ID: 1022301523

View in Genome Browser
Species Human (GRCh38)
Location 7:29106641-29106663
Sequence AACAGGGAAGAGGGTAGAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 566
Summary {0: 1, 1: 0, 2: 1, 3: 49, 4: 515}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022301523 Original CRISPR AACAGGGAAGAGGGTAGAAT TGG Intronic
900434291 1:2620936-2620958 CAATGGGAAGAGGGTATAATGGG - Intronic
901069909 1:6511907-6511929 CACAGGGAAGAGAGTAGCACGGG - Intronic
901680995 1:10912803-10912825 GACAGGGAAGAGGGAAGGAAGGG - Intergenic
902638736 1:17752266-17752288 AACAGGGAGGCAGGAAGAATAGG + Intergenic
902733541 1:18385323-18385345 AACAGAGAAGAGGGGAGGAGAGG + Intergenic
903011314 1:20332653-20332675 AGCAGGGAAGAGGGGACAGTAGG - Intronic
903579566 1:24360722-24360744 TACAGGGATGAGGGTAGATTTGG - Intronic
903791501 1:25896322-25896344 AGCAGGGAAGAGGGGAGGCTAGG + Intronic
904013966 1:27406309-27406331 AAGAGGGAAGAGGGCACACTTGG + Exonic
904019930 1:27456025-27456047 AACAGTGAAAAGGTTAGGATGGG + Intronic
904431950 1:30470069-30470091 AATATGGAAGAGCTTAGAATGGG - Intergenic
904851936 1:33466185-33466207 AAAAGGGAAGGGGATAGAGTGGG + Intergenic
904908179 1:33913688-33913710 AACTGGGAAGGGGGTAGGCTTGG - Intronic
905774874 1:40662013-40662035 CACAGGGAAAAGGGTAGGAGAGG + Intronic
905866038 1:41377374-41377396 ACCAGGGAGGAGGCTAGAGTAGG - Intronic
907664557 1:56423378-56423400 AACAGGGAAAAAGAGAGAATGGG + Intergenic
908919715 1:69174698-69174720 ATCAGGGAAAATGGCAGAATGGG - Intergenic
909493275 1:76248733-76248755 AAGAAGGAAAAGGGTAGAAGAGG - Intronic
909557641 1:76971565-76971587 AACAGGGAAAAATATAGAATTGG - Intronic
909801838 1:79819772-79819794 AACAGGAAAGAGTGAAGATTTGG + Intergenic
910372215 1:86528337-86528359 AACTGGGGAGAGGTGAGAATGGG - Intergenic
910375199 1:86561184-86561206 TACAGGGAAGAGGTAAGATTGGG - Intronic
910935415 1:92482464-92482486 AACAGAGAACAGGGCAGAACGGG - Intronic
911428628 1:97755106-97755128 AGCAGGAAAGAGGGGAGAACCGG - Intronic
911759520 1:101599819-101599841 AACAGGGAAGAAGGAAATATGGG + Intergenic
911799288 1:102113682-102113704 ACCAGGAAAGAGTGTAAAATAGG - Intergenic
911967217 1:104384275-104384297 AACAGGAAAGAGGGAAATATGGG - Intergenic
912069588 1:105792913-105792935 AAAAGAGAAGAGGGAAGAAATGG - Intergenic
912498635 1:110107303-110107325 ACCAGGGAAGAAGGTAGAAAAGG - Intergenic
913001073 1:114581403-114581425 AATAGGGACCAGGGTAGAAGTGG + Intronic
913049281 1:115102703-115102725 CACAGGGAGGAGAGAAGAATCGG - Intergenic
913328155 1:117645819-117645841 GACAGGGAAGAGTGGAGAACTGG + Intergenic
913960981 1:143337963-143337985 AACAGGGCAGAGGTTGGAAGTGG + Intergenic
914123811 1:144802826-144802848 AACAGGGCAGAGGTTGGAAGTGG - Intergenic
914439681 1:147693488-147693510 AAGGAGGAAGTGGGTAGAATTGG + Intergenic
914683760 1:149959857-149959879 AACAGTGAATAAGGTGGAATAGG - Intronic
915159473 1:153907487-153907509 AACTGCGGAGAGGGGAGAATGGG + Intronic
915327610 1:155088761-155088783 AACAGGGAAGAGTGTGGGGTGGG + Intergenic
916068357 1:161154469-161154491 AACAGTGAAGAGTGAAGAAGGGG - Intronic
917134335 1:171774725-171774747 AACAGGAAGGAGGGGAAAATAGG + Intergenic
917448240 1:175124776-175124798 AAGAGGGAAGAAGGGAGAACTGG - Intronic
917884531 1:179370340-179370362 AACAGGGAATAGGAGAGTATAGG - Intronic
918009181 1:180570569-180570591 ATCAGGGCAGATGGTAAAATTGG + Intergenic
918121830 1:181547143-181547165 AACAGGGCAGAGGGGGCAATGGG - Intronic
918125182 1:181577443-181577465 AACAGGGCAGAGAGGAGAAAGGG + Intronic
918148211 1:181776284-181776306 CCCAGGGAAGAGGCTGGAATTGG + Intronic
918394186 1:184097026-184097048 ATCAGGGAGGAGGGCAGAAAAGG + Intergenic
918899152 1:190390211-190390233 AAAAGGAAAGAGGGTGGGATGGG + Intronic
919863336 1:201758166-201758188 AAGAGGAAAGATGCTAGAATGGG + Intronic
920066000 1:203270254-203270276 CACAGGGAAGAGGTTGGACTGGG - Intronic
920339175 1:205264997-205265019 CACAGGGAAGAGAATAAAATGGG + Intronic
920618602 1:207521607-207521629 AAAAAGGAAGAGGGCAGATTTGG - Intronic
920644148 1:207785983-207786005 AATAGGGAATAGGGTAGAGAAGG - Intronic
922027807 1:221768183-221768205 AAAAGTGAAGAGGGAAGAAAGGG - Intergenic
922578450 1:226679261-226679283 AAAAGGGAAGAGGGGAGACAGGG - Intronic
922999344 1:229993808-229993830 AACAGAGAAGTGGTTAGAACAGG + Intergenic
923105399 1:230850208-230850230 AACAGGGAAGAGGGTAACTCTGG + Intronic
923776944 1:236987256-236987278 AGCTGGGAATAGGGGAGAATGGG - Intergenic
924578694 1:245303990-245304012 AGCAGGGAAGATGGTGGAGTTGG - Intronic
924814582 1:247430566-247430588 AACAAGTGAGAAGGTAGAATGGG + Intronic
1062931041 10:1352875-1352897 AACAGGGAAGAAGGAAATATGGG - Intronic
1064192517 10:13220002-13220024 AGCAGGGAAGAGGCAAGAACAGG + Intergenic
1064506411 10:16035062-16035084 AAGAGGGCAGAGGAAAGAATTGG + Intergenic
1064872964 10:19960535-19960557 AAGAGGGTAGAGGACAGAATAGG - Intronic
1065008807 10:21403521-21403543 ATTATGGAAGAGGGTAGAAGTGG - Intergenic
1065245612 10:23753995-23754017 AACAGGGAGGAGGGGACATTGGG - Intronic
1065888772 10:30102464-30102486 AAAATGTAAGAGGGTAGACTGGG - Intronic
