ID: 1022301821

View in Genome Browser
Species Human (GRCh38)
Location 7:29108975-29108997
Sequence CAAGTTACTCAACTAGAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 427
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 392}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022301821_1022301825 14 Left 1022301821 7:29108975-29108997 CCAATTTCTAGTTGAGTAACTTG 0: 1
1: 0
2: 2
3: 32
4: 392
Right 1022301825 7:29109012-29109034 ATCTCTTCATCTATAAAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022301821 Original CRISPR CAAGTTACTCAACTAGAAAT TGG (reversed) Intronic
900935269 1:5761637-5761659 CAAGTCATTCAACTAGAACATGG - Intergenic
901586073 1:10294000-10294022 CAAGTTCTTCAACTACAAAGGGG + Intronic
902743531 1:18457384-18457406 CAAATAACTCAATTAAAAATGGG - Intergenic
903369754 1:22827562-22827584 CAATTTTCTCATCTAGAAAATGG + Intronic
903642041 1:24866889-24866911 GAAGTTACACAACCAGAAAGTGG - Intergenic
904386662 1:30146958-30146980 GAAATTACTCAACTTAAAATGGG + Intergenic
904901440 1:33860688-33860710 AAAGTTACTCAGCTAGTAAATGG + Exonic
905473649 1:38210757-38210779 AAAGTTACCCAAGGAGAAATGGG - Intergenic
906185563 1:43859655-43859677 CAAGTTCCGCAACTGGCAATTGG - Intronic
907575123 1:55519336-55519358 CAGGTTTCTCATCTAGAAAGAGG + Intergenic
907956677 1:59235112-59235134 CACTTTACTCATCTACAAATTGG - Intergenic
908000629 1:59675052-59675074 CAGGTTCCTCAACTATAAAATGG - Intronic
911057123 1:93718540-93718562 CAATTTCCTCAACTATAAAATGG + Intronic
911306621 1:96240012-96240034 CAATTTTCTCAACTATAAAATGG + Intergenic
912305941 1:108567436-108567458 AAAGTTACTCAGCTAGTAAGTGG + Intronic
912979910 1:114362049-114362071 TCAGTTACTTAACTAGAGATGGG - Intergenic
915140724 1:153766641-153766663 CAAATAACTCAATTAAAAATAGG - Intronic
915284289 1:154842918-154842940 CAACTTACTCATCTATAAAATGG + Intronic
915695884 1:157740602-157740624 CAGTTTCCTCAACTATAAATGGG + Intergenic
915774694 1:158470187-158470209 CAAATAACCCAATTAGAAATGGG - Intergenic
915857828 1:159408687-159408709 CAAGTTCCTCATCTATAAAATGG + Intergenic
916807416 1:168271875-168271897 CAAGTTTCTCACCTATAAAAGGG + Intergenic
916855772 1:168747932-168747954 CTAGATACTCTGCTAGAAATGGG - Intergenic
918306878 1:183254744-183254766 CATATTACTCAACTAAAAACTGG - Intronic
918985836 1:191624120-191624142 CAATGTGCTCAGCTAGAAATTGG - Intergenic
919131725 1:193459504-193459526 CCACTTACCCAACTAGAAAGGGG - Intergenic
919435580 1:197555518-197555540 CAAGTAACTCCATTAAAAATTGG + Intronic
919521361 1:198592436-198592458 GAAATTACTAAACTAGAAAATGG - Intergenic
919771415 1:201161935-201161957 CAAGTTACTAAAATAGATAAGGG + Intronic
920363851 1:205437749-205437771 CAGGTTCCTCAACTATAAATAGG - Intronic
920802611 1:209203467-209203489 TAAGGTACTCAACTAGTGATAGG + Intergenic
921515116 1:216081235-216081257 CAAGTAAGTTAACTAGAAAGTGG + Intronic
921586749 1:216955876-216955898 CAAATAATTCAATTAGAAATGGG - Intronic
921591375 1:217008219-217008241 CAAGTTACTCATCTGTAAAATGG - Intronic
921824677 1:219659211-219659233 GAAGTGACTCAAATAGAAAGTGG + Intergenic
922122382 1:222685363-222685385 AAAGTCACTCAACTAGTAATTGG + Intronic
923133854 1:231100274-231100296 TAAGATACCCAATTAGAAATTGG - Intergenic
923734291 1:236588397-236588419 AAAGTTACACAACTAGTAAGTGG - Intronic
924153477 1:241152431-241152453 CAAGTTATTCAACAATAATTGGG + Intronic
1063779102 10:9300589-9300611 CAAGTTACTCAGCTAAGAAGTGG + Intergenic
1064977395 10:21132808-21132830 CAAGTAACCCAATTAAAAATAGG - Intronic
1065180561 10:23120502-23120524 ACAGTTACTCATCTAAAAATGGG - Intronic
1066810090 10:39319587-39319609 CAAACTACTCATCTAAAAATAGG + Intergenic
1067476301 10:46569146-46569168 AAGGTCACACAACTAGAAATCGG - Intergenic
1067618436 10:47772634-47772656 AAGGTCACACAACTAGAAATCGG + Intergenic
1068000538 10:51328919-51328941 CAAGTAACTCCATTAAAAATGGG - Intronic
