 TTGCCCTTCCTTACTCCACCTGG + Intergenic
1139664734 16:68447867-68447889 CAGCCCTTCCTGAATACCCCTGG + Intronic
1140695519 16:77529106-77529128 TTCCCTTTCCTGATTGCCCCAGG - Intergenic
1140894633 16:79314326-79314348 TTTCCTTTCATAAGTACCCCAGG + Intergenic
1141035199 16:80620245-80620267 TCCCCCTTTCTAATTGCCCCTGG - Intronic
1143998612 17:11031715-11031737 TTGATCTTCCTAATAACCCTGGG - Intergenic
1147931930 17:43987196-43987218 TTGCCCTTATTAATTGCACCTGG + Intronic
1148835926 17:50465739-50465761 TCGCCCTTACCAATAACCCCTGG - Exonic
1148868712 17:50642973-50642995 GTGCCCCTCCTATATACCCCTGG + Intronic
1149357883 17:55862537-55862559 TTGCCCTTCCTGAGTTCCCCAGG + Intergenic
1157029095 18:43882762-43882784 TTTCCTTTCCTCATTACCTCAGG + Intergenic
1158749284 18:60240309-60240331 TTCCTCTTCCTAATAAGCCCAGG - Intergenic
1159115053 18:64104680-64104702 TAACACTTCCTAATTTCCCCAGG - Intergenic
1160422507 18:78756732-78756754 TGTCCCTTCCCATTTACCCCTGG + Intergenic
1163866530 19:19777695-19777717 TTGTCTTTCTGAATTACCCCTGG + Intergenic
1164752491 19:30667051-30667073 TTGCCCTACCCAATTTTCCCAGG + Intronic
924960030 2:26430-26452 CTGCCTTCCCTAATCACCCCAGG - Intergenic
925360617 2:3278039-3278061 CTGCCCTTCCTAATCATCCCTGG + Intronic
928486498 2:31737650-31737672 TTGCCCTTACAAATTGCTCCTGG - Intergenic
932701783 2:73997178-73997200 CTGCCCCTCCTAATTACTGCTGG + Intronic
933647397 2:84823821-84823843 TTCCCTTTCCTCATGACCCCAGG - Intronic
935784784 2:106538844-106538866 TTGCCCTTCCTCATCAGGCCGGG + Intergenic
936784419 2:116076725-116076747 TTACACTTCCTAAATATCCCTGG + Intergenic
938680260 2:133682388-133682410 TTTCCCTTCCTTATCATCCCTGG + Intergenic
942498927 2:176567885-176567907 ATGCCCTTCCTAGTAACCCCGGG + Intergenic
944066356 2:195623239-195623261 TTGCCCTGCCAAATTACCCAAGG + Intronic
945974305 2:216258782-216258804 TTGCCCATCCAAATGAGCCCAGG + Exonic
946827836 2:223696685-223696707 CTACCCTTCCTAATAACCACTGG + Intergenic
948153457 2:235763533-235763555 CTGTCCTTCCTAATTTCCCGAGG + Intronic
1171088485 20:22261911-22261933 TTGCTCTTCCCACTCACCCCAGG + Intergenic
1175149453 20:56921600-56921622 TTGTCTCTCCTAAGTACCCCTGG - Intergenic
1175993646 20:62802409-62802431 TTGCCTTTCCCAGTCACCCCTGG - Intergenic
1179196565 21:39169621-39169643 TGCCCCTCCCCAATTACCCCAGG + Intergenic
1179392085 21:41003273-41003295 TTGCCCTTCAGAATTACCCAAGG + Intergenic
1184008348 22:41727798-41727820 ATGCACTTCTTAATTTCCCCAGG + Intronic
949573858 3:5319769-5319791 ATACCCACCCTAATTACCCCAGG - Intergenic
957298148 3:78358468-78358490 TTGCCCTTCCTAATAAAGGCGGG - Intergenic
957625569 3:82649262-82649284 TTGAACTTCCTAAGTACCTCCGG + Intergenic
958509095 3:95022448-95022470 TTCCCCTTCCTAATAAGCCTGGG - Intergenic
959783709 3:110267561-110267583 TTGCCCTGCCTGATGACACCAGG - Intergenic
960815421 3:121666873-121666895 CTGCCCTTCCAAATTACACTTGG + Intronic
961094389 3:124142098-124142120 CAGCCCTTCCCAAGTACCCCAGG + Intronic
963601262 3:147380847-147380869 TTGCCCTTCCTAAGGAGGCCGGG - Intergenic
967497858 3:190162189-190162211 TTCCTCTTCCTAATAAGCCCGGG - Intergenic