1066048507 10:31615161-31615183 CATAGGGAAGAGGGAAGAAAGGG + Intergenic
1067816071 10:49477665-49477687 AGCAAGGAGGAGGGTAGAAGAGG - Intronic
1068257803 10:54536638-54536660 AAAAGGGGAGAGGGTGGAAGAGG - Intronic
1068846005 10:61675206-61675228 AACAGGGGAGAGGGGAGAGATGG - Intronic
1069088871 10:64175429-64175451 AAGAGGGGAAAGGGGAGAATGGG - Intergenic
1069478450 10:68758397-68758419 AACTGGGAAGAGGCCAGAAGCGG + Intronic
1070509484 10:77147489-77147511 GAAAGGGATGAGGGAAGAATGGG - Intronic
1072582070 10:96748305-96748327 AAAGGGGAAGTGGCTAGAATGGG - Intergenic
1073006734 10:100330410-100330432 AAGAGGGGAGAGGGGAGAATAGG + Exonic
1073146246 10:101284018-101284040 AAAAGGGAAGAGATTAGAAGGGG + Intergenic
1073281032 10:102354291-102354313 AACAGGGAACAGGGCAGGAATGG - Intronic
1073541621 10:104319860-104319882 CAGAGGGAGGAGGGTATAATGGG - Intronic
1073583313 10:104686678-104686700 AGGAGGGAAGAGGGAAGGATGGG - Intronic
1073826600 10:107330987-107331009 AAAAGGGAAAAGGGTGGGATGGG - Intergenic
1075308604 10:121391244-121391266 AACAGTGAACCAGGTAGAATTGG - Intergenic
1075581149 10:123619549-123619571 AAAAGGGAGGAGGGGAGAAGGGG + Intergenic
1077771715 11:5226476-5226498 AACAGGGTACAGTTTAGAATGGG - Intronic
1078155605 11:8797498-8797520 AAGAGGGAAGTGGGAAGAAGGGG - Intronic
1078332963 11:10441034-10441056 AAGAAGGAGGAGGGTGGAATGGG + Intronic
1078565223 11:12408719-12408741 AGCAGTGAATAGGGTAGACTAGG + Intronic
1078702505 11:13700730-13700752 AACAGGGAAGAGGCAAAAAGTGG + Intronic
1079053891 11:17188438-17188460 ACCAGGGAAGAGAGTAGTGTTGG - Intronic
1079531077 11:21454457-21454479 AACAGCAGAGAGGCTAGAATGGG - Intronic
1079699821 11:23530893-23530915 GACAGGGGAGAGGGGAAAATGGG - Intergenic
1080901199 11:36493369-36493391 AAGAGGGAACAGTGTAGAACAGG + Intronic
1080955836 11:37094614-37094636 AACAGGGAAGAGGGTACAGGAGG - Intergenic
1081160018 11:39738709-39738731 AACAGGGAAGAAGGAAATATGGG - Intergenic
1082231476 11:49773258-49773280 AAAAGGGAAGAGGGTAGGAAGGG - Intergenic
1083201674 11:61124586-61124608 AAGGGGGAAGAAGGCAGAATGGG - Intronic
1083534666 11:63456844-63456866 AACAGGGAAGAAGGAAATATGGG - Intergenic
1083610684 11:64002828-64002850 AAGAGGGAAGAGGGAAGGAAGGG - Intronic
1083729642 11:64645847-64645869 GAGAGGAAAGAGGGTAGAAATGG - Intronic
1085033307 11:73285713-73285735 AACAGGACAGAGGGTAGCAAAGG + Intronic
1085570503 11:77554181-77554203 AACAGGAAAGAGGGAAATATGGG - Intronic
1086058979 11:82681212-82681234 AAGAGTGAAGAGGGGAGAGTAGG + Intergenic
1086510495 11:87552467-87552489 AACAGAGAAGAGGATTGAACTGG + Intergenic
1087468810 11:98545744-98545766 AGCTGGGAGGAGGGTAGACTGGG + Intergenic
1087570912 11:99927205-99927227 AACAGGGATAAAGATAGAATAGG - Intronic
1087811871 11:102616847-102616869 ACCAGGGAAGAGGCGATAATTGG + Exonic
1088560085 11:111105853-111105875 AACAGTGAAGAAGGTAGCCTGGG - Intergenic
1088847163 11:113678244-113678266 AAGAGGGAAGAGGACAGAAGGGG + Intergenic
1089699150 11:120234061-120234083 AGAAGGGAAGAGGGTAAAAGCGG + Intergenic
1089897538 11:121946765-121946787 AGCAGGGAAGAAGGTAAAACAGG + Intergenic
1089983738 11:122793867-122793889 GAGACCGAAGAGGGTAGAATAGG + Intronic
1090464582 11:126922882-126922904 ATCTGGGAAGAGGGTAGACATGG - Intronic
1091198257 11:133750149-133750171 GACAGGGAAAAGGGTAGACATGG + Intergenic
1091721012 12:2813687-2813709 GATAGGGCAGAGGGTAGAAGGGG - Intronic
1091831184 12:3552263-3552285 AAGAGAGAAGAGGGAAGAAATGG + Intronic
1092140193 12:6178445-6178467 AGAAGGGGAGAGGGTGGAATAGG - Intergenic
1092521418 12:9277319-9277341 AGAAAGGAAGAGGGCAGAATGGG + Intergenic
1093552556 12:20432295-20432317 AAAAGTGAAGAGGGTGAAATGGG + Intronic
1093767472 12:22981837-22981859 AACAGGGAAGGGGTAAGAACTGG - Intergenic
1094207882 12:27859794-27859816 AACTCTGGAGAGGGTAGAATAGG - Intergenic
1094551877 12:31460282-31460304 AGCAGAGAAGCAGGTAGAATGGG + Exonic
1095658213 12:44696093-44696115 AACAAGAAAGAGGGTAGAAGAGG + Intronic
1096002387 12:48140651-48140673 AACAGGGAGGAGGTTAGTAAAGG - Intronic
1096838666 12:54368133-54368155 AACAGGAAAGAGAGGGGAATGGG - Intergenic
1096838683 12:54368198-54368220 GACTGGGAAGTGGGTAGAGTGGG + Intergenic
1098419776 12:70282680-70282702 AAGAGGGCAGAGGAAAGAATGGG - Intronic
1098750716 12:74291083-74291105 AAAAGGGAAGGGTGTATAATTGG + Intergenic
1099025393 12:77459280-77459302 TAAAGGGAAGATGGTCGAATAGG + Intergenic
1099278298 12:80607044-80607066 CAAGGGAAAGAGGGTAGAATGGG + Intronic
1099477213 12:83122063-83122085 AGCTGGGAAGCGGGTAGCATGGG - Intronic
1099477226 12:83122147-83122169 AGCTGGGAAGCGGGTAGCATGGG - Intronic
1100705498 12:97196203-97196225 GATAGGGAACATGGTAGAATAGG - Intergenic
1101567518 12:105922248-105922270 AACAGGGAAGAGGTTGGCAGGGG + Intergenic
1102428813 12:112865554-112865576 CACAGGGAAGAAGGGAGAAGAGG - Intronic
1102595472 12:113989145-113989167 AGCAGGGATGAGGGAAGACTTGG + Intergenic
1102952753 12:117041168-117041190 ATCAGGGAGGAGGGCAGAGTGGG + Intronic
1103012241 12:117466264-117466286 AGCAGAGAAGAGGGAAGAAAAGG + Exonic
1103288834 12:119827003-119827025 AAGAGAGGAGAGGGAAGAATAGG - Intronic
