ID: 1022302015

View in Genome Browser
Species Human (GRCh38)
Location 7:29110671-29110693
Sequence ATTAAGACACTAACATCTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 655
Summary {0: 1, 1: 1, 2: 15, 3: 89, 4: 549}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022302015_1022302020 18 Left 1022302015 7:29110671-29110693 CCTAAAGATGTTAGTGTCTTAAT 0: 1
1: 1
2: 15
3: 89
4: 549
Right 1022302020 7:29110712-29110734 TAGAGGGCAAAAGAGAATTCAGG No data
1022302015_1022302018 1 Left 1022302015 7:29110671-29110693 CCTAAAGATGTTAGTGTCTTAAT 0: 1
1: 1
2: 15
3: 89
4: 549
Right 1022302018 7:29110695-29110717 CCTAGAATATGTTAGGTTAGAGG 0: 1
1: 0
2: 0
3: 9
4: 89
1022302015_1022302016 -6 Left 1022302015 7:29110671-29110693 CCTAAAGATGTTAGTGTCTTAAT 0: 1
1: 1
2: 15
3: 89
4: 549
Right 1022302016 7:29110688-29110710 CTTAATTCCTAGAATATGTTAGG 0: 1
1: 0
2: 2
3: 27
4: 302
1022302015_1022302019 2 Left 1022302015 7:29110671-29110693 CCTAAAGATGTTAGTGTCTTAAT 0: 1
1: 1
2: 15
3: 89
4: 549
Right 1022302019 7:29110696-29110718 CTAGAATATGTTAGGTTAGAGGG 0: 1
1: 1
2: 1
3: 19
4: 180
1022302015_1022302021 28 Left 1022302015 7:29110671-29110693 CCTAAAGATGTTAGTGTCTTAAT 0: 1
1: 1
2: 15
3: 89
4: 549
Right 1022302021 7:29110722-29110744 AAGAGAATTCAGGTTGCAGATGG 0: 1
1: 3
2: 36
3: 133
4: 514

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022302015 Original CRISPR ATTAAGACACTAACATCTTT AGG (reversed) Intronic
900872570 1:5314539-5314561 ATTAGGACATGGACATCTTTGGG + Intergenic
903316988 1:22515770-22515792 ATTAGGACATGGACATCTTTGGG + Intronic
903376927 1:22872471-22872493 ATTAAGACGTGAACATCTTTGGG + Intronic
907627778 1:56047822-56047844 ATTAATTCAGTAACATCTTCAGG + Intergenic
907647645 1:56260204-56260226 ATCAAGATATGAACATCTTTGGG - Intergenic
908053989 1:60263120-60263142 ATTAAAACACTAATATATTGTGG + Intergenic
908230651 1:62101561-62101583 CTTAAGAAACTACTATCTTTAGG - Intronic
908435038 1:64097474-64097496 ATTAGGACATTCACATTTTTAGG + Intronic
909157932 1:72104170-72104192 ATTAGGACATAGACATCTTTGGG - Intronic
909297992 1:73975371-73975393 ATTAAGACTTCAGCATCTTTGGG + Intergenic
909742446 1:79046985-79047007 ATTAAGACACTACCAATTTTGGG - Intergenic
909973786 1:82022017-82022039 ATTAGGACATGGACATCTTTGGG - Intergenic
910144799 1:84067245-84067267 ATTAGGACATGGACATCTTTGGG + Intergenic
910205533 1:84745453-84745475 ATTAGGACACAGACATCTTGGGG - Intergenic
910283070 1:85523031-85523053 AATAAAACACTAACAGCTGTTGG + Intronic
910703797 1:90105013-90105035 ATTAAAACACACTCATCTTTGGG - Intergenic
911217168 1:95207527-95207549 ATTAGGACATGGACATCTTTGGG - Intronic
911740334 1:101380003-101380025 TTTAAGACACAGACATATTTGGG + Intergenic
912465604 1:109871361-109871383 ATTAGGACATAGACATCTTTGGG - Intergenic
912600233 1:110923385-110923407 ATTTGGACATCAACATCTTTGGG + Intergenic
912819748 1:112857326-112857348 ATTAAAACATGGACATCTTTGGG - Intergenic
914206944 1:145539958-145539980 AATAAAACACTAACAGCTGTTGG - Intergenic
915775398 1:158479549-158479571 ATTAAAACATAGACATCTTTGGG - Intergenic
916319190 1:163483914-163483936 ATTAGGACAGAAATATCTTTGGG + Intergenic
917129807 1:171729624-171729646 ATTAGGAAATGAACATCTTTGGG - Intronic
917137324 1:171800189-171800211 ATTAGGACATGGACATCTTTGGG - Intronic
917278668 1:173357949-173357971 ATTAGGACATGAACATCTTTTGG - Intergenic
917839665 1:178967574-178967596 ATTAGGACACAGACATCTTCAGG - Intergenic
917904815 1:179578124-179578146 GTTAAGAAACTGACATCTGTGGG + Intergenic
918667225 1:187166626-187166648 ATTAAGACAGTAACATTATATGG + Intergenic
918896626 1:190356763-190356785 ATTAAGACATAGACATCTGTGGG + Intronic
918985639 1:191622075-191622097 ATGGGGACACTAACCTCTTTTGG - Intergenic
919093652 1:193003454-193003476 AGTAAGTCACTCACATCTTCAGG + Intergenic
919126593 1:193401737-193401759 TTTAAGCCACTAACATTTTGGGG + Intergenic
919126820 1:193404936-193404958 ATTAGGACGTGAACATCTTTGGG - Intergenic
919319614 1:196018817-196018839 ATTAAGCCTCTAACATTTGTGGG + Intergenic
919367101 1:196675404-196675426 AATCACACACTAACAACTTTTGG + Intronic
919600709 1:199618774-199618796 ATTAGGAAACTTATATCTTTAGG - Intergenic
920617470 1:207507616-207507638 ATTAAGACATCAATATATTTCGG + Intronic
921407957 1:214801533-214801555 ATTAGGACTTCAACATCTTTTGG - Intergenic
921550187 1:216526225-216526247 GTTAGGACTCTAACATCTTTTGG - Intronic
921795359 1:219337268-219337290 ATTATGACACAGACATCTTTTGG + Intergenic
921897556 1:220416131-220416153 ATTAAGCCTCTTATATCTTTAGG + Intergenic
921925100 1:220704712-220704734 ATTAATACACTAAAATGTTAAGG + Intergenic
922340243 1:224649076-224649098 ATTAGGACATGAACATCTTTGGG - Intronic
922370706 1:224907845-224907867 ATTTAGACATGAACATCTTTGGG + Intronic
