ID: 1022301317

View in Genome Browser
Species Human (GRCh38)
Location 7:29105292-29105314
Sequence CACCCATGGCTGCCACAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 192}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022301317_1022301321 15 Left 1022301317 7:29105292-29105314 CCAGACTGTGGCAGCCATGGGTG 0: 1
1: 0
2: 0
3: 14
4: 192
Right 1022301321 7:29105330-29105352 TGGCTACATGATGCAAGGACAGG No data
1022301317_1022301322 24 Left 1022301317 7:29105292-29105314 CCAGACTGTGGCAGCCATGGGTG 0: 1
1: 0
2: 0
3: 14
4: 192
Right 1022301322 7:29105339-29105361 GATGCAAGGACAGGTAAACTTGG No data
1022301317_1022301320 10 Left 1022301317 7:29105292-29105314 CCAGACTGTGGCAGCCATGGGTG 0: 1
1: 0
2: 0
3: 14
4: 192
Right 1022301320 7:29105325-29105347 TCTGCTGGCTACATGATGCAAGG No data
1022301317_1022301319 -5 Left 1022301317 7:29105292-29105314 CCAGACTGTGGCAGCCATGGGTG 0: 1
1: 0
2: 0
3: 14
4: 192
Right 1022301319 7:29105310-29105332 GGGTGCTAGTTAATCTCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022301317 Original CRISPR CACCCATGGCTGCCACAGTC TGG (reversed) Intronic
900457221 1:2783164-2783186 CAGCCATGTCTGCCACAGACAGG - Intronic
901213374 1:7539215-7539237 CCCACATGGCTGCAACAGGCAGG + Intronic
902886437 1:19408131-19408153 CAGCCTTGGCTCCCACAGTGGGG - Intronic
902980381 1:20118466-20118488 TACCCTTGGCTGCCACTGACAGG + Intronic
904374154 1:30069262-30069284 CAGGCATGGCTCCCCCAGTCTGG - Intergenic
904820160 1:33237450-33237472 CAGCCATGGCTGCAACTGTGAGG - Intergenic
905451508 1:38060021-38060043 TACCCATGGCTGTCACTTTCAGG - Intergenic
908612822 1:65881358-65881380 ACCCCATGGCTGCCCCAGCCAGG - Intronic
909095837 1:71288093-71288115 CACCTATTGCTGGCACAGTAAGG - Intergenic
909190486 1:72542997-72543019 CAACCATGGTTGCCACAGCTCGG + Intergenic
910100275 1:83568289-83568311 CACCCAGGACAGCCAGAGTCAGG - Intergenic
911852192 1:102834069-102834091 AACCCATGGTTTCCACAGACAGG + Intergenic
912375987 1:109210340-109210362 CACAAAGGGCTGCCACAGTGAGG + Intergenic
917891465 1:179442467-179442489 AACCCATGGTTTCCACAGGCAGG - Intronic
919140034 1:193558933-193558955 CAACAATTGCTGACACAGTCAGG - Intergenic
919745725 1:201008200-201008222 CCTCCCTGGCTGCCACAGTCTGG + Intronic
922782441 1:228263896-228263918 CACCAAGGGCTGCCCCAGGCAGG - Intronic
924456067 1:244219740-244219762 CACCCATTGCTGCCACGAGCCGG - Intergenic
1063901560 10:10738035-10738057 CACCCAGGTCTGCCACAGGTGGG + Intergenic
1064704788 10:18060618-18060640 GGCCCATGGCTGCCATTGTCTGG + Intergenic
1064715348 10:18171347-18171369 CACCCATAACTGTAACAGTCAGG + Intronic
1067392974 10:45882734-45882756 AACTCATGGCTGCCCCAGGCAGG + Intergenic
1067550446 10:47230717-47230739 CACCCATCCCAGCCCCAGTCTGG - Intergenic
1067716184 10:48692717-48692739 AGCCCTTGGCTGGCACAGTCAGG - Intronic
1067861297 10:49851862-49851884 AACTCATGGCTGCCCCAGGCAGG + Intronic
1069717971 10:70532883-70532905 CACCCATGTCTCCCACAGTGGGG + Intronic
1070625806 10:78050205-78050227 GCCCCATGGCTGCCACAACCAGG + Intronic
1073509449 10:104034230-104034252 CACGGATGCCTCCCACAGTCGGG - Exonic
1076734322 10:132451979-132452001 CTGCGCTGGCTGCCACAGTCTGG + Intergenic
