ID: 1022297057

View in Genome Browser
Species Human (GRCh38)
Location 7:29066108-29066130
Sequence AGTTTATCCAGTATCTAGGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 88}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022297053_1022297057 28 Left 1022297053 7:29066057-29066079 CCTGTAACATTCTGGAAGTAAGA 0: 1
1: 0
2: 1
3: 6
4: 143
Right 1022297057 7:29066108-29066130 AGTTTATCCAGTATCTAGGTTGG 0: 1
1: 0
2: 0
3: 5
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022297057 Original CRISPR AGTTTATCCAGTATCTAGGT TGG Exonic
911614783 1:99997861-99997883 AGACCTTCCAGTATCTAGGTTGG - Intronic
913107866 1:115631214-115631236 AGTGTAAACAGTATCTAAGTGGG + Intergenic
914694956 1:150068756-150068778 AGTTTATGCAGTACCTTTGTAGG - Exonic
922890432 1:229057881-229057903 GGGGTATCCAGTATCCAGGTTGG - Intergenic
1064157808 10:12918008-12918030 AGTTTACCTAGAATCTAGTTGGG + Intronic
1065066401 10:21969860-21969882 AGTTTATGCATTATGTAGGATGG + Intronic
1065703024 10:28443974-28443996 AATTTATCCAGATTCTAGGCTGG - Intergenic
1067081620 10:43215686-43215708 TGTATCTCCAGTATCTAGGCAGG - Intronic
1068025241 10:51634578-51634600 TTTTTAGCCAGTATCTAGGTAGG - Intronic
1071800230 10:89051703-89051725 ATATAATCCAGTATCCAGGTGGG + Intergenic
1072775310 10:98185553-98185575 AGATTATCCAGTAGCTAAGATGG + Intronic
1078245006 11:9566079-9566101 ACCTCATCCAGTATCTAGTTGGG - Intergenic
1078363047 11:10684824-10684846 ACTTTAACCAATATATAGGTGGG + Intronic
1080653345 11:34239934-34239956 TCTTTATCCAGTATTTAGGGGGG - Intronic
1081582775 11:44363948-44363970 AGTTTATTGAGTACCTAGGCAGG - Intergenic
1083691548 11:64411967-64411989 AATATACCCAGAATCTAGGTTGG - Intergenic
1086120057 11:83296396-83296418 AGTTCTTCTAGTATCTATGTAGG + Intergenic
1086198433 11:84170290-84170312 AATTTATTCAGTATTTAAGTTGG - Intronic
1092431994 12:8417566-8417588 ATTTTTCCCAGTATCCAGGTGGG + Intergenic
1094718897 12:33041548-33041570 AGTTTCTCTGGTATCTGGGTTGG + Intergenic
1102580177 12:113881423-113881445 AGTTTTTCCAGGACCCAGGTGGG + Intronic
1104095967 12:125558284-125558306 TGTTTATCCCTTCTCTAGGTGGG - Intronic
1117031419 14:51674824-51674846 AGATGATCCAGTAAATAGGTAGG + Intronic
1117400442 14:55354455-55354477 TGTTTATCCAGTGTCCAGGCTGG - Intronic
1126020672 15:44398025-44398047 AGTATCTCCAGTATCTATTTAGG - Intronic
1131498287 15:92934408-92934430 TGTTTTTACAGTATCTAGGGGGG + Intronic
1132257633 15:100391021-100391043 AATTCATCCAGTTTCTAGCTTGG + Intergenic
1135555709 16:23434827-23434849 AGTTAATTCAGTATCTAGGCAGG - Intronic
1135718242 16:24791422-24791444 AGTCTAATCAGTCTCTAGGTTGG + Exonic
1149374860 17:56033732-56033754 AGTGTATCTAATATCTAAGTTGG - Intergenic
1150300499 17:64043686-64043708 AGTTTATCCAGTAGATGGCTGGG + Exonic
1151117730 17:71756781-71756803 ACTTTATCCAGTAGCTAACTGGG + Intergenic
1156594213 18:38527914-38527936 AGTTTATCATATATCTAGCTAGG - Intergenic
1158284297 18:55862206-55862228 ATTTTTTCCAATTTCTAGGTTGG - Intergenic
1161712644 19:5858127-5858149 AGTTTTTACAGGATTTAGGTAGG - Intergenic
1164674748 19:30093699-30093721 AGTTTATCCAGTAGTGAGATGGG + Intergenic
928006369 2:27565719-27565741 AGTCTATCCAGTATCTGTGGTGG - Intronic
931503072 2:62892276-62892298 AGATTATACTGTAGCTAGGTGGG + Intronic
932175129 2:69593726-69593748 ATTTTATCCAGTATACAGTTTGG - Intronic
936341487 2:111637393-111637415 ATTCAATCCAGTATCTATGTGGG + Intergenic
939657551 2:144847045-144847067 AGTATTTCCAGTATGTATGTGGG + Intergenic
942520054 2:176794310-176794332 AGTCTAAACAGTATCTAGGATGG - Intergenic
943303189 2:186229187-186229209 AATTTATCAAGTCTCTAGGAAGG - Intergenic