1069222824 10:65905321-65905343 CAGTTTTCTCAGCTAGAAATGGG + Intergenic
1069848684 10:71390998-71391020 CAGGTTCCTCAACTATAAATGGG - Intergenic
1070534814 10:77368370-77368392 CAAGCTACCCAACTGGAAAATGG - Intronic
1070690490 10:78521432-78521454 AAAGTTCCTCACCTAGAAACAGG + Intergenic
1071386397 10:85125555-85125577 CAATTTGCTTAACTAGAAAATGG + Intergenic
1071517176 10:86305862-86305884 CAAGTTCCTCAACTATAAAATGG - Intronic
1072555637 10:96512375-96512397 CAGGTTACTCATCTCTAAATTGG - Intronic
1073496526 10:103896576-103896598 CAAGTTACCCAAATAAAACTAGG + Intronic
1075598280 10:123748148-123748170 CAAATTACTCACGTAGAAAAGGG - Intronic
1076357286 10:129862391-129862413 CCAGTTACTAAACAAGATATTGG - Intronic
1078389932 11:10928507-10928529 CAAGTTTCTCATCTATAAAATGG - Intergenic
1078566529 11:12418966-12418988 CAATTTACTCATCTGCAAATGGG - Intronic
1078984812 11:16583043-16583065 CAATTTACTCATCCATAAATTGG + Intronic
1079011432 11:16831735-16831757 CAAGTTCCTCATCTATAAAATGG + Intronic
1079356446 11:19733995-19734017 CCATTTCCTCAACTAAAAATGGG - Intronic
1079622329 11:22568874-22568896 CAAGTAACTCCATTAGAAAATGG - Intergenic
1079972250 11:27049552-27049574 CAAGCTACTCAATTAAAAAATGG - Intronic
1080075080 11:28139319-28139341 TTGGTTACTCAACTAGAAAGAGG + Intronic
1080170441 11:29295689-29295711 CAAATGGCTCAACTATAAATGGG + Intergenic
1080780052 11:35420707-35420729 CAGGTTACTCAGCTAGAAGGTGG - Intergenic
1081431860 11:42985111-42985133 CAAGTCACACAACTAGCAAGTGG - Intergenic
1082032707 11:47617253-47617275 CATGCTTCTCAACTAGGAATAGG + Intergenic
1084030373 11:66477441-66477463 CAAGTCACACAACTAGAAAGTGG + Intergenic
1085829531 11:79884789-79884811 CCAGTTACACAGCTAGAAAGAGG + Intergenic
1085981817 11:81734663-81734685 GTAGTTACCCAAATAGAAATTGG - Intergenic
1086157830 11:83687337-83687359 CAGGTTTCACAGCTAGAAATTGG + Intronic
1086172750 11:83854986-83855008 CAAACAACTCAACTAAAAATGGG + Intronic
1086430840 11:86735375-86735397 CAAGTAACCCAAATAAAAATGGG + Intergenic
1086978729 11:93169254-93169276 CAGGTTCCTCAACTATAAATTGG - Intronic
1087078572 11:94148716-94148738 TAAGTTACACAACAAAAAATTGG - Intronic
1087204475 11:95379313-95379335 CAATTTCCTCAACTATAAAATGG - Intergenic
1087269240 11:96094359-96094381 CAATTTTCTCATCTAGAAAATGG + Intronic
1088588188 11:111378702-111378724 TAAGTCACTCAGCTAGAAACAGG + Intronic
1088780530 11:113129845-113129867 CTATTTACTTAACTAGCAATGGG - Intronic
1092491612 12:8950227-8950249 CAAGGTACTCAACTGGAAAAAGG - Intronic
1093577891 12:20755459-20755481 CAAGTTATTCAAGAATAAATTGG - Intergenic
1095325843 12:40891195-40891217 CAAACAACTCAACTAGAAAACGG - Intronic
1095680835 12:44973528-44973550 CATGTTAGGCAACAAGAAATAGG + Intergenic
1097294865 12:57951308-57951330 CAATTTCCTCAACTATAAAAAGG - Intronic
1097622029 12:61950590-61950612 CAAATAACTCAATTAAAAATGGG - Intronic
1098171200 12:67749045-67749067 CAATTTATCCATCTAGAAATGGG + Intergenic
1098405439 12:70121279-70121301 CAACTTATTCATCTAGGAATAGG + Intergenic
1099214791 12:79840181-79840203 CAATTTTCTCATCTGGAAATGGG + Intronic
1099961945 12:89405316-89405338 CAAGTTACTCAGGTAGTAGTGGG + Intergenic
1099974155 12:89528903-89528925 CAATTTACTCATCTATAAAACGG - Intergenic
1100664524 12:96736954-96736976 CAAGTCACACAGCTAGAAAGAGG - Intronic
1100814367 12:98371788-98371810 CAAATCACACAACTAGAAAGTGG - Intergenic
1101509916 12:105383684-105383706 CAAGTTACACAGCTAGTAAGTGG - Intronic
1102600765 12:114028539-114028561 CAGTTTGCTCAACTAGAAAGTGG - Intergenic
1103176277 12:118866113-118866135 CAATTTCCTCATCTATAAATTGG + Intergenic
1105633713 13:22197240-22197262 GAAGTTACTCATCTTGAGATTGG + Intergenic
1105922745 13:24981050-24981072 CAAGTTACTTCTCTAGAAAATGG + Intergenic
1106872090 13:34032522-34032544 CAATTTCCTCAACTATAAAATGG + Intergenic
1107488242 13:40853050-40853072 CAAGTTACTTCTCTAGAAAATGG + Intergenic