1076903146 10:133349812-133349834 CACCAGTGCCTGCCACAGTGGGG + Intronic
1077266569 11:1653686-1653708 CACACATGGGTGCTACAGCCAGG - Intergenic
1078571112 11:12458685-12458707 CACCCTGGGCTGCCACAGAGGGG - Intronic
1079037800 11:17036083-17036105 GACCCCTGGCAGCCACAGCCTGG + Intergenic
1079889086 11:26028146-26028168 GACACATGGCTTCCCCAGTCAGG - Intergenic
1083827426 11:65211475-65211497 AGCCCATGGCTGGCACAGGCAGG - Exonic
1085225944 11:74921302-74921324 CACAGATGGCCTCCACAGTCAGG + Exonic
1086419311 11:86622736-86622758 CAACGATGGCAGCCAGAGTCAGG - Intronic
1087805513 11:102551469-102551491 CACTCATGGCTACAACAGTTGGG + Intergenic
1091688512 12:2580373-2580395 CTCCCATTGCAGCCACAGCCTGG - Intronic
1093353288 12:18129903-18129925 CACCCATAGCTTCCTCAGTTGGG + Intronic
1093411417 12:18872737-18872759 CTTCCATGGCAGCCACAGTAAGG + Intergenic
1096081252 12:48834367-48834389 CACCAATGACAGCCACAGTGCGG + Exonic
1096771711 12:53939563-53939585 CTCCAATGGCTGGGACAGTCAGG + Exonic
1098945553 12:76585551-76585573 TTTCCATGGTTGCCACAGTCGGG + Intergenic
1099100855 12:78439080-78439102 CTCCCATGGCTGCCACTGCTGGG + Intergenic
1100745258 12:97638785-97638807 GACTCCTGGCTGCCACACTCAGG - Intergenic
1102163116 12:110785465-110785487 TGGCCATGGCTGCCCCAGTCAGG + Intergenic
1102308431 12:111824773-111824795 AACCCATGGTTTCCACAGGCAGG - Intergenic
1105616033 13:22013530-22013552 CTCCCATGGCTCTGACAGTCTGG - Intergenic
1106384234 13:29268509-29268531 CGAGCATGGCTGCCACAGACAGG - Intronic
1108004838 13:45935843-45935865 AACCCACAACTGCCACAGTCAGG + Intergenic
1110708655 13:78625717-78625739 CACAACTGGCTGTCACAGTCTGG + Intronic
1111930603 13:94509330-94509352 CACCAATGACTGCCACAGCCAGG - Intergenic
1112951368 13:105001147-105001169 CCTCCATGCCTCCCACAGTCAGG + Intergenic
1113969463 13:114177363-114177385 CACCCACAGCTGCCACCCTCAGG - Intergenic
1114980457 14:28157790-28157812 CACCCCTGCCTGCCACATTGTGG - Intergenic
1115000092 14:28411504-28411526 AACCCATGGTTTCCACAGGCAGG + Intergenic
1117413084 14:55468257-55468279 CACTCTTCACTGCCACAGTCTGG + Intergenic
1118141213 14:63085447-63085469 CACTCCTGGCTGCTACAGCCAGG + Intronic
1118765461 14:68906649-68906671 CACCCATGGCTGCTGCAGGAAGG + Intronic
1120609631 14:86624098-86624120 CTCTAATGGCTGCCCCAGTCTGG + Intergenic
1120781876 14:88492813-88492835 CTCCCATCACTGCCACACTCCGG + Intronic
1121405336 14:93716195-93716217 CACCTATGGCTGCCTTTGTCTGG - Intergenic
1122088708 14:99323886-99323908 CTCCCATGGTTGCCAGAGCCGGG - Intergenic
1122823429 14:104358499-104358521 CACCCATGGCTCCCAGTGCCTGG - Intergenic
1125708851 15:41767126-41767148 CACCTATAGCTGCCAAAGTTGGG + Exonic
1125762191 15:42104224-42104246 CACCCATGGCAGCTTCAGGCAGG - Intergenic
1126694592 15:51315218-51315240 CACCCAGGCCTGCTGCAGTCCGG + Intronic
1126695068 15:51318734-51318756 TAACCATGACAGCCACAGTCAGG - Intronic
1129976867 15:79830010-79830032 CTCCCATGTCAGCCACACTCTGG - Intergenic
1130719845 15:86375810-86375832 CACCCATGGCTCCCACACCTTGG - Intronic
1131083175 15:89554127-89554149 CCACCCTGGCTGCCACACTCTGG + Intergenic
1132562249 16:601474-601496 CACCCCTGGGTGCCAGACTCCGG + Intronic