1104707870 12:130961170-130961192 AACAGGGAAGGAAGAAGAATAGG + Intronic
1106256113 13:28023226-28023248 AACAGTGAACAGGGGAGAAAAGG + Intronic
1107213288 13:37884978-37885000 AAAAGGACAGAGGGTACAATGGG + Intergenic
1107794319 13:44034384-44034406 AAAAGGGAAGAGGGTAAAAGAGG + Intergenic
1108364970 13:49701535-49701557 ACCAGGGAACAGGGAAAAATAGG + Exonic
1108447806 13:50526863-50526885 GAGAGGGAAGAGGGGAGAAGGGG + Intronic
1109244172 13:59932703-59932725 AGCAGTGAAGATGGTAGAAGAGG - Intronic
1109769380 13:66951028-66951050 AGCAAGGATGAGGGTAGGATGGG - Intronic
1112462362 13:99614095-99614117 AACAGGGAGGAGGATGGAGTTGG + Intronic
1114779466 14:25521899-25521921 AACAGGGATGTGTGGAGAATAGG - Intergenic
1115302388 14:31899182-31899204 AACAGGGAAGAGAATGGAATTGG + Intergenic
1115917837 14:38336896-38336918 AACACGGAGGAGGGTATAATGGG - Intergenic
1116188887 14:41637150-41637172 AACAAGAAAGAGGGGAGAATTGG + Intronic
1116216304 14:42021779-42021801 GGCAGGGAAGAGGCTAGAACAGG + Intergenic
1116349868 14:43847388-43847410 AACAGGAAAGAGGGGTCAATGGG + Intergenic
1116375838 14:44199553-44199575 AGGAGGGAAGAGGGAAGAAAGGG + Intergenic
1117748044 14:58891502-58891524 GACAGGGAAGAGTGTGGATTGGG - Intergenic
1118380427 14:65213544-65213566 CACAGGGAGGAGGGTATAATGGG + Intergenic
1119371080 14:74143935-74143957 AACTGGAAAGAGGGGAGAAGAGG - Intronic
1119976278 14:79027833-79027855 AGAGGGGAAGAGGGTAGAAAAGG - Intronic
1120149604 14:81018590-81018612 TACAGGGAACAGGGAAGAAAAGG + Intronic
1120909822 14:89656252-89656274 TACAGGGAAGGGTGAAGAATTGG - Intergenic
1121088060 14:91161726-91161748 AATAGGGAAGGGGCTACAATGGG + Intronic
1121686918 14:95842563-95842585 AAAAGGAAGGAGGGAAGAATTGG - Intergenic
1122441377 14:101734519-101734541 AACAGGGAAAAGGGAAGAACAGG + Intergenic
1202940869 14_KI270725v1_random:143869-143891 AACAGGGCAGAGGGCAGAGGAGG + Intergenic
1124410812 15:29435073-29435095 GATAGGGAAGAGGGGAAAATGGG - Intronic
1126257482 15:46644812-46644834 GACAGGGAATAGGGTAGACATGG - Intergenic
1126557179 15:50002383-50002405 AACAGGGAAGAGGGAGGGTTTGG - Intronic
1126946824 15:53830851-53830873 AACAGGGAGGAGAAGAGAATAGG + Intergenic
1127901257 15:63342614-63342636 AAAAGGGAGGAGGGTATAATGGG + Intronic
1128039638 15:64559936-64559958 AACAGAGAAGGGAGTAAAATAGG + Intronic
1128150363 15:65359652-65359674 TTCAGGGAAGAGAATAGAATAGG + Intronic
1128570828 15:68731567-68731589 AACAGGGAAGAGGGAGGAAGAGG + Intergenic
1129629379 15:77241430-77241452 AACAGGAATGATGGTAGTATAGG - Intronic
1129711730 15:77823832-77823854 ATCAGAGAAGAGGGTGGAAGTGG - Intergenic
1129989384 15:79948945-79948967 AACAGGGAAGAGAGAAAAACTGG + Intergenic
1130774020 15:86958231-86958253 AAAATGAAAGATGGTAGAATGGG + Intronic
1130972807 15:88747308-88747330 AACAGGGTTGAGGGTTGAAAGGG - Intergenic
1131016128 15:89059139-89059161 AACATGGAAGAGGGCATGATGGG - Intergenic
1131162868 15:90119725-90119747 AACATGAAAGATGGGAGAATTGG - Intergenic
1131313256 15:91309811-91309833 GGGAGGGAAGAGAGTAGAATTGG - Intergenic
1134114952 16:11541110-11541132 GGCTGGGAAGAGGGGAGAATGGG - Intergenic
1135152580 16:20021917-20021939 TACAGGGAAGACGGGAGCATAGG - Intergenic
1136617695 16:31408651-31408673 AGCAGGGAGGAGGGTAGCCTGGG + Intronic
1136987955 16:35129295-35129317 TACAGGGAAGATGTTAGAATTGG - Intergenic
1137016268 16:35378608-35378630 AACAGTGAAGTGGGATGAATTGG - Intergenic
1137396760 16:48121488-48121510 CACTGGGAAGAGGATAGAATCGG - Intronic
1138163714 16:54780056-54780078 AAGAGGGAGGAGGAAAGAATAGG - Intergenic
1138742270 16:59324513-59324535 ACTAGGGAAGAGGGCAGAAGAGG + Intergenic
1139005354 16:62563695-62563717 AGCAGCGTAGAAGGTAGAATGGG + Intergenic
1139107701 16:63847992-63848014 GACAGGGAAGAGTGTGGAAAAGG - Intergenic
1139293230 16:65876658-65876680 AACTGGGAGGAGAGTGGAATGGG + Intergenic
1140298703 16:73735409-73735431 GACTGGGGAGAGGGGAGAATGGG - Intergenic
1140828034 16:78725932-78725954 AAAAGGGAAGAGGAAAGAAAAGG - Intronic
1141051041 16:80763938-80763960 AATAGGGAAGGGGGTAGAGAGGG + Intronic
1144150347 17:12437076-12437098 CAAAGGGATGAGGGTAGATTAGG - Intergenic
1144169553 17:12646793-12646815 ACCAGGGCAGAGGGTTAAATAGG - Intergenic
1148124650 17:45230539-45230561 ACAAGGGGAGAGGGGAGAATGGG - Intronic
1148748550 17:49931703-49931725 CACAGGGAAAAGGGTAGACAGGG + Intergenic
1149710639 17:58739026-58739048 AGCTGGGGAGAGTGTAGAATGGG - Intergenic
1150343488 17:64387120-64387142 AGCAGGGAAGAGGATGGAAAAGG + Intronic
1151264393 17:72943037-72943059 AACAGGGAAAATGGGAGAAAGGG + Intronic
1151426931 17:74036978-74037000 AAAAGGCAAGAGGTCAGAATAGG + Intergenic
1152790861 17:82278750-82278772 AAGTGGGAAGAGGGGAGAAAGGG + Intergenic
1152838128 17:82548567-82548589 AACAGGGCAAAGGATGGAATGGG - Intronic
1152913046 17:83016506-83016528 AGGAGGGAAGAGGGCAGAAGAGG + Intronic
1153584100 18:6603413-6603435 AAGAGGGAAGAGTGTAGGGTTGG + Intergenic
1153597327 18:6740976-6740998 AACATGGAAGAGGGGAGAACTGG + Intronic
1153734227 18:8047715-8047737 TAGAGGGAAGAGGGTAAGATGGG + Intronic