1108245458 13:48508775-48508797 CAAGTTGCTTAACTGGACATTGG - Intronic
1109568859 13:64158793-64158815 CAATTTTCTCATCTAGAAAGCGG + Intergenic
1109664269 13:65510231-65510253 TTAGTTACACAACTAGTAATTGG + Intergenic
1110019001 13:70445065-70445087 CAAGTTCCTCAACAAAAACTAGG + Intergenic
1110026549 13:70547714-70547736 CATGTTACTCATATAAAAATAGG + Intergenic
1110101560 13:71612619-71612641 CAAGTTACTCATCTGTAAAGTGG + Intronic
1110113546 13:71781984-71782006 CCAATTTCTCAACTAGACATTGG + Intronic
1110678130 13:78275364-78275386 CAGTTTACTCACCTAGAGATTGG - Intergenic
1111409157 13:87852164-87852186 CAAGTTCCTCACTTATAAATTGG - Intergenic
1111809534 13:93081730-93081752 AAAGTTACTCAAGGTGAAATTGG - Intergenic
1112043190 13:95568925-95568947 AAAGTTACACAGCTAGAAAGTGG - Intronic
1112855143 13:103759589-103759611 CAAGTCACACAAATAGAAATTGG - Intergenic
1113108429 13:106796430-106796452 CAAGTTACTCATCAACACATTGG - Intergenic
1113133923 13:107068119-107068141 CAGGTCACTCAGCAAGAAATGGG - Intergenic
1113536494 13:111070749-111070771 CAAGTTTTACACCTAGAAATGGG + Intergenic
1113810370 13:113138189-113138211 CAAGTTAATTACCTAGAAACAGG - Intronic
1114846364 14:26327497-26327519 AAAGTTATTCATTTAGAAATAGG + Intergenic
1115096218 14:29639068-29639090 AAGGTAACTCAAATAGAAATGGG - Intronic
1117063085 14:51982501-51982523 CAAGGTGTTCAAGTAGAAATGGG + Intergenic
1117439605 14:55747250-55747272 CAAGTTCCTCACCTGGAAAATGG - Intergenic
1117832725 14:59768874-59768896 CAATTTCCTCAACTACAAAATGG - Intronic
1118574581 14:67229130-67229152 CAAGTCACACAGCTAGAAAATGG + Intergenic
1118969985 14:70627916-70627938 CAAATAACTCAACTAAAAATAGG + Intergenic
1119059031 14:71455458-71455480 AAAATTCCTAAACTAGAAATTGG + Intronic
1120033776 14:79672187-79672209 CAAGATAGTCTACTAAAAATGGG - Intronic
1120071624 14:80109790-80109812 CAAATTACCCAGCTAGAAATAGG + Intergenic
1120683551 14:87510773-87510795 CAAATGACTCAATTAAAAATTGG - Intergenic
1121721866 14:96115004-96115026 CAAGCTCATCCACTAGAAATGGG - Intergenic
1121859528 14:97303579-97303601 CAGTTTTCTCAACTAGATATTGG - Intergenic
1122251328 14:100441918-100441940 CAAGTTTCTCAGCTATAAAATGG - Intronic
1124419036 15:29502752-29502774 CAAATAACTCAACTAGGAAAAGG + Intronic
1124519184 15:30394877-30394899 CAAGTTACCAATCCAGAAATTGG - Intergenic
1124759178 15:32436228-32436250 CAAGTTACCAATCCAGAAATTGG - Intergenic
1124974490 15:34520337-34520359 CAAGTTACCAATCCAGAAATTGG - Intergenic
1125153253 15:36557888-36557910 GAAGTTACTGAACTTGAAGTTGG - Intergenic
1125542353 15:40476949-40476971 CAATTTCCTCATCTAGAAAATGG - Intergenic
1125680111 15:41525137-41525159 AAAGCTGCTCAACTGGAAATGGG + Exonic
1126117375 15:45220803-45220825 TAAGTTACTTTCCTAGAAATTGG + Intergenic
1126326622 15:47484920-47484942 CAAATCAATCAACTAGAATTGGG - Intronic
1126511620 15:49481790-49481812 ACAGCTACTCATCTAGAAATTGG - Intronic
1129158673 15:73734569-73734591 TAAGTTACACAGCCAGAAATTGG - Intergenic
1130542150 15:84827950-84827972 CAAATTACTCAACTATAACATGG - Intronic
1131890113 15:96963551-96963573 CAATTTCCTCAATTATAAATGGG - Intergenic
1132185899 15:99801424-99801446 CAAGTTACCAATCCAGAAATTGG + Intergenic
1132429779 15:101751274-101751296 CAAGTTACCAATCCAGAAATTGG - Intergenic
1134380160 16:13716810-13716832 CAATTTACTCATCTATAAAATGG - Intergenic
1134465040 16:14468229-14468251 CAAGTTCCTCAATTAAAAAATGG + Intronic
1135263680 16:21002888-21002910 CAATTTACTCAACCAAAAAATGG - Intronic
1135802450 16:25510549-25510571 CAGTTAACTCAACTTGAAATAGG + Intergenic
1136002846 16:27308746-27308768 CAAGTAACCCAACTAAAAAATGG + Intergenic
1139326623 16:66157469-66157491 CAAGTTACTCAACTGCAAAAGGG - Intergenic
1140877943 16:79170276-79170298 CTATTTCCTCAACTATAAATTGG - Intronic
1140987092 16:80168393-80168415 CAAGTTTCTCAAATATAAATGGG + Intergenic
1145033928 17:19526865-19526887 CAATTTATTCAATTAGAAAAGGG + Intronic