1132860096 16:2066318-2066340 CACCAACAGCTGCCACAGCCTGG - Intronic
1133238527 16:4401327-4401349 CACGCATGGCTGGCAGAGGCGGG + Intronic
1136493072 16:30623543-30623565 AACCCATGGTTTCCACAGACAGG - Intronic
1138414062 16:56861241-56861263 CACCCTTGGCAAGCACAGTCAGG + Intergenic
1139089219 16:63623793-63623815 CCCCCATCGCAGCCACTGTCTGG + Intergenic
1140173878 16:72636062-72636084 CATTCATGTCTGCTACAGTCTGG - Intergenic
1143011697 17:3869601-3869623 CACCCAAGGGTGCAACTGTCGGG + Exonic
1145721043 17:27073050-27073072 CCCCCATGGCTGCCACCATGAGG + Intergenic
1146638090 17:34520772-34520794 CTCCCAGGGCTGGCACAGTCTGG + Intergenic
1150488174 17:65558501-65558523 CACCCCTGGCTGACACGGTGGGG + Exonic
1150523259 17:65891836-65891858 CACCAATTGTTGCCTCAGTCTGG + Intronic
1153760117 18:8322773-8322795 CCCCCATGGCTGCCACCATGAGG - Intronic
1156499337 18:37547262-37547284 CACCCAAGGCTGCTCCAGCCTGG - Intronic
1157506224 18:48228553-48228575 CACCCTTGGCAGCCACTCTCAGG - Intronic
1158938971 18:62389436-62389458 CCCCCATGGCTGCCCCACTGCGG + Exonic
1162030623 19:7915863-7915885 GTCCCATGGCTGCCTCAGCCTGG + Intergenic
1162076936 19:8194172-8194194 CCCCCATGTCTGCAACAGGCTGG - Intronic
1162595548 19:11626170-11626192 CACCCATGGTTTCCACAGGCAGG - Intergenic
1162998738 19:14352680-14352702 CCCCCACGGCCACCACAGTCAGG - Intergenic
1164305987 19:24004073-24004095 TTCCTGTGGCTGCCACAGTCCGG - Intergenic
1165014438 19:32870461-32870483 CATCCAGGGCTGCCAGGGTCTGG + Intergenic
1165935535 19:39386444-39386466 CTCCCAGGGCTCCCAGAGTCTGG + Intronic
1167097392 19:47381657-47381679 CACCCAGGGATGCCACACACTGG + Intronic
1167148259 19:47695063-47695085 CACCCATGGCCGCCACAGGTAGG + Exonic
1167883169 19:52479073-52479095 AACCCATGGTTTCCACAGACAGG - Intronic
925994957 2:9284691-9284713 CACCCATGGCAGCCACTGCAAGG - Intronic
930612146 2:53555019-53555041 CACCCACTGCTGCCACAGGGTGG - Intronic
930681554 2:54262149-54262171 CACCCCTGGCTGAAACACTCTGG - Intronic
932515119 2:72338788-72338810 TACCCAAGGCTGCTACAGACAGG + Intronic
933765536 2:85706143-85706165 CGGCCATGGCTGCCACAGGATGG + Intergenic
934734659 2:96683883-96683905 CCCCGATGGGTGCCACAGACTGG - Intergenic
934738813 2:96704360-96704382 CCCCCATGGCTGCCACTCACCGG - Intergenic
934860476 2:97760351-97760373 CACCCATGCCTGTCTCAGCCAGG - Intronic
936110696 2:109662084-109662106 CACCCATTTCTGCCACATGCAGG + Intergenic
936372356 2:111912773-111912795 CACCCTTGGCTGTCACACACTGG + Intronic
937589536 2:123596437-123596459 TACCCAAGGCTACAACAGTCAGG + Intergenic
937885254 2:126895082-126895104 CTCCCCTGGCTGTCAGAGTCTGG - Intergenic
938929768 2:136076439-136076461 AACCCATGGTTTCCACAGGCAGG - Intergenic
939084879 2:137707579-137707601 CACCCTTCACTCCCACAGTCTGG + Intergenic
940294777 2:152111082-152111104 CACCCTTGGCTGCAAGAGTCTGG + Intergenic
941314636 2:163977168-163977190 CACTCATGGCTGCATCACTCTGG - Intergenic
941374342 2:164708344-164708366 CCCCCATGCCTACCCCAGTCAGG - Intronic
943928437 2:193819214-193819236 CACCCCTGCTTGCCACACTCTGG - Intergenic
946031257 2:216706968-216706990 CAACCATGGCTTCCCCAGGCAGG - Intergenic
948653871 2:239464973-239464995 CACCGGTGCCTGCCACTGTCTGG + Intergenic