1154368889 18:13739484-13739506 AACAGGGAAAAGGGCAGGCTGGG + Intronic
1154409086 18:14126294-14126316 AATAGGGAAGTGGCTAAAATAGG - Intronic
1154937922 18:21079557-21079579 AAGAGTGAAGAGGGGAGAGTAGG + Intronic
1155100970 18:22609427-22609449 AACAGAGAACAGGGGAGAAAGGG + Intergenic
1155150449 18:23118736-23118758 AACATGTAAGAGTTTAGAATAGG + Intergenic
1155238094 18:23841576-23841598 AAAAGGGACAAGGGTATAATAGG + Intronic
1155297978 18:24402766-24402788 AACAGGAAAGGGGGTAGTAATGG - Intergenic
1155422740 18:25672773-25672795 AACAGGGACGAGGATGGAGTGGG - Intergenic
1155941801 18:31807735-31807757 AACAGGGAAGAGGGAAATGTGGG - Intergenic
1156281377 18:35642739-35642761 ACCAGGGAAGAGGGGGCAATAGG - Intronic
1157719842 18:49915287-49915309 ATCTGTGAAGAGGGGAGAATAGG - Intronic
1160543737 18:79639294-79639316 CAGAGGGAGGAGGGTAGAATGGG - Intergenic
1162286978 19:9746120-9746142 AACAGGAAAGAGGGAAATATGGG - Intergenic
1163395804 19:17060390-17060412 AAGAGAGTAGAGGGTAGAATGGG - Intronic
1164081103 19:21862102-21862124 AACAGGAAAGAGGGAAATATGGG - Intergenic
1164322147 19:24158935-24158957 AATAGGGAAGAAGGAAGAAAGGG - Intergenic
1164976440 19:32576175-32576197 CAGAGGGAAGAGGGTAAAAGTGG - Intergenic
1165263060 19:34637136-34637158 AGGAGGGAAGGGGGCAGAATTGG + Intronic
1165342318 19:35221893-35221915 GAAAAGGAAGAGGGAAGAATAGG + Intergenic
1166011338 19:39944906-39944928 AAAAAGGAAGAGGGTACAGTGGG + Intergenic
1166875360 19:45893642-45893664 GACAGGGAAGATGGGAGATTGGG + Intronic
1167004423 19:46766465-46766487 AAAAGAGAAAAGGGTAGAATAGG + Intronic
1167199261 19:48052902-48052924 AACAGGCAGGAGGGTTGCATGGG - Intronic
1167757389 19:51421360-51421382 AAAAGTGAAGAGGGGGGAATGGG - Intergenic
925211979 2:2057259-2057281 GAAAGGGAAGAGGGTGGACTTGG - Intronic
925607863 2:5677228-5677250 AACAGGACAGAGAGTAAAATGGG + Intergenic
925806853 2:7659081-7659103 AACATGGATTAAGGTAGAATAGG + Intergenic
926119896 2:10236209-10236231 AAGAGGGAAGAGGGTGGGAAGGG - Intergenic
926283979 2:11472895-11472917 GTAAGGGGAGAGGGTAGAATTGG - Intergenic
926404403 2:12536205-12536227 AAGAGGAAAGATGGTAGAATGGG - Intergenic
926730523 2:16032705-16032727 AACAGGGAGGAGGTTGGCATAGG + Intergenic
927033985 2:19152558-19152580 GGCAAGGAAGAGGGTAAAATGGG - Intergenic
927579203 2:24226222-24226244 AACAGGGAAAAGGTGAGAAATGG - Intronic
927863259 2:26573616-26573638 AACTGGGAAGACGGAGGAATTGG - Intronic
928193542 2:29195837-29195859 TACAGGGAAGAGGAGAGCATCGG + Intronic
928429644 2:31206670-31206692 AACAAGGAAAAGGGGAGAATGGG - Intronic
928445595 2:31331155-31331177 AAGAGGGAAGAGGGAAGCAGAGG + Intergenic
929046340 2:37794216-37794238 AAAAGGGGAGAGAGTAGCATGGG + Intergenic
929413448 2:41723115-41723137 TAGAGGGAGGAGTGTAGAATTGG + Intergenic
930367431 2:50458243-50458265 GACAGTGAATAGAGTAGAATAGG + Intronic
930492553 2:52093581-52093603 AGGAGAGAAGAGGGAAGAATGGG - Intergenic
930579042 2:53187478-53187500 AACAGAGAAGAGGTTTGAAAGGG + Intergenic
930724572 2:54670221-54670243 AACAGGCAAGAGGTTAGGTTTGG + Intronic
931106205 2:59059141-59059163 ACAAGGGAATGGGGTAGAATTGG - Intergenic
931267673 2:60674826-60674848 AAGAGGGAAGAGGGAAGCAGAGG - Intergenic
931345630 2:61443136-61443158 GACAGGGGAAAGGGAAGAATAGG + Intronic
931420447 2:62122286-62122308 AACATTGAACAGGGTAGAATGGG - Intronic
931761395 2:65420294-65420316 AACACGGAGGTGGGTACAATGGG - Intronic
932777543 2:74537048-74537070 AACATGGAAGGGGGAAGAAGAGG - Intronic
933157753 2:78993547-78993569 TACGGAGAAGAGGGGAGAATGGG - Intergenic
933582361 2:84142048-84142070 TACAGGGAAGTGGGAAGAAAGGG - Intergenic
933594536 2:84269526-84269548 AAAAGGGGAGAAGATAGAATAGG - Intergenic
934869641 2:97851306-97851328 AAGAAGGCAGAGGGTAGAACGGG - Intronic
935548292 2:104423950-104423972 AACAGAGAAAAGGGAGGAATTGG - Intergenic
935973603 2:108555704-108555726 ATAAGGGCAGAGAGTAGAATTGG + Intronic
937502405 2:122493984-122494006 GACAGGGAAGAGGGGAGGATGGG - Intergenic
937622779 2:124008102-124008124 AAAAGGGAATAGGAAAGAATGGG - Intergenic
938306909 2:130262785-130262807 AACAGGGAAGAGGTAATTATGGG - Intergenic
939546151 2:143556164-143556186 AAAAGAGCAGTGGGTAGAATAGG - Intronic
939700665 2:145386837-145386859 AGCTGGAAAGAGGATAGAATGGG - Intergenic
939902832 2:147870725-147870747 AAAAGGGAAGAAGGAAAAATGGG - Intronic
940922304 2:159322407-159322429 TACTGGGAAGAGGGAGGAATGGG - Intronic
941103702 2:161327204-161327226 AGCTGGGAAGAGGAGAGAATAGG + Intronic
941422979 2:165306060-165306082 AACAGGAAGGAGGAAAGAATTGG + Intronic
941745443 2:169081901-169081923 GACATGGAAGTGGGTAGGATGGG + Intronic
941833073 2:169983673-169983695 TACAGGGAGGAGTGGAGAATTGG + Intronic
941885919 2:170527220-170527242 AAGAAGGCAGAGGGTAGGATGGG + Intronic
942903328 2:181149547-181149569 AACAGTGAAGAAGGTATAAGAGG - Intergenic
943657247 2:190522602-190522624 AAAAGGGAGGAGGGCATAATGGG - Intronic
944068775 2:195647037-195647059 AAAATGGAAGAGGGAAGAAGAGG - Intronic
944104551 2:196065645-196065667 AACAGGGAACAGGGAAGACTAGG - Intronic
944355179 2:198778987-198779009 ACCTAGGAAGAGGGTAGAGTGGG - Intergenic