1145851571 17:28104113-28104135 CCAGTTTCTCAACTAGATCTTGG + Intronic
1146680468 17:34803764-34803786 CAAGTTATTAATCTAGATATAGG + Intergenic
1146947155 17:36881421-36881443 CAATTTTCTCAACTATAAAATGG + Intergenic
1147848988 17:43426728-43426750 CAGTTTACTCAACTGTAAATTGG - Intergenic
1149138713 17:53403024-53403046 AAAGATACTAAAATAGAAATAGG - Intergenic
1149285641 17:55161091-55161113 CAGTTTACTCAACTATAAAATGG - Exonic
1149628163 17:58094940-58094962 CACGTTACTCAGCTAGAAAAAGG - Exonic
1150930794 17:69582855-69582877 CAAGTTACCCAATAACAAATAGG - Intergenic
1154994681 18:21628488-21628510 CATGATACTCAACTAGAGTTAGG + Intronic
1155544816 18:26903975-26903997 AAAGTTAATCACCAAGAAATGGG - Intergenic
1156661766 18:39354512-39354534 CAAGTTAATTAAATTGAAATGGG + Intergenic
1156942935 18:42792709-42792731 AAAGCTCTTCAACTAGAAATGGG - Intronic
1157410343 18:47457944-47457966 CAGTTTACTCATCTGGAAATCGG + Intergenic
1157873377 18:51250146-51250168 CAAGTTAGCCGACTAGAACTAGG - Intergenic
1157953534 18:52068022-52068044 CAAATAACTCAAGTAGAAAATGG + Intergenic
1157958176 18:52122494-52122516 CAAATTATTCTACTAAAAATTGG - Intergenic
1159070228 18:63614581-63614603 CAAGTTTCTAAACTATAATTTGG - Intergenic
1159976987 18:74726101-74726123 CATGTCACTGAACTAGAAAGTGG - Intronic
1160078402 18:75700236-75700258 CAAGATACTGAACTGGGAATAGG - Intergenic
1161675196 19:5643011-5643033 CAATTTCCTCAACTGAAAATGGG - Intronic
1161877536 19:6923490-6923512 AAAATCACACAACTAGAAATTGG + Intronic
925290826 2:2747761-2747783 CAATTTCCTCATCTAAAAATAGG + Intergenic
926486410 2:13465639-13465661 CAAGTCACTCAACTAAAAATGGG + Intergenic
926725059 2:15991240-15991262 CAGGTTTTCCAACTAGAAATTGG - Intergenic
926972904 2:18484675-18484697 CCAGTTCCTCAACTTTAAATAGG - Intergenic
928046597 2:27940401-27940423 CCAGATACTCAACTAGAGATTGG - Intronic
928858294 2:35826831-35826853 CAATTTACTCATCTATAAATTGG - Intergenic
929299925 2:40291508-40291530 CTAGTGACTCATCTAAAAATGGG - Intronic
929482187 2:42320398-42320420 GAAGTTACTTAACAAAAAATTGG - Intronic
929923994 2:46194309-46194331 CAATTTCCTCAACTATAAAATGG - Intergenic
931532553 2:63232541-63232563 GAAGTTATTGAACTAGAAAATGG + Intronic
932064709 2:68542461-68542483 CAAATTACCCAATTTGAAATTGG + Intronic
932296838 2:70631405-70631427 CAAATTACTCCAAAAGAAATAGG + Intronic
936098908 2:109557647-109557669 CAAGTTTCTTTACTTGAAATTGG - Intronic
936537376 2:113322883-113322905 CAGGTTTCTCAACTGGAAAATGG - Intergenic
937060767 2:118978990-118979012 CAATTTACTCTCCTAGAAAAGGG + Intronic
937630459 2:124095906-124095928 CAACTTATTCATCTAGAAAATGG - Intronic
938121479 2:128637176-128637198 CAAGTCACACAATTACAAATGGG + Intergenic
938195970 2:129328554-129328576 CAAATAACCCAACTAGAAAATGG + Intergenic
939596320 2:144127796-144127818 CAAGATACACATCTAGAAAGTGG + Intronic
939713525 2:145554387-145554409 CATGTTACACAACTACAAAATGG - Intergenic
939918347 2:148076786-148076808 CAAGTTACTGTACTAGACAGTGG + Intronic
940113861 2:150185932-150185954 CAAGTTCCTCATCTAGAATATGG + Intergenic
940631087 2:156239966-156239988 CAAGTCACACAACTAGTAAGAGG - Intergenic
941209238 2:162615960-162615982 GAAGTTACTAAATTAGAGATAGG + Intronic
942010040 2:171752415-171752437 TAGGTTACACTACTAGAAATGGG - Intergenic
942568683 2:177291591-177291613 CAGGTTACACAACTAGTAAGTGG - Intronic
942815522 2:180049096-180049118 CATGTTAATCCACTACAAATTGG - Intergenic
943048252 2:182884501-182884523 CAAGTAACTCAATTAAAAAGTGG - Intergenic
943483417 2:188450987-188451009 CAAATTACTCAATTAGTAAATGG + Intronic
943622356 2:190163597-190163619 CCAGGCACTCAACTAGGAATTGG + Intronic
944395929 2:199266063-199266085 AATGTTCCTCAACTAAAAATTGG - Intergenic
945324558 2:208467391-208467413 TAAGTTACTCAACCAGAATGTGG + Intronic
945364722 2:208937914-208937936 CAATGTACTCAACTAAATATTGG - Intergenic
945628612 2:212241937-212241959 CAAATGAGTCCACTAGAAATAGG + Intronic