948712478 2:239833655-239833677 CACCCATGGCTGTCCCTGGCCGG + Intergenic
948764328 2:240211819-240211841 CAGCCATCTCTGCCACACTCTGG - Intergenic
1168804122 20:662793-662815 CAACCTGGGCTTCCACAGTCTGG - Exonic
1168891571 20:1298320-1298342 CAGCCATGGGAGCCACAGGCTGG - Intronic
1168905184 20:1397620-1397642 AACCCATGGTTTCCACAGGCAGG + Intergenic
1171297100 20:24027452-24027474 CGCCCATGGCTGCCACATCTGGG + Intergenic
1173263865 20:41460515-41460537 CAGCCATGGCTGGAACAGTTGGG - Intronic
1174558283 20:51412239-51412261 CCCCCATGACTGGCACACTCTGG + Intronic
1175748510 20:61478304-61478326 CACCCATTGCTGCTAGAGACGGG - Intronic
1177444282 21:21171587-21171609 CACCCTTGACTGCCACAGACTGG + Intronic
1178983756 21:37285845-37285867 CACCCACCCCTGCCACACTCTGG - Intergenic
1181102537 22:20551050-20551072 CACCCACGGCTGCCTCTGACAGG + Intronic
1184032532 22:41903398-41903420 CACACTTTGCTGCCACAGACAGG + Intronic
1184043164 22:41956546-41956568 CAGCCATGGCAGCTGCAGTCAGG + Intergenic
1184066282 22:42123643-42123665 CACCCTTGGCAGACACAGTAAGG + Intergenic
1184068750 22:42135795-42135817 CACCCTTGGCAGACACAGTAAGG + Intergenic
953804170 3:46053695-46053717 AACCCATGGTTTCCACAGGCAGG - Intergenic
953846057 3:46427335-46427357 AACCCATGGTTTCCACAGGCAGG + Intergenic
954139628 3:48598227-48598249 CCCCCAGTGCTTCCACAGTCAGG - Intergenic
955033545 3:55243855-55243877 CAGGGATGGCTGTCACAGTCAGG - Intergenic
956453927 3:69402087-69402109 CACCCATGACTGCAATAGTTGGG - Intronic
961752420 3:129104671-129104693 TGCCCATCGCTGCCTCAGTCGGG + Intronic
963347548 3:144113252-144113274 AACCCATGGCTTCCATAGTGAGG - Intergenic
963596243 3:147329237-147329259 CACCAATGGCAACCACAGTTTGG + Intergenic
967735261 3:192945124-192945146 CAGCCATTGCTGCCACAACCAGG + Intergenic
968606180 4:1536779-1536801 CACAGGTGGCTGCCACAGCCGGG + Intergenic
969123009 4:4923614-4923636 CACCCATCACTGCCACAATTGGG + Intergenic
969611071 4:8228085-8228107 CCACCATGGCTGCCACGGCCCGG + Exonic
969662185 4:8536773-8536795 CATCCTTTGCTGCCTCAGTCAGG + Intergenic
971825303 4:31614075-31614097 CAACCTTGGGTGCCAGAGTCTGG + Intergenic
973328808 4:48891421-48891443 CAGCCATGGCAGCCCCACTCTGG - Intronic
975379686 4:73684782-73684804 CACCCAAGGCTTCCTCAGTTGGG - Intergenic
975737883 4:77399395-77399417 AACCCATGGTTTCCACAGACAGG - Intronic
977251339 4:94692722-94692744 CACCCATTGCTGCTCCAATCGGG + Intergenic
979146143 4:117251310-117251332 CACCCATGGCTGGAACAGCTGGG - Intergenic
981095184 4:140771980-140772002 CACCCAAGGGTGCCTCAGTTGGG + Intergenic
982377486 4:154709164-154709186 CACACATGTATGCCACACTCAGG - Intronic
985202698 4:187500859-187500881 CACCCATGTTTTCCATAGTCCGG + Intergenic
988325701 5:29764127-29764149 AACTCATGGATGTCACAGTCAGG + Intergenic
989735137 5:44694413-44694435 CACCCCTGGATGCCACTGTAGGG + Intergenic
990770718 5:59241344-59241366 CAGCCATGGCTGGTACAGGCGGG - Intronic
992417895 5:76570213-76570235 CAGCCATGGTTGCCAAAATCTGG + Intronic
993309675 5:86313770-86313792 CAGCCATGGCTGCTGCAGTTAGG - Intergenic
999553909 5:152720517-152720539 CCCCCAAGGCTGCCACAGTGAGG - Intergenic