944612288 2:201423430-201423452 AACTAGGGAGAGGGGAGAATAGG + Intronic
945275956 2:207987836-207987858 AACAGGGAAGAGGTTGTAAGGGG - Intronic
945855809 2:215068457-215068479 AACAGGCAATAGGCTGGAATTGG + Intronic
946209017 2:218132297-218132319 AATAGGCAAATGGGTAGAATTGG - Intronic
947145864 2:227064879-227064901 AAAAGGGAAGATGGCCGAATAGG + Intronic
949027171 2:241771783-241771805 AGCAGGGGAGAGGGGAGAAGGGG + Intergenic
1168739554 20:176170-176192 AACAGGGAAGAGGGAAATAATGG - Intergenic
1168795452 20:607990-608012 AAGAGGGAAGAGGTTAAAAGTGG - Intronic
1169020168 20:2325200-2325222 AGGAGAGAAGAGGGCAGAATTGG + Intronic
1170465135 20:16615886-16615908 AACAAGAAAAAGGGGAGAATGGG + Intergenic
1170834967 20:19876404-19876426 AAAAGGGAAGAGGAGAGAAAAGG + Intergenic
1171185812 20:23123314-23123336 CACAGGGAGGAATGTAGAATGGG + Intergenic
1172884626 20:38222817-38222839 ATCAGCGAAGAGGCTGGAATGGG - Intronic
1173348962 20:42227158-42227180 AAAAGGGAAGAGGAGAGAAGGGG + Intronic
1173618077 20:44415884-44415906 AACAGGGGAGAGGGTAGGGGCGG - Intronic
1174306198 20:49615908-49615930 CACAGGGAGGAGGGCAGATTTGG - Intergenic
1175610155 20:60344394-60344416 ATCAGGAAAGAGGGGAGAAGAGG - Intergenic
1175843611 20:62047484-62047506 TAGAGGGAAGAGGGTAGAGCAGG - Intronic
1176671557 21:9739542-9739564 AACAGGAAAGAGAGAAGAAAAGG + Intergenic
1176996373 21:15560011-15560033 CACAGGGGAGAGGGGAGAATGGG + Intergenic
1177215234 21:18119513-18119535 ACAAAGGAAGAGGGTACAATTGG + Intronic
1178084396 21:29098303-29098325 AAAAGAGAAGTGGGTAGATTTGG - Intronic
1178213217 21:30561448-30561470 AACAAGGAAGAGAGTGGGATGGG - Intergenic
1178241375 21:30905074-30905096 AACAGGCAAGAGAGTTGAACAGG - Intergenic
1180945994 22:19693820-19693842 AGCAGGGATGAGGGTGGCATGGG + Intergenic
1181302146 22:21888352-21888374 ATCAGGGAACATGGTAGAGTAGG + Intergenic
1181518552 22:23432383-23432405 AAGGGGGAAGAGGGTGGGATGGG - Intergenic
1182096065 22:27626886-27626908 AACAGGGACGAGGTTTGAACCGG + Intergenic
1182278830 22:29206492-29206514 AACAGGGAAAAGGGGAGAGAGGG - Intronic
1183198701 22:36371124-36371146 AACAGGGAAGAAGGGAGTAGGGG - Intronic
1183450810 22:37893917-37893939 AGCAGGCATGAGGGGAGAATTGG + Intergenic
949494719 3:4620711-4620733 AACAGTAAAGAGAGTAGAAAGGG + Intronic
949930114 3:9071730-9071752 AGGAGGGAAAAGGGTAAAATGGG + Intronic
950119349 3:10471284-10471306 CACAGGGAAGAGGGTGGGATTGG - Intronic
951393092 3:22130719-22130741 AGCAGGAAAGATGGTAGAAAAGG - Intronic
951638518 3:24807420-24807442 GGCAGGGAAGAGGGGTGAATAGG + Intergenic
952297019 3:32070659-32070681 AACAGGTAAAACGGGAGAATTGG - Intronic
952372870 3:32740121-32740143 AACTGGGTAGAGGGTAGATGAGG - Intronic
952839353 3:37631002-37631024 GACAGGGAAGTGGGGAGAAGAGG + Intronic
953473349 3:43185045-43185067 AACAGGGAAGCGGGGAGCAAAGG + Intergenic
953886324 3:46716242-46716264 AAAAGGGAAGAGAGAAGAAGAGG - Intronic
953935238 3:47036130-47036152 AAGAAGGAAGAGGGAAGAAAAGG - Intronic
954290276 3:49646133-49646155 AATAGAGGAGAGAGTAGAATTGG + Intronic
954856575 3:53648983-53649005 ACCAGTGAAGAGTGGAGAATGGG + Intronic
954899166 3:54004251-54004273 AACATGGAGGAGTGAAGAATTGG + Intergenic
955144985 3:56308252-56308274 AGCAGGGGAGACTGTAGAATTGG - Intronic
955215551 3:56982510-56982532 AACAGGCAAGAGGGGTGGATAGG - Intronic
955335787 3:58084759-58084781 AGCAGAGGAGAGGGGAGAATGGG - Intronic
955705227 3:61720575-61720597 AAGTGGGAAGAGGGGAGCATGGG - Intronic
955733072 3:62008113-62008135 AACAGGAATGAGTGTGGAATAGG - Intronic
955783482 3:62510980-62511002 GAGAGGGAATAGGGTAGAACTGG - Intronic
956770055 3:72517728-72517750 AAAAGGGAAGAGTCTAGAAATGG + Intergenic
956886343 3:73564055-73564077 AGCCAGGAAGAGGGCAGAATAGG - Intronic
957305651 3:78455626-78455648 AGAAGGGAAGAGGGAAAAATGGG - Intergenic
957664272 3:83204042-83204064 AGCATGGAAGAGGGTAGAAGTGG - Intergenic
957861163 3:85952421-85952443 ATCAGGGAAGAGGGCAGAACTGG - Intronic
957964832 3:87308584-87308606 TACAGGGAAGAGAGTAGAAGAGG - Intergenic
958652346 3:96953577-96953599 ACCAGAAAAGAGTGTAGAATTGG - Intronic
958804230 3:98790380-98790402 TACAGGTAAGATGGTAGATTTGG + Intronic
959257289 3:104031385-104031407 CACAGAGAAGAGGGTGGCATGGG + Intergenic
960053974 3:113263318-113263340 AACAGGCAGGAGGGTAGGACAGG + Intronic
960337658 3:116437626-116437648 AGAAGGCAAGAGGGAAGAATTGG + Intronic
960581747 3:119285684-119285706 AACAAGGAAAAGTCTAGAATGGG - Intergenic
962685601 3:137844969-137844991 AACAGGGAAGAGGGAGGGAGAGG - Intergenic
963058910 3:141209095-141209117 AACAGGGAAGAAGGAAATATGGG - Intergenic
963767415 3:149352237-149352259 AAAAAGGAAGAGGGAAGAGTGGG - Intergenic
963777968 3:149458840-149458862 GACTGGGAGGAGGCTAGAATGGG + Intergenic
964295547 3:155229051-155229073 GTCAAGGAAGAGGGTAGAGTTGG + Intergenic
964299974 3:155276746-155276768 AACAGGGAAGAAGGAAATATGGG + Intergenic
966128070 3:176603571-176603593 AACATGGAAAATGTTAGAATTGG + Intergenic
968155544 3:196378221-196378243 AAGAGGGACAAGGGGAGAATGGG - Intronic
968532351 4:1099393-1099415 AGCAGGGAAGAGGGGGAAATGGG + Intronic