922932604 1:229402194-229402216 ATTAGGACACAGACATCTTTGGG + Intergenic
923397112 1:233577211-233577233 ATTCTGACATGAACATCTTTAGG + Intergenic
923503216 1:234583522-234583544 ATTAAGAGACAAAAATCTGTGGG + Intergenic
923890698 1:238212335-238212357 ATTAAGACACCTATTTCTTTGGG + Intergenic
923899367 1:238309175-238309197 ATTAGAACATGAACATCTTTGGG - Intergenic
924007649 1:239629630-239629652 AGTAAGTCACAAACATTTTTTGG - Intronic
1063284696 10:4673330-4673352 ATTAAGACAATAAGCACTTTAGG - Intergenic
1064897113 10:20249728-20249750 ATTAGGACATGGACATCTTTGGG + Intronic
1065474956 10:26125322-26125344 ATTAAGACATTTTCATTTTTGGG + Intronic
1065598820 10:27347609-27347631 TTTAAGACAGTAAAACCTTTTGG + Intergenic
1066485509 10:35839144-35839166 ATTAATATACTAATTTCTTTTGG + Intergenic
1066779739 10:38931357-38931379 ATTAGGACATGAACATTTTTGGG + Intergenic
1068043436 10:51856278-51856300 ATTATGACATGGACATCTTTGGG + Intronic
1068372521 10:56136407-56136429 ATTAGGACATTGACATCTTTGGG - Intergenic
1068571619 10:58636061-58636083 ATTGAGACACTCAAATGTTTTGG + Intronic
1068633331 10:59321087-59321109 ATGAAGACATGGACATCTTTGGG - Intronic
1068801607 10:61146826-61146848 TTTAAGTCACTAAGATCTTATGG - Intergenic
1069028652 10:63571688-63571710 ATTAAGACACAGACATCTTTAGG + Intronic
1069510217 10:69036537-69036559 ATTAAGACATGGACATCTTTGGG + Intergenic
1069675393 10:70243160-70243182 AGGAAGCCACTATCATCTTTAGG + Intergenic
1069970187 10:72161289-72161311 AGTGGGACATTAACATCTTTGGG - Intronic
1070118779 10:73555146-73555168 ATTAAGACATTAATAACTTTTGG - Intronic
1071087988 10:81885994-81886016 ATTAAAAAACTAACACATTTCGG + Intronic
1071927930 10:90432430-90432452 ATTAGGACATGAATATCTTTAGG + Intergenic
1073808043 10:107121437-107121459 ATTCATACAATGACATCTTTGGG + Intronic
1073858410 10:107705996-107706018 CTTCAGACAATTACATCTTTAGG - Intergenic
1075015891 10:118909797-118909819 AGTAAGACCCTGACATCTTTGGG - Intergenic
1075260087 10:120955744-120955766 ATTAAGACACTAAAGTTTTAGGG + Intergenic
1075955140 10:126517083-126517105 ATTAAGACATGAACATCTTTGGG + Intronic
1076292413 10:129356954-129356976 ATTAGGGCACAGACATCTTTTGG - Intergenic
1076419786 10:130322883-130322905 ATGAAGACACTCACATTATTAGG + Intergenic
1078837063 11:15041058-15041080 ATTAGGACATGGACATCTTTGGG + Intronic
1078911631 11:15738082-15738104 ATTAGGAAACTAACTTTTTTTGG + Intergenic
1079147857 11:17869793-17869815 ATTAGGACATGGACATCTTTAGG - Intronic
1079345163 11:19645446-19645468 ATTCAGACGTGAACATCTTTGGG + Intronic
1079516851 11:21280015-21280037 ATGAAGACAGTAAAATCTTCAGG + Intronic
1080131538 11:28801365-28801387 ACTATGACACGGACATCTTTCGG + Intergenic
1081350503 11:42046077-42046099 ATTAGGACGTTGACATCTTTGGG - Intergenic
1081417841 11:42837036-42837058 ATTATGACATGGACATCTTTGGG - Intergenic
1083287928 11:61672562-61672584 ATTAGGACACAGTCATCTTTGGG + Intergenic
1083830460 11:65228974-65228996 ATAAAGATTCAAACATCTTTGGG - Intergenic
1084413503 11:69017236-69017258 ATTAGGACATCAACATCTTTAGG - Intergenic
1084580912 11:70022729-70022751 ATCAGGACACAGACATCTTTGGG - Intergenic
1084793076 11:71487064-71487086 ATTAAGACACTCACACTCTTTGG - Intronic
1085336922 11:75703436-75703458 ATTCAAACATGAACATCTTTGGG + Intergenic
1085789421 11:79484307-79484329 ATTAGGACATAGACATCTTTGGG + Intergenic
1086005804 11:82034081-82034103 ATTAAGACCCTGAAATCTTTAGG - Intergenic
1086195059 11:84127914-84127936 ATTAAGACTTCAACATCTTTTGG + Intronic
1086994806 11:93343993-93344015 ATGATGACAGTAACATTTTTTGG + Intronic
1087021893 11:93611354-93611376 ATTAGGACATGGACATCTTTGGG + Intergenic
1087249722 11:95884173-95884195 ATTAAAACACTACCATTTTATGG + Intronic
1087275736 11:96158858-96158880 GTTAAGAGAATAAAATCTTTGGG + Intronic
1087327321 11:96739674-96739696 GTTAAGCCACTAACATTTTCAGG - Intergenic
1087710077 11:101538494-101538516 ATTAAGGCACAGACATCTTTGGG - Intronic
1087770586 11:102205495-102205517 AAGAAGCAACTAACATCTTTTGG - Intronic
1087982559 11:104634224-104634246 ATTAGGACATTGACATCTTGGGG - Intergenic
1088120129 11:106359416-106359438 GTTAAGACATCAACATATTTTGG - Intergenic
1088601142 11:111477158-111477180 ATTAATACACTAACAGCTGCAGG + Intronic
1090302413 11:125655117-125655139 AACAAGAGACAAACATCTTTAGG - Intronic
1092023933 12:5225100-5225122 ATTATGACAGCAACTTCTTTGGG - Intergenic
1092654487 12:10670949-10670971 ATTAGGACATGGACATCTTTGGG - Intronic
1092695510 12:11167118-11167140 ATTAAGTCATAGACATCTTTGGG + Intronic
1093168002 12:15828094-15828116 ATTAGGACATGGACATCTTTGGG - Intronic
1093386892 12:18568180-18568202 ATTAGGACATGAACATCTTTTGG + Intronic
1093590018 12:20891340-20891362 AATAAGACCCTAATTTCTTTTGG + Intronic
1093636316 12:21473981-21474003 ATTAGGACGTGAACATCTTTGGG + Intronic