1001305262 5:170567798-170567820 CACTCTTGGCCCCCACAGTCAGG + Intronic
1001716529 5:173820922-173820944 CACCCATGGTTGCAACTGTTTGG - Intergenic
1003287311 6:4745931-4745953 TACCCATGGCTCCCACATTCTGG - Intronic
1005485523 6:26295546-26295568 AACCCATGGTTTCCACAGACAGG - Intergenic
1005955862 6:30662958-30662980 CACTCATGGCAGCCACTCTCCGG + Exonic
1006219774 6:32478786-32478808 AACCCATGGTTCCCACAGACAGG - Intergenic
1006229050 6:32566533-32566555 AACCCATGGTTCCCACAGACAGG - Intronic
1013664968 6:112338492-112338514 CACCCAAGGCTGGCCCAGTTAGG + Intergenic
1016698780 6:147030453-147030475 CGCACATGGCTGGCACAGCCTGG - Intergenic
1022301317 7:29105292-29105314 CACCCATGGCTGCCACAGTCTGG - Intronic
1022468176 7:30665309-30665331 CACCCATGGTGGCCACAGTTGGG + Intronic
1022903610 7:34834598-34834620 CACCAAAGGCTGTCACAGGCGGG + Intronic
1023797949 7:43809374-43809396 AACCCATGGTTCCCACAGGCAGG + Intergenic
1023852728 7:44159213-44159235 CAGCCGTTGCTGCCACAGGCGGG - Exonic
1029234183 7:99099590-99099612 CTCCCACCGCTGCCACAGTGGGG - Intronic
1031979952 7:128118228-128118250 CACCCACGGGTGACACATTCTGG - Intergenic
1032589983 7:133183037-133183059 CTGGCATGGCTGCCACAGGCTGG + Intergenic
1033771812 7:144560640-144560662 CACCCATCGCTGCCACCAGCTGG + Intronic
1034254261 7:149715691-149715713 CATCCATGGCTGCCTCGGACTGG - Intronic
1035931312 8:3783392-3783414 GACCCACGGCTGGCACAGTCAGG + Intronic
1037491364 8:19399953-19399975 CATCCATGGCAGCCTCCGTCCGG - Intergenic
1038732327 8:30138704-30138726 AACCCATGGCAGCCACGGCCAGG + Exonic
1040294847 8:46143868-46143890 CCCCCATGGCTGACTCAGGCGGG - Intergenic
1040336439 8:46418443-46418465 CACCCAGGGCTTTCCCAGTCAGG + Intergenic
1049443001 8:142617690-142617712 CAGCCAGGGCTGAGACAGTCTGG - Intergenic
1050098618 9:2094492-2094514 CAGCCATGCCTTCCACATTCAGG + Intronic
1053546363 9:39027104-39027126 CATCCCTGGCTGGCACAGCCAGG + Intergenic
1053810679 9:41848766-41848788 CATCCCTGGCTGGCACAGCCAGG + Intergenic
1054619914 9:67338673-67338695 CATCCCTGGCTGGCACAGCCAGG - Intergenic
1057695699 9:97321725-97321747 CAGCCATGGGAGCCACAGTTAGG + Intronic
1058529003 9:105887668-105887690 GGCCCATGGCTCCCAAAGTCAGG - Intergenic
1059536563 9:115086392-115086414 CCCCAATGACTGTCACAGTCGGG - Exonic
1062044868 9:134420298-134420320 CCCCCAGGCCTGCCACAGCCAGG - Intronic
1062376479 9:136264050-136264072 CACGCAGGGCTGGCACAGGCTGG + Intergenic
1185747275 X:2583582-2583604 CACCGGTGGCGGCCACAGGCGGG + Intergenic
1188663528 X:32790608-32790630 CACCCATGGCTGCAACTGCTGGG + Intronic
1189198789 X:39174296-39174318 CAGCTAGGGCTGCCACAGCCAGG + Intergenic
1195962121 X:110397071-110397093 CTCCCAGAGCAGCCACAGTCTGG + Intronic
1200071987 X:153533777-153533799 CAGCCATGGCTGCACCAGTCAGG + Intronic
1200181968 X:154156133-154156155 CAGACATGGCTGCCTCAGGCTGG - Intronic
1200187617 X:154193247-154193269 CAGACATGGCTGCCTCAGGCTGG - Intergenic
1200193266 X:154230387-154230409 CAGACATGGCTGCCTCAGGCTGG - Intronic
1200199021 X:154268191-154268213 CAGACATGGCTGCCTCAGGCTGG - Intronic
1201495244 Y:14585940-14585962 CAACCAAGGCTTCCACAATCTGG - Intronic
1201741822 Y:17332371-17332393 AACCCATGGTTTCCACAGGCAGG + Intergenic