969341827 4:6546897-6546919 AAGATGGAAGAGGGGAGAAAAGG + Intronic
969495261 4:7522865-7522887 AGGAGGGAAGAGGGGAGAAAGGG - Intronic
969558648 4:7931215-7931237 AACAGGGATCAGGGTGGAAAAGG + Intronic
970414077 4:15839265-15839287 AACAGGGAAGAGTTTAGGAATGG + Intronic
970861840 4:20713376-20713398 ATCAGGGAAGAGAGGAGAAAAGG - Intronic
971450701 4:26798873-26798895 AAAATGGGAGAGGGTAGAAGGGG + Intergenic
972056495 4:34809030-34809052 TACAGGTAAGTGGGTAGTATAGG - Intergenic
974014047 4:56633120-56633142 AAAAGGGAAGGGGATGGAATGGG + Intergenic
974434655 4:61841146-61841168 AAGAGAGGAGAGGGTAGAGTAGG - Intronic
974515965 4:62911329-62911351 TACGGTAAAGAGGGTAGAATTGG - Intergenic
974610916 4:64214300-64214322 AACTGGGGAGAGGGTAGGAAAGG + Intergenic
974699887 4:65427627-65427649 AAAAGGGAAGAGGGAAAAATAGG + Intronic
975031843 4:69630359-69630381 AACCGGGAAGAGGTGGGAATGGG - Intronic
976089567 4:81442146-81442168 GAAAGGAAAGTGGGTAGAATTGG - Intronic
976558859 4:86478727-86478749 AACAGGAAAGAAGGAAGTATGGG - Intronic
976689522 4:87854420-87854442 AACAGGGCAGAGGGCAGGCTAGG + Intergenic
976794155 4:88913424-88913446 TAGAGGGAAGAGGGAAGAAGAGG + Intronic
977586871 4:98783821-98783843 AGCAGAGAGGAGGGTAGAAAGGG + Intergenic
978855375 4:113388199-113388221 TGCAGGGAAGAATGTAGAATAGG + Intergenic
979669830 4:123350570-123350592 AATAGGGAATATGGTAGAAGGGG + Intergenic
980714710 4:136614576-136614598 AACAGGGAAGAGGAAAATATGGG - Intergenic
981361580 4:143852039-143852061 AAGAGGGGGGAGGGTAGAAGAGG - Intergenic
982151649 4:152465298-152465320 AGAAGGGAAGAGGAAAGAATCGG + Intronic
982479111 4:155887335-155887357 AACAGGGAAAAGTGTGCAATGGG - Intronic
982629320 4:157812126-157812148 AGCATTGAAGAGGGTAGAAAGGG + Intergenic
983345846 4:166524668-166524690 AACAGGGAAGAAGGAAATATGGG - Intergenic
983412322 4:167417042-167417064 AAGAGTGAAGAGGGGAGAGTAGG - Intergenic
983610324 4:169637178-169637200 AACAGGGAAAAGGACTGAATAGG - Intronic
983878837 4:172910418-172910440 AAGGTGGAAGAGGATAGAATGGG + Intronic
984120712 4:175738568-175738590 GACCGAGAAGAGGGCAGAATGGG + Intronic
984915808 4:184723344-184723366 AATAAGGGAGAGGGAAGAATCGG + Intronic
985035165 4:185831496-185831518 AACAAGGAAGATGTTAGAATAGG + Intronic
985582599 5:706716-706738 AACAGGGAAGAAGGAAATATGGG - Intergenic
986106995 5:4669199-4669221 AACAGGGAAGGAGGGAGAATGGG - Intergenic
986674737 5:10173792-10173814 GTCAAGGAAGAGGGTAGCATAGG + Intergenic
986997748 5:13626460-13626482 AACAGAGAATATGGCAGAATGGG + Intergenic
987119279 5:14751260-14751282 AACAGGTCAGAGGGGAGAAGCGG + Intronic
987597080 5:20015651-20015673 AACAGGGTAGAGAGCTGAATTGG + Intronic
987981289 5:25088214-25088236 AACAGGAGAGAGAGTAGAAGAGG - Intergenic
988362155 5:30250491-30250513 AAGAGGATAGAGGGTAGGATGGG - Intergenic
988585544 5:32504652-32504674 AAGAGGGAAGCTGGTAAAATGGG - Intergenic
989137172 5:38167130-38167152 AAAAGAGGAGAGGGTGGAATGGG - Intergenic
989153813 5:38325118-38325140 GGCAGGGAAGAGGGTATAGTGGG + Intronic
989250445 5:39308229-39308251 AAGAGGGGAGAGGGTAGAGCTGG - Exonic
989660139 5:43789714-43789736 AACAGGAAAGAGGGAAATATGGG - Intergenic
989795186 5:45460732-45460754 AATAGGGAAGAAGATAGAAAAGG + Intronic
992071687 5:73154661-73154683 AACAGGGAAGAAGGGAGGAGAGG - Intergenic
992194344 5:74324929-74324951 AAAAGGGAAGGGGGCAGATTGGG - Intergenic
992595321 5:78340875-78340897 TTCAGGGGAGAGGGAAGAATGGG - Intergenic
992646348 5:78815259-78815281 AACAGGGAAGGGTGGAGAAGGGG - Intronic
992745873 5:79819770-79819792 ATAAGGGAAGAGGGGAGAATGGG + Intergenic
993363252 5:87003743-87003765 AACTGGGAAAGGCGTAGAATAGG - Intergenic
994325190 5:98438860-98438882 AACAGGAAAGAGGGAAATATGGG - Intergenic
994840571 5:104920390-104920412 AACAAGGAAGAGTGTGGAACAGG + Intergenic
995124913 5:108570255-108570277 AACAGGGAAGAAGGAAATATGGG + Intergenic
995892703 5:116973554-116973576 AGCAGAGAAGAGGGAAAAATGGG - Intergenic
996029208 5:118686149-118686171 TAAAGGCAAGAGGGTCGAATTGG - Intergenic
996218766 5:120902718-120902740 AAAAGGGAAGAGGGTGGGAGGGG - Intergenic
996358373 5:122620661-122620683 AACAGGGAAGAAGGAAATATGGG + Intergenic
996584464 5:125069329-125069351 AACAGGAAAGAGAGTGGAAGGGG - Intergenic
997008864 5:129852905-129852927 AGCAGGGATGAGGGTGGATTTGG - Intergenic
997157612 5:131576170-131576192 AACAGGAAAGAGGGAAATATGGG - Intronic
998533584 5:142908422-142908444 AAGAGGGAAAAGGGAAGAAAAGG - Intronic
999735852 5:154512301-154512323 TTCAGGGAAGAGGGAAAAATGGG + Intergenic
999737063 5:154520988-154521010 ATCAGGGAAGAGGCTAGAAGGGG + Intergenic
999933532 5:156459862-156459884 AACAAGGAAGAGGTAAGTATTGG + Intronic
1000470707 5:161637699-161637721 AAAAGGGGAGAGTGTAAAATAGG - Intronic
1000493260 5:161943506-161943528 TATAAGGAAAAGGGTAGAATTGG - Intergenic
1000607183 5:163337782-163337804 AACAGGAAAGAGGGAAATATGGG - Intergenic
1001135253 5:169097442-169097464 AAAAGGGAAGAAGGAAGAAAGGG + Intronic
1001365085 5:171129152-171129174 AAAGGGAAAGAGGGAAGAATGGG + Intronic
1001754934 5:174160975-174160997 AGCAGGGAAGAGGGGAGAGGAGG + Intronic