1093914143 12:24781779-24781801 ATTAAGACACAGACATCTTTTGG + Intergenic
1094171689 12:27499795-27499817 ATTTATACACTAACATCTTGAGG + Intronic
1094212762 12:27909947-27909969 ATTAATATACTTACATGTTTGGG + Intergenic
1094232650 12:28125414-28125436 ATTAAAACAGAAACATATTTTGG - Intergenic
1094585357 12:31772673-31772695 ATTAGGACACGAACATGTTTAGG + Intergenic
1095591030 12:43904398-43904420 TTTAAAACACTAATATCATTAGG - Intronic
1095893733 12:47259335-47259357 ATTACGACATAGACATCTTTGGG + Intergenic
1096760675 12:53839483-53839505 CTTCTAACACTAACATCTTTGGG + Intergenic
1097354120 12:58582564-58582586 ATTAAGATGTGAACATCTTTAGG - Intronic
1098449777 12:70607422-70607444 ATTAAGAAACCAACAACATTTGG + Intronic
1098473227 12:70869504-70869526 ATTAAAACACAGACCTCTTTGGG - Intronic
1098516804 12:71386895-71386917 ATTAGGACATAAACATCTTTGGG - Intronic
1099426232 12:82526546-82526568 ATTAATACTCTGACATTTTTAGG + Intergenic
1099714613 12:86275467-86275489 ATTAAGACATGGACATCTTCGGG - Intronic
1099742404 12:86656725-86656747 AATAGAACACAAACATCTTTTGG + Intronic
1099821891 12:87722627-87722649 ATTAGGACACGAAGCTCTTTGGG - Intergenic
1099887657 12:88551752-88551774 ATTAGGACATGGACATCTTTGGG - Intronic
1100263560 12:92954704-92954726 ATTAAGACAGGTGCATCTTTGGG - Intergenic
1100478233 12:94953558-94953580 ACTGAGACACAGACATCTTTTGG - Intronic
1100777856 12:97991929-97991951 ATTAAGACATGGACATCTTTGGG + Intergenic
1100897257 12:99197443-99197465 ATTAAGGCATGAACATCTTTGGG - Intronic
1101212739 12:102550982-102551004 ATAAAAACACTGACATCTTTTGG - Intergenic
1101481619 12:105103531-105103553 ATTAGGACATGAACATCTTTGGG - Intergenic
1101787946 12:107902505-107902527 AGTAAGACTCAAACATGTTTTGG + Intergenic
1101817242 12:108154589-108154611 ATTAGGACACGGATATCTTTGGG + Intronic
1102399130 12:112613444-112613466 ATTAGGACATGGACATCTTTGGG - Intronic
1103981590 12:124740294-124740316 ATTAGGACATGGACATCTTTGGG + Intergenic
1104054062 12:125215958-125215980 ATTAGGACATGCACATCTTTGGG + Intronic
1104170339 12:126274498-126274520 ATTAGGATGCGAACATCTTTTGG + Intergenic
1104368284 12:128197984-128198006 ATTAGGACATGGACATCTTTGGG - Intergenic
1104372038 12:128231974-128231996 GTTAAGCCACTAACATTTTGAGG + Intergenic
1104589672 12:130074365-130074387 ATGGAGACAATAACATCTATAGG - Intergenic
1105233824 13:18526775-18526797 ATTAGGACATGAACATTTTTGGG + Intergenic
1105513574 13:21071766-21071788 ATTAAGGCATGGACATCTTTGGG - Intergenic
1106493921 13:30257028-30257050 ATTATTACATTATCATCTTTAGG + Intronic
1107752601 13:43584980-43585002 ATTAGGACGTTCACATCTTTGGG - Intronic
1107821890 13:44293410-44293432 TTTAAGATACTGATATCTTTTGG - Intergenic
1108920115 13:55662426-55662448 ATTAAGACAGAGACATCATTGGG - Intergenic
1109202493 13:59446351-59446373 ATTAGGACTTCAACATCTTTTGG + Intergenic
1109287142 13:60423022-60423044 ATTAAGATAATAAAATCCTTAGG + Intronic
1109349087 13:61153844-61153866 ATTAGGACATGAACATCTTTTGG - Intergenic
1109365353 13:61348542-61348564 ATTAGGACATTTACATCTTTGGG + Intergenic
1109400261 13:61818209-61818231 ATTAAAACAATAAAATATTTAGG + Intergenic
1110305909 13:73986542-73986564 ATTAGGACATGGACATCTTTAGG - Intronic
1110614546 13:77526892-77526914 ATTAGGATATGAACATCTTTGGG - Intergenic
1110800206 13:79685266-79685288 AATAAGACTCTAACATCTAATGG - Intergenic
1111069162 13:83140960-83140982 ATTAAAAAAAAAACATCTTTTGG - Intergenic
1111931247 13:94515134-94515156 ATCAAGACACCAACATCGTTGGG - Intergenic
1112624942 13:101093318-101093340 ATTAAGAAAATAACATATCTAGG - Intronic
1112834524 13:103497784-103497806 ATTAGGACATAGACATCTTTGGG + Intergenic
1113020637 13:105882347-105882369 ATTTATACAATAACATCTATAGG - Intergenic
1113213682 13:108013020-108013042 ATTAAGACAGGGGCATCTTTTGG - Intergenic
1113504344 13:110803830-110803852 AGTAAGAAAGTAACATCTTTTGG + Intergenic
1113673416 13:112190806-112190828 ATTAAGACACACATATTTTTTGG + Intergenic
1114067016 14:19069355-19069377 ATTAAGTCAGCAACATCTTAAGG - Intergenic
1114095249 14:19330673-19330695 ATTAAGTCAGCAACATCTTAAGG + Intergenic
1114273618 14:21121194-21121216 ATTAAAACACTAAAATGCTTAGG - Intergenic
1114944302 14:27659666-27659688 TTTAAGACATCAACATATTTTGG - Intergenic
1114967396 14:27980192-27980214 ATTAAAACAGCAACATATTTAGG + Intergenic
1115741890 14:36397690-36397712 GCTAGGACATTAACATCTTTTGG + Intergenic
1115886901 14:37982161-37982183 ATTAGGACACAAATATCTTTTGG - Intronic
1116062490 14:39941487-39941509 ATTAGGACATGGACATCTTTGGG + Intergenic
1116105912 14:40505005-40505027 ATTATGGCATGAACATCTTTGGG + Intergenic
1116114653 14:40631482-40631504 TTTAAAACACTAATGTCTTTAGG - Intergenic
1116231370 14:42222156-42222178 ATTAGGACATGAGCATCTTTAGG - Intergenic
1116254931 14:42540925-42540947 AGTAAGACAATAACATCTCATGG + Intergenic