945737591 2:213619477-213619499 CAAATTATTCAACTAAAAAACGG + Intronic
946291802 2:218751065-218751087 AAAGTTATTCAACTAGAGAGTGG + Intronic
947117709 2:226790162-226790184 CAAGTTACTGATGAAGAAATAGG + Intronic
1168911581 20:1452244-1452266 CAGTTTCCTCAACTATAAATTGG - Intronic
1168946905 20:1768423-1768445 CAGTTTACTCATCTAGAAAATGG - Intergenic
1169482066 20:5992223-5992245 GAAGTTACACAACTAGTAAGTGG - Intronic
1171009085 20:21497902-21497924 AAAGTTATTCAAATAGAATTTGG - Intergenic
1171088034 20:22256524-22256546 TAAGTTAGTCAATTAAAAATGGG + Intergenic
1171095039 20:22324818-22324840 CAAGTTAACCAACTGGAAATTGG + Intergenic
1172254381 20:33504214-33504236 CATGTTACTCAACAATAAAAAGG - Intronic
1173065825 20:39710158-39710180 CAAGTGACTCATCAAGAAAGGGG - Intergenic
1174024031 20:47557399-47557421 CAAATTCCTCAACTGTAAATGGG - Intronic
1174939630 20:54911182-54911204 CAAGTAACTCAATTAAAAATGGG - Intergenic
1175043603 20:56080130-56080152 CAAGCAACCCAACTAAAAATAGG - Intergenic
1175128525 20:56770989-56771011 CAAATAACTCAATTAAAAATTGG - Intergenic
1175574072 20:60047307-60047329 CAAGATACTCACCTATAAAATGG - Intergenic
1176738957 21:10580185-10580207 CAAGTTACTTCTCTAGAAAATGG - Intronic
1176880395 21:14185436-14185458 TAAGTTACCCAAATGGAAATGGG - Intronic
1176944407 21:14961061-14961083 CAAGTTAGTGCACTAGAAACAGG - Intergenic
1177058515 21:16340176-16340198 TCAGTTTCTCAACTAAAAATGGG + Intergenic
1177323492 21:19552982-19553004 CAAGTTACTTCATTAGAGATGGG - Intergenic
1177543041 21:22520465-22520487 ATAGCTACTCAACTAGAAAGAGG - Intergenic
1177906171 21:26973623-26973645 CTAGTTACTGAATTAGAAACTGG - Intergenic
1178217579 21:30617660-30617682 CAAGTTATACAACTAGATAATGG + Intergenic
1179065615 21:38021901-38021923 CAAGTAACCCAATTAAAAATGGG + Intronic
1182982665 22:34686121-34686143 GAAGTTACACAGCTAGAAAATGG - Intergenic
1184111400 22:42397720-42397742 CAAGTTCCTCATCTATAAAATGG - Intronic
1184196227 22:42930806-42930828 CAAGTCACACAACTAGTAAGGGG + Intronic
1184306664 22:43607517-43607539 TAAGCTACTCAAACAGAAATGGG + Intronic
949633658 3:5958008-5958030 CAAATAACTTAACTAAAAATAGG - Intergenic
950880536 3:16319422-16319444 CAAGTTACTCATCTCTAAAATGG + Intronic
951035245 3:17925608-17925630 CAAGTTAATCAGCTAAAAGTAGG - Intronic
951362771 3:21744159-21744181 CAAATTCCTCATCTAAAAATAGG + Intronic
951417346 3:22441093-22441115 CAAGTTTCTCTACTATAAAGTGG - Intergenic
951943238 3:28105261-28105283 AAAGTTAATCAACCAGAAAGAGG + Intergenic
952597660 3:35038222-35038244 CAATTGTCTAAACTAGAAATTGG - Intergenic
953184131 3:40622177-40622199 GAAGTTACACAGCCAGAAATTGG - Intergenic
954492274 3:50917407-50917429 AAATTTACTCAAGAAGAAATAGG - Intronic
954643292 3:52115067-52115089 CAAGTTACCCAACTTGGAAAAGG - Intronic
954784107 3:53080741-53080763 CAGTTTACTCATCTAAAAATGGG - Intronic
955045583 3:55356923-55356945 TAAGTCACTCATCTAGAAGTAGG + Intergenic
955161039 3:56466046-56466068 CTAGTTACTCATCTATAATTTGG + Intronic
956318549 3:67968268-67968290 CAAGTTTCTCATCTATAAATTGG + Intergenic
956655365 3:71545232-71545254 TCACTTACTCAACTAGAAAGTGG - Intronic
956929624 3:74028294-74028316 CAATTTTCTCATCTATAAATTGG + Intergenic
958664450 3:97117155-97117177 CAAATGACTCAATTAAAAATGGG - Intronic
959252851 3:103970766-103970788 CAAGTTACTGATCTTGAGATGGG - Intergenic
959420931 3:106127458-106127480 CATGTTACCTATCTAGAAATGGG + Intergenic
959517285 3:107283168-107283190 CAAGTTACTCAACAACAAATAGG + Intergenic
959538910 3:107518620-107518642 AAAGTTACTCAGCTAGAAAGTGG + Intergenic
959711108 3:109386663-109386685 CAATTTATTCATCTAGAAAATGG - Intergenic
960101144 3:113745408-113745430 CTAGTGACTCAACTAGATTTGGG - Intronic
960879470 3:122330081-122330103 CAAGTTTCTCACCTATAAAGCGG - Intronic
960908473 3:122624905-122624927 CAAGTTCCTCATCTACAAAATGG - Intronic
960908495 3:122625109-122625131 CAGTTTGCTCAGCTAGAAATTGG - Intronic