1002387306 5:178877917-178877939 GTCAGGGAAGATGGTAGAGTAGG - Intronic
1003100054 6:3170170-3170192 AACAGGGAAGAAGGAAATATGGG - Intergenic
1003297879 6:4849906-4849928 GGCAGGGAAGGGGATAGAATTGG + Intronic
1003771825 6:9313282-9313304 CACAGGGGAAAGGGTAGGATTGG - Intergenic
1004678784 6:17871661-17871683 GACAGTGGAGAAGGTAGAATGGG + Intronic
1004835313 6:19524465-19524487 AACAGGCAACAGGGCAGATTTGG - Intergenic
1005275122 6:24208742-24208764 AGCAGGGAAGGGGGCAGAATTGG - Intronic
1006941532 6:37754942-37754964 AACAGGGAAGGGGGCAGGAGAGG - Intergenic
1006970857 6:38043522-38043544 AAAAGGGGAGAGGGGAGAAAAGG - Intronic
1007045643 6:38771545-38771567 AACTGGGGAGAGGAGAGAATGGG - Intronic
1007112857 6:39322986-39323008 AGCTGGGAAGAGGTCAGAATGGG + Intergenic
1008438230 6:51501322-51501344 AATACAGAAGAGGTTAGAATTGG + Intergenic
1008912613 6:56751843-56751865 AGAAGAGAGGAGGGTAGAATAGG + Intronic
1008978688 6:57457908-57457930 AACAAGGAAGATGGCCGAATAGG - Intronic
1010586441 6:77662329-77662351 AACAGGGAAGAAGGAAATATGGG + Intergenic
1011582762 6:88888485-88888507 CACAGGGAAGGGTGCAGAATGGG + Intronic
1012278466 6:97300950-97300972 AAAAGGGCAGAGGTGAGAATGGG - Intergenic
1012346456 6:98193427-98193449 AAGAGCGAAGAGGGAAAAATAGG - Intergenic
1012644499 6:101661904-101661926 AACTGGGAAGATGGCCGAATAGG - Intronic
1014280140 6:119433217-119433239 AACAGGCAAGAGTGTAGAGAAGG - Intergenic
1014330155 6:120054388-120054410 AACATGAAAGAGTGTAGGATAGG + Intergenic
1015973204 6:138763208-138763230 GAGAGGAAAGAGGGTAGAAGGGG + Intronic
1016300899 6:142630287-142630309 AACAGGGCAGAGTATAGAAAAGG + Intergenic
1016521486 6:144951557-144951579 CAAAGGGAAGAGGGTATAACAGG - Intergenic
1016811982 6:148270173-148270195 AACAGGGAAGAGGGTGGCAAAGG + Intergenic
1018555342 6:165043813-165043835 AACAGGGGAGAGAGTAGGAAAGG + Intergenic
1018735886 6:166686919-166686941 AACAGGGGTGAGGGGAGAATAGG + Intronic
1019066284 6:169302105-169302127 AGCATTGAAGAGGGTAGAAAGGG + Intergenic
1019600013 7:1876561-1876583 AAGGGGGAAGAGGGTGGGATGGG + Intronic
1021977652 7:26025977-26025999 AACAGGAAAGAGGGAAATATGGG + Intergenic
1022301523 7:29106641-29106663 AACAGGGAAGAGGGTAGAATTGG + Intronic
1022522213 7:31015722-31015744 AACAGTGGAGAGGGCAGATTGGG - Intergenic
1022895805 7:34749354-34749376 TAAAGGGAAGGGGGTAGAAAGGG + Intronic
1023159294 7:37282158-37282180 AACAGGAAGGAGAATAGAATTGG - Intronic
1023182884 7:37503607-37503629 AAAAGGGAAGAGGGTAGTAATGG - Intergenic
1023732913 7:43209270-43209292 AACAGGGGACAGGGGAGCATGGG - Intronic
1023744960 7:43314506-43314528 AACAAAGAAGAGGGTAGTAGAGG + Intronic
1024163791 7:46709133-46709155 AACAGGGATGATGGTTGATTTGG + Intronic
1024241665 7:47440493-47440515 AAGAGGGAAGAGGGCAGAAATGG + Intronic
1024468461 7:49739891-49739913 AACTGGGGAGAGGAGAGAATGGG + Intergenic
1026171841 7:67960766-67960788 AAGAGGGGTGAGAGTAGAATAGG + Intergenic
1027656469 7:80936287-80936309 AACAATGAAGTGAGTAGAATGGG - Intergenic
1029952030 7:104596175-104596197 AACAGTGAAGATGGCTGAATAGG - Intronic
1029967510 7:104755359-104755381 TACTGGGAAGGGTGTAGAATTGG + Intronic
1030781847 7:113610678-113610700 AATGGGGAAGAGGGGAGAAGAGG + Intergenic
1031923445 7:127617827-127617849 AACAGGAAAGGGGGTGGAAGGGG + Intergenic
1032324760 7:130916939-130916961 TACAGAGAAGAGGAAAGAATTGG - Intergenic
1032544607 7:132731254-132731276 TAGTGGGAAGAGGGTGGAATAGG - Intergenic
1033162445 7:139009702-139009724 AACAGGCAAGAGGCTGGTATAGG + Intergenic
1033432379 7:141300813-141300835 AAGAGGAAAGAGGGAAGGATGGG - Intronic
1033845563 7:145427820-145427842 GACAGGGAAGAGAGGAGAAAGGG - Intergenic
1034391610 7:150791801-150791823 GACAGGGCAGAGGGGAGAGTGGG + Intronic
1034465005 7:151222503-151222525 AAAACGTAAGAGGGTGGAATGGG - Exonic
1035335451 7:158124997-158125019 AGAAGGGAAGAGGGGAGAAGGGG + Intronic
1036114335 8:5942068-5942090 AGCAGGGAAGTGGGTGGAAAGGG + Intergenic
1036549959 8:9807029-9807051 AACAGGGAAGAAGGAAATATGGG - Intergenic
1036582752 8:10090686-10090708 ACCTGGGCAGAGGGAAGAATTGG - Intronic
1037250988 8:16894055-16894077 AGAAGGGAGGAGGGTGGAATGGG - Intergenic
1037639665 8:20731151-20731173 AACAGGAAAGAAGGAGGAATGGG + Intergenic
1037709937 8:21347540-21347562 AACAGGGAGGAAGATAGTATAGG + Intergenic
1038473669 8:27846286-27846308 ACCAGGCAAGAGGATAGGATGGG + Intergenic
1039033350 8:33332882-33332904 AATAGGGAAGAGGGCACCATTGG - Intergenic
1040568529 8:48588212-48588234 TGCAGGGAAGAAGGGAGAATTGG - Intergenic
1041503293 8:58563409-58563431 AGCTGGAAGGAGGGTAGAATGGG + Intronic
1042170860 8:65989640-65989662 AGCAGGGAAAAGGGTAGAGAGGG - Intergenic
1043380984 8:79701905-79701927 TACAGGGAAGAAGGCAGAAGGGG + Intergenic
1044396576 8:91720416-91720438 CAAAGGGAGGAGGGTAGAATGGG + Intergenic
1045203611 8:100013310-100013332 AACAGAGAAGAGGGTAAAGTAGG + Intronic
1045332314 8:101166041-101166063 AAGAAGGAAGAGGGTAGTGTAGG + Intergenic
1045713418 8:105013328-105013350 AAGAGGGAAAAGGTTAAAATTGG - Intronic
1045735001 8:105284767-105284789 AACAATGAAGAGGGTGGAAAAGG + Intronic