1116515751 14:45803060-45803082 ATTAGGACACTAAACTCTTTGGG - Intergenic
1117059464 14:51947229-51947251 ATTGGGACATGAACATCTTTGGG - Intronic
1117794613 14:59379544-59379566 ATTAGGACATGAACATTTTTGGG - Intergenic
1118439431 14:65799333-65799355 ATTAAAACAATAACAGCTATTGG + Intergenic
1118447402 14:65864141-65864163 ATTAGGACATGAACATCATTTGG + Intergenic
1118468563 14:66054016-66054038 ATTAGGACACGGGCATCTTTGGG + Intergenic
1119206160 14:72795110-72795132 ATTAGGACATGGACATCTTTGGG + Intronic
1119677658 14:76567851-76567873 ATTAAGACATGAACATTTGTAGG - Intergenic
1119679303 14:76579989-76580011 ATTAGGACATGAACATCTTCAGG + Intergenic
1119680545 14:76589354-76589376 ATTAAAACATGAACATCTCTGGG + Intergenic
1120827528 14:88969181-88969203 ATTAGGACATGGACATCTTTGGG - Intergenic
1121141517 14:91546661-91546683 ATTAAGGCACTAGCAGATTTGGG - Intergenic
1121571195 14:94947766-94947788 ATTAGGACATGGACATCTTTGGG - Intergenic
1122349926 14:101083181-101083203 ATTAGGACATGGACATCTTTGGG - Intergenic
1202937513 14_KI270725v1_random:104897-104919 ATTAGGACATGAACATTTTTGGG - Intergenic
1124131241 15:26987838-26987860 ATTAAAACACTGAAATCTATAGG - Intronic
1124164152 15:27304806-27304828 ATTAGGACACAGACATCTTTAGG + Intronic
1124181847 15:27483484-27483506 GTTAGGACTCTAACATCTTCAGG + Intronic
1124694716 15:31854400-31854422 ATTAGGACAGGAACATCTCTGGG + Intronic
1125134419 15:36325243-36325265 ATTAGGACATGAACATATTTGGG - Intergenic
1125356344 15:38820572-38820594 ATGAAGACATGGACATCTTTGGG + Intergenic
1126277793 15:46904423-46904445 ATTAAGATATGGACATCTTTGGG + Intergenic
1126424699 15:48514851-48514873 ATTAAGACATGAGCATATTTGGG - Intronic
1126729515 15:51668492-51668514 ATTAAGACAAGAACATCTTTGGG - Intergenic
1126823034 15:52523574-52523596 AATAAGACAGAAACATGTTTGGG + Intronic
1127057806 15:55150427-55150449 ATTAGGATATGAACATCTTTGGG - Intergenic
1127159885 15:56171278-56171300 ATTAAGACATGAACATTTCTGGG - Intronic
1128480181 15:68030725-68030747 ATTAGGACATGGACATCTTTGGG - Intergenic
1128984990 15:72213402-72213424 ATTCAGCCACTAAAATCATTTGG + Intronic
1128986769 15:72227893-72227915 ATTAAGAAATAAACAGCTTTAGG + Intronic
1129128555 15:73468154-73468176 ATTAGGACATAGACATCTTTAGG + Intronic
1129222335 15:74138504-74138526 TTTAAGACAGTAAAACCTTTAGG + Intronic
1130213824 15:81950127-81950149 ATTAGTACACAGACATCTTTAGG + Intergenic
1131707276 15:95011495-95011517 ATTAGGACACCAACATTTTTGGG - Intergenic
1134284234 16:12846258-12846280 ATTAGGACGTGAACATCTTTGGG + Intergenic
1134401954 16:13918432-13918454 ATTAGGATATGAACATCTTTGGG + Intergenic
1135600933 16:23782736-23782758 ATTAAGAAAATCACATCTCTGGG + Intergenic
1136737785 16:32478363-32478385 ATTAGGACATGAACATTTTTGGG - Intergenic
1136938490 16:34499144-34499166 ATTAGGACATGAACATTTTTGGG - Intergenic
1136961329 16:34849413-34849435 ATTAGGACATGAACATTTTTGGG + Intergenic
1137218737 16:46426998-46427020 ATTAGGACATGAACATTTTTGGG - Intergenic
1137391461 16:48084799-48084821 ATCAGGACATTAACATCTTTGGG + Intronic
1140042954 16:71421542-71421564 ATGAAGACAATAAAATCTTGAGG + Intergenic
1140739599 16:77929577-77929599 CTCAAGACACTAACATTTTCAGG + Intronic
1141018751 16:80475063-80475085 ATTAAGATGGGAACATCTTTGGG + Intergenic
1141487359 16:84349657-84349679 ATTAGGACATGGACATCTTTTGG - Intergenic
1141741698 16:85898049-85898071 ATTATGAAATTAACATGTTTTGG + Intergenic
1203015288 16_KI270728v1_random:351214-351236 ATTAGGACATGAACATTTTTGGG + Intergenic
1203033623 16_KI270728v1_random:624372-624394 ATTAGGACATGAACATTTTTGGG + Intergenic
1143157361 17:4846545-4846567 CTAGAGACACTAACATCCTTAGG + Intronic
1143365309 17:6404431-6404453 ATTAGGACACGGGCATCTTTGGG + Intronic
1143891633 17:10106789-10106811 ATTAAGATATTAATATATTTGGG - Intronic
1144598043 17:16588222-16588244 TTTAAGACAGTAAAACCTTTTGG + Intergenic
1144749040 17:17635484-17635506 ATTAGGATATGAACATCTTTTGG - Intergenic
1145709059 17:26952032-26952054 ATTAGGACATGAACATTTTTGGG + Intergenic
1146367782 17:32242722-32242744 ATGAAAACACCAACATCTCTGGG + Intronic
1147215771 17:38898233-38898255 ATTACGAGTCTAACACCTTTTGG + Intronic
1148022399 17:44562130-44562152 AATAAGACAGTTCCATCTTTTGG + Intergenic
1148791040 17:50172985-50173007 ATTTAAACACTAACATCTACTGG + Intronic
1149036328 17:52138406-52138428 ATTAGGACACAAACATCTTTGGG + Intronic
1149039202 17:52167564-52167586 ATTAGGATGTTAACATCTTTAGG + Intergenic
1149671861 17:58420681-58420703 ATCAAGACACCTATATCTTTTGG - Exonic
1149854289 17:60066517-60066539 AATAACACATTGACATCTTTAGG - Intronic
1151285005 17:73104514-73104536 ATTAGGACATGGACATCTTTAGG - Intergenic
1151529337 17:74694700-74694722 ATTAGGACACAGATATCTTTGGG + Exonic