961824374 3:129591261-129591283 CATTTTACTCAACTATAAAATGG + Intronic
962160084 3:132989772-132989794 AAAGTTACTCATCCAGATATTGG + Intergenic
962366350 3:134787519-134787541 CAAATAACCCAACTAAAAATGGG + Intronic
963713330 3:148773223-148773245 CAGTTTACTCATCTATAAATAGG + Intergenic
963784641 3:149521860-149521882 CAGTTTACCCATCTAGAAATTGG + Intronic
966300715 3:178476678-178476700 CAAGCTACTCCCCTTGAAATAGG + Intronic
969140970 4:5071242-5071264 CATGTTACTCCACAAGAAAGAGG + Intronic
970774727 4:19659852-19659874 CAAGGTCCTCAAGTAAAAATAGG - Intergenic
970833500 4:20371064-20371086 GAAGTGACCCAACTAGAGATAGG - Intronic
970922017 4:21405561-21405583 CAAGTTGCTGAACTAGAAAGTGG - Intronic
971185268 4:24369536-24369558 CAATTTTCTCATGTAGAAATTGG - Intergenic
971504248 4:27348655-27348677 CAAGTGACTCAATAAGTAATTGG + Intergenic
971889626 4:32502285-32502307 CAAATGACCCAAATAGAAATTGG + Intergenic
973345694 4:49052337-49052359 CAAGTGCCTCATCTAAAAATGGG + Intronic
974476154 4:62383526-62383548 AAAGTTACTGAGCTAGAAAAAGG - Intergenic
974590244 4:63939062-63939084 CCAGTTACTCTGCTAAAAATCGG + Intergenic
974700872 4:65444187-65444209 TAAATTACTCAGCTAGAAAGTGG - Intronic
974828086 4:67154718-67154740 AAAGTTACACAAATAAAAATGGG + Intergenic
974881954 4:67770050-67770072 CAATTTCCTCATCTAGAAATAGG + Intergenic
975382567 4:73718424-73718446 CAAGTTTCTCATATATAAATTGG - Intergenic
975796663 4:78013201-78013223 AAAGTTAGTCAAGAAGAAATAGG + Intergenic
976487007 4:85618806-85618828 CAAATTACTCAATTAAAAACGGG - Intronic
976605309 4:86977067-86977089 CAAGTTATTCCACTGCAAATAGG - Intronic
976654479 4:87474197-87474219 CAAGCTACTCAATTAAAAACTGG - Intronic
976837276 4:89389328-89389350 AAGGTTACACAACTAGCAATGGG - Intergenic
978305553 4:107323921-107323943 CAAGATAGCCAACTAGAAGTAGG - Intergenic
978969473 4:114785470-114785492 CAAATTATTCAATTAAAAATGGG + Intergenic
979174018 4:117638912-117638934 CAAGTGAGTCAAACAGAAATGGG - Intergenic
979600526 4:122582437-122582459 CAAATTGCACAGCTAGAAATTGG + Intergenic
980093101 4:128462648-128462670 CAAGTAACTCACCAAGAAAGTGG - Intergenic
981119374 4:141031565-141031587 CAAATTACTCAATTAAAAAATGG + Intronic
981232496 4:142373569-142373591 CAATTTCCTCATCTAGAAAATGG + Intronic
981351295 4:143732907-143732929 CAAGTTACCCAGCTAGATAGTGG + Intergenic
981491093 4:145340275-145340297 CAAGTTGCACAACTAGTAATTGG - Intergenic
981809434 4:148756953-148756975 CAAGCAATTCAATTAGAAATGGG - Intergenic
982208417 4:153015374-153015396 CAGTTTACTCAACTATAAAATGG + Intergenic
982493101 4:156054367-156054389 GAACTTACTAACCTAGAAATTGG + Intergenic
984208403 4:176815404-176815426 CAAATAACTCAATTAAAAATGGG - Intergenic
986242013 5:5969350-5969372 CAAGTTAATCAACAAGAAGCTGG - Intergenic
986364269 5:7015165-7015187 AAAGTTACTGAACCAGAAAAAGG - Intergenic
987004586 5:13697085-13697107 CATGTAACTCAACTGGAAAAAGG + Intronic
987157413 5:15104043-15104065 AAGATTACTCATCTAGAAATGGG + Intergenic
988575059 5:32414367-32414389 AAACTTCCTCAGCTAGAAATTGG + Intronic
989286467 5:39705689-39705711 CAAGATAGTCATCTTGAAATCGG + Intergenic
990474800 5:56151990-56152012 CAAGCTACTGAACTAGAAACTGG + Intronic
991941732 5:71859953-71859975 CAAGCTATTCAATTAGATATAGG + Intergenic
992635430 5:78721867-78721889 CAAGATACACAACTAGTAAGTGG + Intronic
994576039 5:101580958-101580980 CAAGTCAGTTAACTGGAAATAGG - Intergenic
994579672 5:101624701-101624723 CAACTGACTCAAAGAGAAATAGG - Intergenic
995994904 5:118285958-118285980 CAACTTTCTCATCTAGAAAATGG + Intergenic
996236598 5:121138417-121138439 CCAGTTTATCAACTAGTAATAGG + Intergenic
996320989 5:122216472-122216494 AAAGTAACTCAACAAGACATAGG + Intergenic
997431216 5:133842428-133842450 CAAGTTGCTCATCTCCAAATGGG + Intergenic
997875808 5:137545849-137545871 CCAGTTACCCAAATAGAATTTGG + Intronic