975667924 4:76752282-76752304 TTCCCCCTCCTACTAACCCCTGG - Intronic
978023894 4:103848481-103848503 TTCCTCTTCCTAATAACCCTGGG + Intergenic
980313184 4:131162251-131162273 TTCCCCTTCCTAATAAGCCTGGG + Intergenic
987253518 5:16124515-16124537 TGGCCTTTCTTCATTACCCCAGG + Intronic
987662095 5:20890379-20890401 CTGCCCTTCCTTACTACCACAGG + Intergenic
988553691 5:32218825-32218847 TTGCCCTTCCTATTTCTACCAGG - Intergenic
988761486 5:34314921-34314943 CTGCCCTTCCTTACTACCACAGG - Intergenic
989414044 5:41152756-41152778 TTGCCCTTTGTAATTAGGCCTGG + Intronic
994401440 5:99285247-99285269 TTGACTTTCCTAATTTTCCCTGG - Intergenic
996107848 5:119526755-119526777 TTGCCCTGCATACTCACCCCAGG + Intronic
998696940 5:144651681-144651703 TGTCCCTTCCTAATTGCCCTAGG - Intergenic
999506270 5:152200580-152200602 TTACCCTTCTTAATTAGCCTGGG - Intergenic
1004314054 6:14571064-14571086 CTACCCGTCCTAATGACCCCAGG + Intergenic
1004468249 6:15905649-15905671 CTGCCCTTCTTAATTATTCCTGG - Intergenic
1011550908 6:88530455-88530477 TTCATCTTCCTAAGTACCCCTGG + Intergenic
1012460701 6:99457048-99457070 TTTCCCTTCCTAATGAGCCTGGG - Intronic
1012948915 6:105496606-105496628 TTGTCCTTCCTCGTTCCCCCTGG + Intergenic
1018474116 6:164123219-164123241 TTGCCGTTACAAATTACCACAGG - Intergenic
1019415006 7:923037-923059 TTCCCCTTCCTAAGGACACCGGG - Intronic
1020025125 7:4894537-4894559 TCCCCCATCCTAATCACCCCAGG + Intergenic
1022291600 7:29009785-29009807 TTGCCCTTCCTAATTACCCCTGG - Intronic
1023472150 7:40535304-40535326 TTCCCCTTCCTCCCTACCCCCGG + Intronic
1023908049 7:44536154-44536176 TGGCCCTTCCTAAGTGACCCTGG - Intronic
1024142605 7:46477584-46477606 TGGCCTTTCTTAGTTACCCCAGG - Intergenic
1028728635 7:94119176-94119198 TTGCCCTTCGTAATTTGCCCTGG - Intergenic
1029252105 7:99244263-99244285 TTGTCCTTCCTAAGTGCCTCAGG - Intergenic
1031441698 7:121802444-121802466 TTTCCTTTTCTAATTACCCAGGG + Intergenic
1033648390 7:143321967-143321989 TTCCCCTTCCTAGTGTCCCCTGG - Intronic
1033672584 7:143507150-143507172 TTCCCCACCCTAATCACCCCAGG + Intergenic
1033785303 7:144722873-144722895 TTGCCCTTCCTAACCACAACAGG + Intronic
1039208827 8:35188000-35188022 TTTCCCTTCCTAAGTTCCACGGG + Intergenic
1041314188 8:56544561-56544583 TTCCCTTCCCTAATCACCCCAGG + Intergenic
1041827046 8:62107697-62107719 ATGCCCTTCCTAATTGACCCTGG + Intergenic
1046886280 8:119370952-119370974 ATGCTCTTCCAAATAACCCCAGG + Intergenic
1047576649 8:126162943-126162965 GTGCCCTTTCTCATTAGCCCTGG + Intergenic
1047717964 8:127613304-127613326 TTGCACTTCCTAATTGGCCTTGG + Intergenic
1048201216 8:132375569-132375591 TTGCCCTTTCTCCATACCCCAGG - Intronic
1052894514 9:33734803-33734825 TAGCCCTCCCCAATGACCCCTGG - Intergenic
1058842843 9:108926650-108926672 TTGCCATTCCTAAGTACCTATGG + Intronic
1062588731 9:137263499-137263521 TTGCCCTCCCTCCTTCCCCCTGG + Intronic
1186518439 X:10185018-10185040 TTGACCATGCTAATTACACCTGG - Exonic
1202374163 Y:24218190-24218212 TTGCCCTTGCCAATCACCACAGG - Intergenic
1202496618 Y:25451930-25451952 TTGCCCTTGCCAATCACCACAGG + Intergenic