1153711441 18:7803536-7803558 ATTAAGACACGGACATCATTGGG + Intronic
1154519193 18:15208673-15208695 ATTAGGACATGAACATTTTTGGG - Intergenic
1155813856 18:30277767-30277789 CTTATGACAGTAAAATCTTTTGG + Intergenic
1155831906 18:30526500-30526522 ATTAGGACATGGACATCTTTAGG + Intergenic
1155858808 18:30869652-30869674 ATTAATACACTAAAAGATTTGGG - Intergenic
1156881887 18:42090034-42090056 ATTAAGACTCTAAATTCTGTTGG - Intergenic
1157079726 18:44510054-44510076 ATTGAGACACTACCAGCCTTGGG - Intergenic
1157411931 18:47470322-47470344 ATAAAGAGACTAACATATATGGG + Intergenic
1157433841 18:47652244-47652266 GTTAAGACTTCAACATCTTTTGG + Intergenic
1157848633 18:51027490-51027512 TTTAAGACAGTAAAACCTTTTGG - Intronic
1157890768 18:51415583-51415605 CTTAAAACACAAACACCTTTTGG + Intergenic
1158715794 18:59878581-59878603 TTTAAGAGAATAAAATCTTTAGG + Intergenic
1159059129 18:63496295-63496317 TTTAAGACAATATCCTCTTTAGG + Intronic
1159325873 18:66916580-66916602 ATTAGGACATGTACATCTTTGGG + Intergenic
1159390813 18:67789721-67789743 AATTATACACTAACAACTTTAGG + Intergenic
1159739877 18:72154092-72154114 ATTAATTCATTCACATCTTTTGG + Intergenic
1159753334 18:72330213-72330235 ATTAGGACTTTAACATCTTTTGG + Intergenic
1162323625 19:9985777-9985799 ATTCAGAGACTAACATCTGGGGG - Intronic
1167276451 19:48543149-48543171 ATTAGGACCCGAACATCTCTTGG + Intergenic
1168050376 19:53825307-53825329 ATTAGGACATGAATATCTTTGGG - Intergenic
926124764 2:10265305-10265327 ATTAGGACGCGGACATCTTTGGG + Intergenic
926136723 2:10341756-10341778 TTTAAGACAGTCACATCTCTTGG - Intronic
926591038 2:14740632-14740654 ATTAGGACATGGACATCTTTAGG - Intergenic
927093017 2:19726824-19726846 ATTATGACACGGACACCTTTGGG - Intergenic
927231993 2:20833467-20833489 ATTAGGACATGGACATCTTTGGG - Intergenic
927479622 2:23441947-23441969 ATTAGGACATGGACATCTTTGGG - Intronic
928302188 2:30135518-30135540 CTCAAGACTTTAACATCTTTGGG + Intergenic
928340588 2:30439873-30439895 ATTAGGACAGGGACATCTTTGGG - Intergenic
928650738 2:33401141-33401163 ATTAGGACACGGAAATCTTTGGG - Intergenic
929489045 2:42380267-42380289 ATTAGGACACAGACATTTTTAGG + Intronic
930010128 2:46931112-46931134 ATTAGGACATAAACATCTTTGGG - Intronic
930126066 2:47797767-47797789 ATGAAGACAATAACATCTTGAGG - Intronic
930262730 2:49166248-49166270 ATTCAGACAAGAACATCTTTAGG + Intergenic
930268019 2:49222700-49222722 ATTAGGACATGAACATCTTTGGG + Intergenic
930476372 2:51887807-51887829 ATTAAGACACTGATATGGTTTGG - Intergenic
930620053 2:53634397-53634419 ATTAAGACTCTAACATCTTGTGG + Intronic
930688653 2:54336070-54336092 CTTAAATCACGAACATCTTTAGG + Intronic
930858637 2:56045688-56045710 ATTAAGAACCTCCCATCTTTTGG + Intergenic
931708341 2:64966548-64966570 ATTAGGACTCAAACATATTTGGG + Intergenic
931800251 2:65751094-65751116 ATTAAGACAAGGAGATCTTTGGG + Intergenic
931908898 2:66872707-66872729 ATTAAGAGGCTAACCTCTTATGG - Intergenic
932253660 2:70266084-70266106 ATTAAGACATGGACATCTTGTGG - Intronic
933367760 2:81375653-81375675 ATTAAGACATAAACATCTTTGGG - Intergenic
933527110 2:83455750-83455772 ATTAAGACATGGACATCTTTGGG - Intergenic
933580314 2:84118294-84118316 ATTAAACCACTAAGATTTTTAGG + Intergenic
933627050 2:84612857-84612879 ATTAGGACATGAACATCTCTAGG + Intronic
933840080 2:86279497-86279519 ATTAGGACATGGACATCTTTGGG - Intronic
934034103 2:88074533-88074555 ATTAAGACATTGACAATTTTTGG + Intronic
934053621 2:88232858-88232880 ATTAACACAGAGACATCTTTGGG - Intergenic
934188904 2:89767476-89767498 ATTAGGACACGAACATTTTTGGG - Intergenic
934307684 2:91840477-91840499 ATTAGGACATGAACATTTTTCGG + Intergenic
934331809 2:92075121-92075143 ATTAAGACATGAACATTTCTGGG + Intergenic
935485370 2:103646810-103646832 ATTAGGACATGAACATCATTAGG - Intergenic
935988687 2:108699376-108699398 GTTAAGACGCAAACATATTTAGG - Intergenic
936604549 2:113936890-113936912 ATTAAGACACAGACATGTATGGG - Intronic
936620027 2:114086213-114086235 TTTAAGTCACTAAGATTTTTGGG - Intergenic
936689352 2:114868030-114868052 AATCAGACACTCACATCTTCTGG + Intronic
937113276 2:119384073-119384095 ATTCAGACACGAACCTCTCTGGG - Intergenic
937454345 2:122028296-122028318 ATAAAGACACACGCATCTTTAGG + Intergenic
937809848 2:126187105-126187127 ATTAAGAGACTGACAACTTTTGG - Intergenic
938146853 2:128841738-128841760 ATTAAGACACAGCCATCTTTGGG - Intergenic
938484411 2:131689447-131689469 ATTAAGTCAGCAACATCTTAAGG - Intergenic
938516133 2:132009666-132009688 ATTAGGACATGAACATTTTTGGG - Intergenic
938519189 2:132049308-132049330 ATTAGGACATGAACATTTTTGGG - Intergenic
939268166 2:139902896-139902918 ATTAAGTCACTGATATCTGTAGG - Intergenic
939554056 2:143652856-143652878 ATTAAGACAATAATATTTTTTGG + Intronic
940068395 2:149655338-149655360 ATTAGGATATGAACATCTTTAGG - Intergenic