1000521116 5:162295823-162295845 CAATTTACTCATCTACAAAATGG - Intergenic
1000875048 5:166626870-166626892 CAATTTACACAATTTGAAATTGG + Intergenic
1000921218 5:167140043-167140065 AAAGTTACTCAACTAAAACGTGG + Intergenic
1001874684 5:175189347-175189369 GAATATGCTCAACTAGAAATGGG + Intergenic
1001884900 5:175280608-175280630 CAATTTACTCATCTGCAAATGGG + Intergenic
1002208144 5:177578515-177578537 CAAGTTGGACAACTAGAAGTAGG - Intergenic
1004229195 6:13815572-13815594 CAAGTCACCTAACTAAAAATGGG + Intergenic
1008492742 6:52103090-52103112 CAAGTTACTCAACCACGAATGGG + Intergenic
1008714305 6:54269952-54269974 CAATTTATTTGACTAGAAATAGG + Intergenic
1009268468 6:61587987-61588009 CAATTAAATGAACTAGAAATTGG - Intergenic
1009357422 6:62768525-62768547 TAAGAAACTCAACTAAAAATGGG + Intergenic
1009469599 6:64016342-64016364 CAATTTCCTCACCTATAAATGGG - Intronic
1010296074 6:74197691-74197713 CAAGATAGTAAACTATAAATTGG - Intergenic
1010503555 6:76629654-76629676 GAAGTTACTCAACTAGGACCTGG - Intergenic
1010729353 6:79372749-79372771 CCAGATACTCACCTAGGAATTGG + Intergenic
1012564775 6:100634553-100634575 CAAATTATTCAATTAAAAATGGG + Intronic
1012872871 6:104692662-104692684 CGAGTTTCTCAACTATCAATAGG + Intergenic
1013457370 6:110342888-110342910 AAACTTACTCAACTATAAAAAGG - Intronic
1014394605 6:120910219-120910241 CAAACAACTCAACTACAAATTGG - Intergenic
1014412333 6:121141464-121141486 CAAATAACTCAATTAAAAATGGG + Intronic
1014483282 6:121965548-121965570 CAAATAACTCAACAAGAAAATGG - Intergenic
1015196850 6:130533211-130533233 CAAGTTTCTCATCTATAAAATGG + Intergenic
1017713455 6:157190487-157190509 TACGTTCCTCATCTAGAAATTGG + Intronic
1020815891 7:12905561-12905583 CATGTAACTCAATTACAAATAGG + Intergenic
1021806412 7:24361349-24361371 CCAATTACTGAATTAGAAATGGG - Intergenic
1022217310 7:28276748-28276770 CAAATAACTCAACTAAAAAACGG - Intergenic
1022301821 7:29108975-29108997 CAAGTTACTCAACTAGAAATTGG - Intronic
1023025560 7:36046621-36046643 AAGGCTACTCAACTAGAAAGTGG - Intergenic
1023026677 7:36057039-36057061 CAATTTCCTCATCTATAAATAGG + Intergenic
1023509506 7:40936063-40936085 CAAATAACTCAACTTAAAATGGG - Intergenic
1023682521 7:42702121-42702143 CAGTTTACTCAACTATAAAATGG - Intergenic
1024749693 7:52450996-52451018 CAAGTTGCTGAACTAAAAGTGGG + Intergenic
1024914004 7:54478124-54478146 CTAGTTCATCAACTAGCAATGGG + Intergenic
1024920464 7:54548583-54548605 CAGTTTACTCAACTATAAAATGG + Intronic
1025111936 7:56224530-56224552 CAGCTTACTCAAGAAGAAATAGG - Intergenic
1027705179 7:81522661-81522683 CAAGTTCCTAAACTGGACATTGG + Intergenic
1028450976 7:90982861-90982883 CAAGTAACTCCATTAAAAATGGG + Intronic
1029067172 7:97862106-97862128 AAAATAACTCAATTAGAAATGGG + Intronic
1030238051 7:107288629-107288651 CAAATTACCCAACTAAAAAGTGG - Intronic
1030336029 7:108327198-108327220 CAAGCTACCCAGCTAGGAATAGG - Intronic
1030460740 7:109832694-109832716 CAATTTTCTCAAGTAAAAATGGG + Intergenic
1030536350 7:110771834-110771856 CAAGTTACTCATCTGTAAAGTGG - Intronic
1030597577 7:111558505-111558527 CAAATTCCTCATCTATAAATGGG - Intronic
1031060557 7:117046573-117046595 CCAGTTAGTCTACCAGAAATGGG + Intronic
1032412355 7:131705684-131705706 GAACTTACTAATCTAGAAATAGG - Intergenic
1033964193 7:146953715-146953737 TCAGGTACTCTACTAGAAATGGG - Intronic
1035248698 7:157582313-157582335 CAAATGACCCAACTAAAAATGGG + Intronic
1036628224 8:10490689-10490711 CAAGATATTAAAATAGAAATTGG + Intergenic
1037747379 8:21657638-21657660 CAAGATACACAACAAGAGATTGG - Intergenic
1037933306 8:22897584-22897606 CAGTTTACTCAACTATAAAATGG - Intronic
1038172215 8:25145817-25145839 CAATTTACTCATCTATAAATGGG + Intergenic
1038936736 8:32260132-32260154 GAACTTGCTCAAATAGAAATGGG + Intronic
1038969206 8:32612776-32612798 CAAGGTGCTCAACTAGAGCTGGG - Intronic
1039020735 8:33203068-33203090 AATGTTACTCAACTAGTAAGTGG - Intergenic
1039924228 8:41914735-41914757 CAAACAACTCAATTAGAAATCGG - Intergenic