1045864218 8:106846179-106846201 CCCAGGGAAGAGGGAAGAAGTGG + Intergenic
1046664558 8:116986433-116986455 AGCAGGCAATAGGGTAGAAAGGG + Intronic
1047359618 8:124156163-124156185 TAGAGGGAGGAGGGTAGGATGGG - Intergenic
1047498244 8:125423698-125423720 AACAGGAAAGTGTCTAGAATTGG + Intergenic
1047506993 8:125487922-125487944 AAAAGGGAGGAAGGTAGAAATGG + Intergenic
1047515730 8:125553145-125553167 AAAAGGTAGGAGGGTAGAAGGGG - Intergenic
1048232861 8:132660701-132660723 ACCAGGAAAGAGGGTAGGACTGG - Intronic
1048632642 8:136260687-136260709 AGCAGGGAAGAGGCCAGGATGGG + Intergenic
1050704952 9:8386338-8386360 AGCAGGGAAGAGGGGAGAAAAGG - Intronic
1051194708 9:14551302-14551324 AACTGGGGAGAGGGAAGAATGGG - Intergenic
1051303575 9:15681432-15681454 AACAGGGAAGAAGAAAGAAGAGG - Intronic
1051806740 9:21002548-21002570 GACAGGGCAGATGGGAGAATAGG + Exonic
1052027000 9:23584562-23584584 AAAAGGGAAAAGGGAAGAAAAGG + Intergenic
1052144901 9:25036813-25036835 AACAGGCAAGAGGGGATCATGGG - Intergenic
1052403210 9:28026702-28026724 AACAGGGCAGAGGGAAGGAACGG - Intronic
1053265878 9:36713123-36713145 AGCTGGGAGGAGGGGAGAATGGG - Intergenic
1053524847 9:38817994-38818016 AACAGGAAATAGGATAGAAGAGG - Intergenic
1053674320 9:40407847-40407869 GAGAGGGGAGAGGGAAGAATGGG + Intergenic
1054197081 9:62042410-62042432 AACAGGAAATAGGATAGAAGAGG - Intergenic
1054510301 9:65968443-65968465 GAGAGGGGAGAGGGAAGAATGGG - Intergenic
1054641327 9:67546284-67546306 AACAGGAAATAGGATAGAAGAGG + Intergenic
1055094099 9:72392591-72392613 AATAGGGAAGAGGGAAGAAGTGG + Intergenic
1055627013 9:78184955-78184977 AACAGGGAAGAAGGAAATATGGG - Intergenic
1057355460 9:94327962-94327984 AACAGGGGTGGGGGCAGAATGGG - Intronic
1057561620 9:96132445-96132467 AACAAGGAAGATGTTAGAACTGG + Intergenic
1057652295 9:96929660-96929682 AACAGGGGTGGGGGCAGAATGGG + Intronic
1057723788 9:97554219-97554241 GGCAGGGGAGAGGGTAGAAGGGG + Intronic
1058745641 9:107987886-107987908 AAAAAGGAAGAGTGGAGAATGGG + Intergenic
1058850409 9:109006646-109006668 ACCAGAGAAGAGGGCAGAAAAGG + Intronic
1058948823 9:109884041-109884063 ATCAGGGAAGGGTGAAGAATGGG + Intronic
1059108736 9:111534662-111534684 AACAGGAAGGAGGGCAGATTGGG + Intronic
1059805599 9:117796860-117796882 ACAGGGGAAGAGGGTAAAATAGG + Intergenic
1060343141 9:122794160-122794182 AAGAGGGAAGGGGAAAGAATTGG + Intergenic
1060495911 9:124118500-124118522 AGCAGGGAAGAGGGTAGATTTGG - Intergenic
1060672933 9:125486326-125486348 ACCAGTGCAGGGGGTAGAATGGG + Intronic
1060752013 9:126176352-126176374 ATCTGGGAGGAGGGAAGAATGGG - Intergenic
1062330039 9:136036621-136036643 AACAGGAATGAGGGGAGAAATGG + Intronic
1062576747 9:137212396-137212418 AACAGGCAGGTGGGTAGGATGGG - Intronic
1185963626 X:4575015-4575037 AACAAGGAAAAGGGGAGAAAAGG + Intergenic
1188117138 X:26258258-26258280 AACAGGCAAGAGGCTGGAAGAGG + Intergenic
1188431319 X:30107486-30107508 AACAGGGAAGAAGGAAATATGGG - Intergenic
1188463102 X:30450684-30450706 AACAGGGAAGAAGGAAATATGGG + Intergenic
1188974759 X:36659872-36659894 CACACTGAAGAGGGTAGAAAAGG + Intergenic
1189006551 X:37000442-37000464 AAAAGGGAAAAAGGGAGAATGGG - Intergenic
1189184193 X:39038078-39038100 GACAGGGAAGAGATTATAATGGG - Intergenic
1189239316 X:39513509-39513531 AACAGGGAGGGGGTCAGAATTGG + Intergenic
1189690624 X:43613507-43613529 AGCAGGGGAGAGGGAAGAGTGGG - Intergenic
1189711009 X:43811843-43811865 AACAACTAAGAGGGTATAATTGG - Intronic
1190133667 X:47774260-47774282 CACAGGGAGGAGGGAAAAATTGG - Intergenic
1190360311 X:49643142-49643164 AAAAGGGAGGAGGGCATAATGGG - Intergenic
1190705362 X:53022692-53022714 AACAGGGAACAGGGGAAAAGGGG + Intergenic
1190873571 X:54444652-54444674 AACAGGGGAGAGGGTGGAGATGG - Exonic
1191143215 X:57136996-57137018 AACAGGGAAGTGGTTAGGATAGG - Exonic
1191712237 X:64162418-64162440 AGTAGGGAGGAGGGGAGAATGGG - Intergenic
1192764215 X:74125888-74125910 AACAGGAAAGAGGGAAATATGGG + Intergenic
1193607018 X:83581382-83581404 CACAGAAAAGAGGGTAGACTGGG + Intergenic
1194336859 X:92658865-92658887 AATAGCAAAAAGGGTAGAATTGG + Intergenic
1194358563 X:92918732-92918754 AGGAGAGAAGAGGGGAGAATGGG - Intergenic
1194561288 X:95424521-95424543 AAAAGATAAGAGGGAAGAATTGG + Intergenic
1195605797 X:106803962-106803984 AACAAGTAAGAGAGTAGGATGGG - Intronic
1196667846 X:118334998-118335020 AAGAGGGATGAGGGTAAAAAGGG - Intergenic
1196681669 X:118475908-118475930 AACAGGGAAGAGAAAAAAATAGG + Intergenic
1196789631 X:119452184-119452206 ACAAAGGAAGAGGGTAGAATTGG - Intronic
1197100489 X:122647732-122647754 ATCAAGGAAAAGGGTACAATAGG - Intergenic
1197294022 X:124695141-124695163 AAGAGTGAAGAGGGTAGGATGGG + Intronic
1197471257 X:126867219-126867241 AACAGGGAAGAAGGAAATATGGG - Intergenic
1198618154 X:138480623-138480645 AACAAGGAAGTGCGGAGAATAGG - Intergenic
1198802355 X:140460655-140460677 AAGTGGGTAGAGGGTAGGATAGG - Intergenic
1200645293 Y:5775605-5775627 AATAGCAAAAAGGGTAGAATTGG + Intergenic
1200666742 Y:6034422-6034444 AAGAGAGAAGAGGGGAGAATGGG - Intergenic
1202602520 Y:26608773-26608795 CTCAGGGAAGAGGTCAGAATTGG - Intergenic