940487586 2:154315649-154315671 ATTAAAACATAAACATTTTTAGG - Intronic
940804134 2:158166836-158166858 ATTAGGAAATTGACATCTTTGGG - Intergenic
941304012 2:163838748-163838770 ATTAGGACATGAACATCTTTGGG - Intergenic
941459617 2:165753540-165753562 ATTTAGACTCTAACTCCTTTAGG - Intronic
943241614 2:185391409-185391431 ATTAGGACATGAATATCTTTGGG + Intergenic
943375879 2:187076145-187076167 ATTAAGACATGGACATCTCTGGG - Intergenic
943404778 2:187467138-187467160 TTTAAATCAATAACATCTTTTGG - Intronic
944108299 2:196103228-196103250 ATTAGGACATTGACATCTTTGGG - Intergenic
944626274 2:201572180-201572202 AAGAAGACACTAACATTTATTGG + Intronic
944630879 2:201622772-201622794 ATTAGGACATGGACATCTTTAGG + Exonic
945748255 2:213746192-213746214 ATTAAGCCACTGAAGTCTTTTGG + Intronic
945897637 2:215502628-215502650 ATTAGGATACCGACATCTTTTGG + Intergenic
946033110 2:216720742-216720764 ATTAGGACATGGACATCTTTGGG + Intergenic
946585653 2:221184684-221184706 ATTAGGACATAGACATCTTTAGG - Intergenic
946657182 2:221961044-221961066 ATTAGGACATGAACGTCTTTGGG + Intergenic
947039922 2:225905615-225905637 ATTAAGAGATTAACAGCTATAGG - Intergenic
947043964 2:225956830-225956852 AATAAAACACTATTATCTTTCGG - Intergenic
947425937 2:229982871-229982893 ATTAGGACATGGACATCTTTGGG + Intronic
947982579 2:234423175-234423197 ATTAGGACATGGACATCTTTTGG - Intergenic
948006797 2:234616284-234616306 ATGAAGACACTAGAATCTGTGGG + Intergenic
948193935 2:236081001-236081023 ATTAGGACGTTGACATCTTTGGG + Intronic
948436824 2:237959449-237959471 ATTAGGACAAGGACATCTTTAGG + Intergenic
1169499459 20:6145506-6145528 ATTAGGACAGGGACATCTTTGGG - Intergenic
1169713594 20:8591277-8591299 ATTAAGACATAGACAACTTTGGG + Intronic
1170517655 20:17148636-17148658 ATTAAGGCATGGACATCTTTGGG + Intergenic
1173013623 20:39205038-39205060 ATTAGGACGTAAACATCTTTGGG + Intergenic
1173116143 20:40244967-40244989 ATTTAGACACTCATATCTTGGGG - Intergenic
1173281956 20:41636582-41636604 ATTAAGATATGAACATCTTTGGG - Intergenic
1173488059 20:43456187-43456209 ATTAGGACATAGACATCTTTAGG + Intergenic
1174311286 20:49656860-49656882 TTCAGGACACCAACATCTTTTGG + Intronic
1174433584 20:50489228-50489250 ATTAGGGCACAGACATCTTTGGG + Intergenic
1174481234 20:50832949-50832971 ACTAGGACATGAACATCTTTGGG + Intronic
1174539742 20:51279605-51279627 ATTAGGACATAGACATCTTTGGG - Intergenic
1174690567 20:52500140-52500162 ATTAAGAGGCTGACATTTTTTGG - Intergenic
1174705320 20:52649367-52649389 ATTAAGACACTAGCATCCTCAGG - Intergenic
1175075404 20:56368124-56368146 TTTAAGACAGTAAAACCTTTTGG - Exonic
1175231158 20:57474249-57474271 ATTAGGACATGGACATCTTTGGG - Intergenic
1175478731 20:59296325-59296347 ATTAGGACATGGACATCTTTGGG + Intergenic
1175496007 20:59414717-59414739 TTTAAGACATGGACATCTTTGGG + Intergenic
1175622497 20:60460918-60460940 ATTAAGACAGTGACATGGTTTGG + Intergenic
1175667627 20:60873602-60873624 ATTAGGACATGGACATCTTTAGG + Intergenic
1175721659 20:61291232-61291254 ATAAAGACACTCACAGCTTCTGG - Intronic
1176720641 21:10389982-10390004 ATTAGGACATGGACATCTTTGGG - Intergenic
1176742527 21:10617038-10617060 ATTAGGACATGAACATTTTTGGG + Intergenic
1176777809 21:13155052-13155074 ATTAGGACATGAACATTTTTGGG + Intergenic
1177036754 21:16054210-16054232 ATTAAGACATGGACATCTTTGGG - Intergenic
1177369618 21:20184741-20184763 ATTAAGAATTTTACATCTTTAGG + Intergenic
1177582914 21:23050951-23050973 ATTAAGAGATGGACATCTTTGGG - Intergenic
1177591381 21:23172835-23172857 TTTAAGACATTAGCATCTCTTGG - Intergenic
1178182538 21:30179429-30179451 ATTAAGATGTGAACATCTTTGGG - Intergenic
1179355486 21:40654876-40654898 ATTAGGACACGCACATCTTTAGG + Intronic
1179596809 21:42448456-42448478 ATTAGGACATGAACATCTTTGGG + Intergenic
1180301781 22:11042477-11042499 ATTAAGACATGGATATCTTTGGG - Intergenic
1180301842 22:11042825-11042847 ATTAGGACATGGACATCTTTGGG - Intergenic
1180301947 22:11043459-11043481 ATTAGGACATGGACATCTTTGGG - Intergenic
1180485493 22:15791939-15791961 ATTAAGTCAGCAACATCTTAAGG - Intergenic
1180525395 22:16254410-16254432 ATTAGGACATGAACATTTTTGGG + Intergenic
1180534764 22:16387559-16387581 ATTAGGACATGAACATTTTTCGG + Intergenic
1180570725 22:16716337-16716359 ATTAGGCCAAGAACATCTTTTGG - Intergenic
1181665000 22:24388746-24388768 ATTAAGACATCAACAGCTTATGG + Intronic
1182160596 22:28117316-28117338 ATTAAGCCACTAAGATTTATGGG + Intronic
1182409107 22:30167364-30167386 TTTAGGACATGAACATCTTTGGG + Intronic
1182517286 22:30866112-30866134 ATTAGGACATGGACATCTTTGGG - Intronic
1184298155 22:43539239-43539261 ATTAGGACACAGGCATCTTTGGG + Intronic
1203237676 22_KI270732v1_random:21581-21603 ATTAGGACATGAACATTTTTGGG + Intergenic
949107936 3:223128-223150 ACTAGGACACGAACATCTTTGGG + Intronic