1170477979 20:16735429-16735451 AGTTAAACCGTTATCTAGGTAGG - Intronic
1178278306 21:31258860-31258882 AGTTGACCGAGTATCTAGCTTGG - Intronic
1182983817 22:34698105-34698127 AGTTAATCCAGTTCCTAGGAAGG + Intergenic
951337023 3:21435559-21435581 AGTTTATCAAGAATTTTGGTGGG - Intronic
952725818 3:36583005-36583027 AGTTTTCCCAGCCTCTAGGTGGG - Intergenic
959912236 3:111776558-111776580 AGTTGATTTAGTATCTAGGCAGG - Intronic
964132761 3:153309136-153309158 AGTTTATTTGGTAACTAGGTGGG - Intergenic
966476756 3:180357746-180357768 AGTTTATCAAGTGTCTCAGTGGG - Intergenic
967122252 3:186392572-186392594 TGTATCTCTAGTATCTAGGTTGG + Intergenic
972135124 4:35883514-35883536 ATTTTATACAGTATCTATTTTGG + Intergenic
976108742 4:81647374-81647396 AGTTTTCCCAGTCTCTAGATTGG - Intronic
979783366 4:124684276-124684298 AGTGTATGCAGTGTCTAGGCTGG + Intronic
980024474 4:127748605-127748627 AGTTCACCCAGAATCTAGATAGG + Intronic
981500844 4:145449826-145449848 AGTTTATCCATTCTCTGGGTTGG - Intergenic
983059670 4:163143591-163143613 AGTTTTTCTATTATCTAGGAGGG + Intronic
983826229 4:172264810-172264832 AGTATATCCAGTAGATAGTTAGG - Intronic
984982741 4:185298833-185298855 TGTTTATCCAGGATCCAGGGAGG - Intronic
987221552 5:15795451-15795473 AGCTGATGCAGTTTCTAGGTAGG + Intronic
987489581 5:18560441-18560463 TTTTTATCCAGAATCTAGTTTGG + Intergenic
988194208 5:27980500-27980522 ATTTTCTTCAGTATCTAGATGGG + Intergenic
996206714 5:120746912-120746934 ATTTTATCCAATAACTATGTTGG - Intergenic
996947126 5:129083849-129083871 ATGGTATCCAGAATCTAGGTGGG + Intergenic
1004317350 6:14601301-14601323 GGCTTTTCCAGTATCCAGGTGGG + Intergenic
1010369766 6:75094039-75094061 AGTTTTTAAAGTATTTAGGTTGG + Intronic
1013676788 6:112473165-112473187 CGTTTATACAGTATTTAGGCAGG + Intergenic
1016189051 6:141237764-141237786 ACTTTCTCCTGTGTCTAGGTAGG - Intergenic
1022297057 7:29066108-29066130 AGTTTATCCAGTATCTAGGTTGG + Exonic
1022749136 7:33204901-33204923 AGTTTTTCCAGTACTTTGGTTGG + Intronic
1023611054 7:41971655-41971677 AGTTTACCCAGTTTCTAGACTGG + Intronic
1028012663 7:85667917-85667939 AGTATATCCAGTGTCTAGGGAGG - Intergenic
1030164214 7:106536671-106536693 ATTTTATCCACAGTCTAGGTAGG - Intergenic
1033944455 7:146699100-146699122 AGTTTCTGCTGTATCTAAGTAGG + Intronic
1040801015 8:51340134-51340156 ATATTATCCAGTAGCCAGGTAGG + Intronic
1043213532 8:77554873-77554895 AGTTTAAGCAGCATATAGGTGGG - Intergenic
1043562248 8:81507438-81507460 AGTTTAGCAAGTATTCAGGTAGG - Intergenic
1043601762 8:81948384-81948406 AGAGTATCCAGCATCTAGTTGGG + Intergenic
1045513136 8:102830750-102830772 AGTTGATCCAGTCAGTAGGTTGG - Intronic
1045536985 8:103039671-103039693 AATCTATTCAGAATCTAGGTAGG - Intronic
1051791997 9:20815479-20815501 ATAGTATCCAGTATCTTGGTTGG + Intronic
1052610804 9:30771178-30771200 AGTTTATGCAATATGTAGGTTGG - Intergenic
1053425515 9:38007508-38007530 AGTTTAGCCACTTGCTAGGTGGG - Intronic
1055331971 9:75194312-75194334 ACATTATCCAGTATTTATGTGGG - Intergenic
1055830358 9:80371353-80371375 AGTGTAGCAAGTATGTAGGTGGG - Intergenic
1056085895 9:83149079-83149101 TGTTTTTCCAGTCTCTAGGGTGG - Intergenic
1056618941 9:88194358-88194380 AGTTTCTCCAGTCTTTATGTGGG + Intergenic
1060559024 9:124527684-124527706 GGTTTTTCCAGTATCTAAGGTGG + Intronic
1194118347 X:89931133-89931155 AGTTTAGCTAGTACCAAGGTTGG - Intergenic
1194501253 X:94684187-94684209 AGTTTATCCTGTCTCTCGCTGGG + Intergenic
1198692490 X:139299612-139299634 ATTTTATCCAATATCAAGCTGGG - Intergenic
1198851557 X:140969847-140969869 AGTTTATCCAAGTTGTAGGTGGG - Intergenic
1200471229 Y:3588702-3588724 AGTTTAGCTAGTACCAAGGTTGG - Intergenic