1041666852 8:60454129-60454151 AAAGTCACTCAGCTAGAAAATGG - Intergenic
1041699667 8:60774229-60774251 AAAGTTACACAGCTAGAAAATGG - Intronic
1041948864 8:63477561-63477583 CAATTTTCTCATCTACAAATTGG - Intergenic
1042117316 8:65446290-65446312 CAAGTTTCTCATCTTAAAATGGG + Intergenic
1042413600 8:68493289-68493311 CTAATTACTCAATTAAAAATGGG + Intronic
1042790152 8:72596136-72596158 TCAGTTTCTCAACTACAAATTGG - Intronic
1044215656 8:89607218-89607240 CCAGCTTCTCAACTAGAAAGAGG - Intergenic
1044865773 8:96569733-96569755 CAGGTTCTTCAACTAGAAAATGG - Intronic
1045360955 8:101432782-101432804 CAGGTTACTCCACTTAAAATAGG + Intergenic
1047506886 8:125487154-125487176 AATGTTACACAACTAGAAAGAGG - Intergenic
1048125503 8:131630572-131630594 CAGTTTCCTCAACTAGAAAATGG - Intergenic
1050325593 9:4494269-4494291 CAATTTCCTCATCTGGAAATTGG + Intronic
1051257641 9:15231528-15231550 TAAGTAACTCAATTAAAAATGGG - Intronic
1052838600 9:33271333-33271355 GAAGTTACTCTACTAGTAAATGG - Intronic
1054860444 9:69947535-69947557 TAAGTGGCTCAACTAGTAATTGG + Intergenic
1054974699 9:71128743-71128765 CAAGTTATTCAAGCAGTAATTGG - Intronic
1055007066 9:71520070-71520092 CAAATCACTCAACTAGACAGTGG + Intergenic
1055207173 9:73746400-73746422 CAAATAACTCCACTAAAAATGGG - Intergenic
1056209872 9:84355636-84355658 CAAGTTCCCAATCTAGAAATAGG - Intergenic
1056467242 9:86869569-86869591 CAAGTTTCTCACCTATAAAACGG + Intergenic
1057908494 9:99000595-99000617 CAAGTTCCTTATCTAGAAATGGG - Intronic
1058160273 9:101562984-101563006 CAAGTTACTCTGCTAGTAAATGG - Exonic
1058820415 9:108724214-108724236 CAAGTGACTCAACTTCAACTTGG - Intergenic
1059071098 9:111137051-111137073 CAAGTAACTCAACTGAAAATGGG + Intergenic
1059795484 9:117691484-117691506 CAAATAACTCAATTAGAAAATGG + Intergenic
1060152269 9:121296272-121296294 CAAGTCACTCAACTGGAAAGAGG - Intronic
1060365794 9:123012014-123012036 AAGGTTACACAGCTAGAAATTGG + Intronic
1060509291 9:124220523-124220545 CAAGTCACGCAACTAGTAAATGG + Intergenic
1061124446 9:128665366-128665388 AAAGTTACTCAGCCAGAGATGGG + Intergenic
1185782669 X:2862722-2862744 CAAAGTATTCACCTAGAAATTGG - Intronic
1187807525 X:23137239-23137261 CAAGTCACACAGCTAGAAAGTGG + Intergenic
1188058559 X:25571519-25571541 CAAATAACTCAATTAAAAATAGG - Intergenic
1188076550 X:25783395-25783417 CCAGTTTCTCAACTATAAATTGG + Intergenic
1188287739 X:28348878-28348900 CAAGTAACCCAACTAAAAATGGG - Intergenic
1188799479 X:34510089-34510111 CAACTCTCTCAACTAGGAATGGG + Intergenic
1189913183 X:45831415-45831437 CAGTTTCCTCAACTAGAAAGTGG - Intergenic
1190158364 X:48011930-48011952 CAAGTTGCTCTAATAGAAATTGG + Intronic
1190174135 X:48134812-48134834 CAAGTTGCTCTAATAGAAATTGG + Intergenic
1190623408 X:52311951-52311973 CAATTTCCTCATCTATAAATTGG + Intergenic
1191963641 X:66731162-66731184 AAAGTCACACAACTAGAAAGTGG - Intergenic
1192252546 X:69424720-69424742 CAAGTTCCTCTACTTGAATTTGG - Intergenic
1192596904 X:72419754-72419776 GAAGTTACTCAACATGAAAAAGG - Intronic
1192837992 X:74822553-74822575 CAAGTAAATCAATTAAAAATGGG + Intronic
1194313019 X:92338381-92338403 CAAATTACTCAATTAAAAAAAGG - Intronic
1194731405 X:97459854-97459876 CAAGATACACAACTAGGAAGTGG - Intronic
1195150314 X:102061170-102061192 TCAGTTACTTACCTAGAAATGGG - Intergenic
1195389606 X:104347725-104347747 CAGGTCACACAACTAGAGATTGG + Intergenic
1195629616 X:107041310-107041332 CCAGTTAGTCAACTGGATATTGG + Intergenic
1197326064 X:125095090-125095112 AAAGTGACTCAGCTAGAAAATGG + Intergenic
1197805263 X:130392865-130392887 AAGGTTACCCAACTAGAAAGGGG + Intergenic
1199288520 X:146080732-146080754 CTAGTTACAGAACTAGCAATAGG - Intergenic
1200621284 Y:5452495-5452517 CAAATTACTCAATTAAAAAAAGG - Intronic
1202136814 Y:21674872-21674894 AATGTTACTGAACTAGAAAAAGG + Intergenic
1202597692 Y:26559714-26559736 CAAGTTACTTCTCTAGAAAATGG - Intergenic