949264542 3:2141168-2141190 ATTAGGACACTGGCATCTTTGGG - Intronic
951377938 3:21945688-21945710 ATTAAGAAACTTACATCAATTGG - Intronic
952196803 3:31084470-31084492 ATTAGGACATGAACATCTTTGGG - Intergenic
953138745 3:40207474-40207496 ATTAAGAGAAAAACATCTATTGG - Intronic
953235530 3:41103199-41103221 ATTAAGAGAAAAAAATCTTTTGG - Intergenic
953686808 3:45084347-45084369 ATTAGGACCAGAACATCTTTGGG - Exonic
953806156 3:46069680-46069702 ATTAAGAAAATAACCTCTCTTGG + Intergenic
953852315 3:46473847-46473869 ATTAGGACATGGACATCTTTGGG + Intronic
954073720 3:48161413-48161435 ATTAAGAGAATAGCATCTTTTGG + Intronic
954453490 3:50584354-50584376 ATTAAGACACTGCCATTTTGGGG - Exonic
954924334 3:54219023-54219045 ATTAGGACATGGACATCTTTGGG + Intronic
955223188 3:57039948-57039970 ATTAGGTCAGAAACATCTTTTGG + Intronic
955598528 3:60618626-60618648 ATTAAAACGTTGACATCTTTAGG - Intronic
955863642 3:63358570-63358592 ATTAGAACATGAACATCTTTAGG + Intronic
955866674 3:63391335-63391357 ACTAAGATACGAACATCCTTTGG - Intronic
956721934 3:72125625-72125647 ATTAGGACCCAAACATCTTTGGG - Intergenic
957107842 3:75913367-75913389 ATTAGGCCAAGAACATCTTTTGG + Intronic
957156073 3:76546378-76546400 ATTAAGACATAGGCATCTTTGGG - Intronic
957588891 3:82170119-82170141 ATCAAGTAACTAACATTTTTAGG + Intergenic
957757881 3:84514158-84514180 ACCAACACACTAAAATCTTTGGG - Intergenic
957908963 3:86596787-86596809 ATTATAACAATAACCTCTTTAGG + Intergenic
959581253 3:107984741-107984763 AGTTAGACAGTAAAATCTTTAGG - Intergenic
960327089 3:116310716-116310738 GTTATGACATTAAGATCTTTAGG - Intronic
960503351 3:118464289-118464311 ATTAGGACACAGACATCTTTCGG - Intergenic
961586318 3:127929657-127929679 ATGAAGACACTACAATGTTTTGG + Intronic
962093630 3:132271021-132271043 ATTAGGACATGAGCATCTTTGGG - Intronic
964095125 3:152922440-152922462 ATTAAAGCACAGACATCTTTGGG + Intergenic
964562821 3:158016975-158016997 ATTAAGATGTGAACATCTTTGGG + Intergenic
965348037 3:167576438-167576460 ATTAGGACATGGACATCTTTGGG - Intronic
965671573 3:171153111-171153133 AGGAAGACAATAGCATCTTTTGG - Intronic
965921391 3:173919213-173919235 ATTAAGACTCAGACATCTTTGGG + Intronic
965977800 3:174646032-174646054 ATTAAGAAATAAACATATTTAGG - Intronic
966323416 3:178727392-178727414 ATTAGGACATAGACATCTTTAGG - Intronic
967062535 3:185884991-185885013 ATTAAAACCCTAACATAATTAGG + Intergenic
968019525 3:195372272-195372294 ATTAAGAGAATAACATTTTATGG + Intronic
970016422 4:11517325-11517347 ATTAGGGCATGAACATCTTTTGG + Intergenic
970224113 4:13839316-13839338 ATGAAGACATGGACATCTTTAGG + Intergenic
970580008 4:17466542-17466564 ATTAGGACACAAGCATCTTTCGG - Intronic
970656833 4:18240463-18240485 ATTCAGACATTGAAATCTTTGGG + Intergenic
971506066 4:27367703-27367725 ATTAGGACATGGACATCTTTGGG + Intergenic
971830298 4:31684125-31684147 ACTAAAACACGTACATCTTTTGG + Intergenic
972124669 4:35748299-35748321 ATTAGGACTTTAACATCTTTGGG + Intergenic
972208375 4:36805482-36805504 ATTATTACACTTACATTTTTAGG - Intergenic
972419423 4:38872658-38872680 ATTAAGACAGGGAAATCTTTAGG + Intronic
972694839 4:41434976-41434998 ATTAAGATATTAACATCCATAGG - Intronic
972710629 4:41590974-41590996 ATTAAGAAACTCAGAACTTTAGG - Intronic
972967046 4:44523632-44523654 ATTAAGATGCAGACATCTTTGGG - Intergenic
973110053 4:46388164-46388186 TTTAAGACTCACACATCTTTTGG + Intronic
973807041 4:54536204-54536226 ATGAATACACGGACATCTTTGGG + Intergenic
974773651 4:66450449-66450471 ATTAAGCCACTAAAATTTCTGGG - Intergenic
975454996 4:74579570-74579592 ATTAGGACATGGACATCTTTAGG + Intergenic
975738514 4:77405458-77405480 ATTAAGAAATTAACAACTTATGG + Intronic
975911472 4:79272195-79272217 AGTAATACAATAACTTCTTTAGG + Intronic
976406235 4:84663411-84663433 ATTATGACACTAAAATCCATGGG - Intergenic
977239333 4:94547610-94547632 ATTAGGACAGGGACATCTTTGGG + Intronic
978490392 4:109305539-109305561 ATTAGGACATGGACATCTTTGGG - Intergenic
978963175 4:114709117-114709139 ATTAGGACATTGACATCTTTGGG + Intergenic
979344530 4:119571243-119571265 ATTAGGACAAGGACATCTTTGGG - Intronic
979761030 4:124405235-124405257 ATTAGGACATGGACATCTTTGGG - Intergenic
980263193 4:130481261-130481283 ATTAGGACATTAACATCTTTGGG - Intergenic
980329590 4:131393084-131393106 ATTAGGACATGAACATCATTGGG + Intergenic
980627820 4:135396726-135396748 ATTGAGATACTAAAATCTCTAGG - Intergenic
980818456 4:137980050-137980072 ATTAAGAAAATAATAGCTTTTGG + Intergenic
981452477 4:144914286-144914308 ATTAGGACAGGGACATCTTTGGG + Intergenic
981591835 4:146372797-146372819 ATTAAAAAAGTAACATTTTTTGG + Intronic
982577126 4:157127430-157127452 ATTATGACATGAACATCTTTAGG - Intronic
982968629 4:161949335-161949357 ATTCGGACAGAAACATCTTTGGG + Intronic
983135919 4:164080350-164080372 TTTAAGCCACTAACATTTTGGGG + Intronic
983223712 4:165066898-165066920 ATTAAGACATGAACATCTTTGGG + Intergenic
983503526 4:168527497-168527519 ATAAAGACAGTAACCTCTTTGGG + Intronic
983828187 4:172291285-172291307 ATTAAGAAACTGACATTTTGGGG + Intronic
983855303 4:172636348-172636370 ATTAGGACATGGACATCTTTGGG - Intronic
986327591 5:6688095-6688117 ATTAGGACAATGACATATTTGGG - Intergenic
986460573 5:7966925-7966947 ATTAAGACGTGGACATCTTTGGG - Intergenic
986617749 5:9637770-9637792 ATTAAAACACTAACAAATTCTGG - Intronic
986870917 5:12044822-12044844 ATTAAATCACTGACATGTTTTGG + Intergenic
987103197 5:14611147-14611169 ATTCAGACACAGACATCTTTGGG - Exonic
988346949 5:30048940-30048962 ATTAGGACATTGATATCTTTGGG + Intergenic
988445585 5:31282617-31282639 ATTAGGACATGGACATCTTTGGG + Intronic
988468310 5:31512555-31512577 ATTAGGACATGGACATCTTTGGG - Intronic
988622882 5:32841693-32841715 ACAAAGACACGAACATCGTTGGG - Intergenic
988875299 5:35438633-35438655 ATTAAGACATGGACATCTTTGGG + Intergenic
989585486 5:43071288-43071310 GTTAACACGCTGACATCTTTCGG + Intronic
990157946 5:52900979-52901001 ATTAGGACATGGACATCTTTGGG - Intronic
990346993 5:54881093-54881115 ATTAGGACATGAACATCTCTGGG + Intergenic
990769835 5:59230475-59230497 ATTTAGTCAATAAAATCTTTTGG - Intronic
991040725 5:62172744-62172766 ATTAATATATTAACATCTTTGGG + Intergenic
991108582 5:62870915-62870937 AATCAGACACAAGCATCTTTTGG + Intergenic
991513869 5:67412238-67412260 ATTAAGATACTTTCATGTTTAGG - Intergenic
991960927 5:72043334-72043356 ATTAAGGAAATAACAGCTTTGGG + Intergenic
992165618 5:74047956-74047978 ATTAGAACACAGACATCTTTGGG + Intergenic
992990204 5:82276045-82276067 AGTAAGATACAAACATTTTTTGG + Exonic
993832021 5:92771563-92771585 ATTAGGACAAAGACATCTTTGGG + Intergenic
993877414 5:93324312-93324334 ATTAAGACATTAGGATGTTTGGG + Intergenic
994225407 5:97246398-97246420 ACGAAGACACTCACATCATTTGG - Intergenic
994617178 5:102118479-102118501 ATTAGGACTGCAACATCTTTGGG - Intergenic
994652525 5:102546515-102546537 ATCAAGACACTAGCAAATTTGGG - Intergenic
994675156 5:102811608-102811630 ATTAAGACATGGATATCTTTGGG + Intronic
994805168 5:104437349-104437371 ATTAAGACATAAGCATCTTTGGG - Intergenic
994920760 5:106040017-106040039 ATTAGGGCACAGACATCTTTGGG - Intergenic
995382059 5:111546568-111546590 ATTATGACTCTATCATCCTTTGG + Intergenic
995437816 5:112157788-112157810 ATTAGGACATGAATATCTTTTGG + Intronic
995957757 5:117799649-117799671 AAGAAGACACCAACAGCTTTTGG - Intergenic
996199981 5:120660126-120660148 TATAAGACACTCACAACTTTAGG + Intronic
996541363 5:124632761-124632783 ATTAGGACATGGACATCTTTGGG - Intergenic
996945755 5:129065713-129065735 ATTAAGACGTAGACATCTTTTGG - Intergenic
997182204 5:131841820-131841842 ATTAAGAAAATAATATCCTTAGG - Intronic
997205471 5:132046205-132046227 ATTAGGACATGAACATTTTTGGG + Intergenic
997320115 5:132970970-132970992 ATTAGTACATGAACATCTTTGGG + Intergenic
997487999 5:134248083-134248105 ATTAACTAACTCACATCTTTGGG + Intergenic
997604149 5:135162059-135162081 ATTAGGACATGGACATCTTTGGG + Intronic
998678527 5:144437456-144437478 ATTAAGATACTTACCTCATTAGG + Intronic
998728558 5:145047206-145047228 ATTAAGACACAGACATTTTTAGG - Intergenic
999833809 5:155347512-155347534 ATTAAGACACTATGATGTTTGGG + Intergenic
999840904 5:155425501-155425523 ATTAGGATATGAACATCTTTGGG - Intergenic
999949211 5:156630582-156630604 ATTAAGCAACTAACAACTTGAGG - Intronic
1000428687 5:161124202-161124224 ATTAAGATATCAACATCTTAGGG - Intergenic
1000514000 5:162217926-162217948 ATTAAGAAATGGACATCTTTGGG + Intergenic
1000895188 5:166846699-166846721 ATTAAGACACAGACATCTTTGGG + Intergenic
1000921647 5:167145216-167145238 ATTTGGACACGGACATCTTTGGG + Intergenic
1001233883 5:170013313-170013335 ATTAGGACATGGACATCTTTGGG - Intronic
1001234013 5:170014263-170014285 ATTAGGACATGGACATCTTTGGG - Intronic
1001698138 5:173687858-173687880 ATTAAGACATGGACATCTTTGGG + Intergenic
1004019018 6:11759668-11759690 ATTAGGACATAGACATCTTTGGG - Intronic
1004915671 6:20329654-20329676 ATTCAAACACTGACATGTTTCGG - Intergenic
1004955281 6:20722290-20722312 ATGAAGACAATAAAATCTTGAGG - Intronic
1004998333 6:21215811-21215833 ATTAGGACACGATCACCTTTGGG - Intronic
1005347463 6:24904575-24904597 ATTAGGACATGGACATCTTTGGG + Intronic
1005678670 6:28182934-28182956 ATTAGGACATAGACATCTTTGGG + Intergenic
1005831658 6:29675932-29675954 TTTAAGAATCTAACATCTGTGGG - Exonic
1006045890 6:31297965-31297987 ATTAGGACACAGACATATTTAGG - Intronic
1006499970 6:34452091-34452113 ATTCGGACATGAACATCTTTGGG + Intergenic
1007645036 6:43373222-43373244 ATAAAGACACTATCATCATGGGG - Intergenic
1008416549 6:51247471-51247493 ATTAAGACACTAAAATCTGTTGG + Intergenic
1008492877 6:52104187-52104209 ATTAGGACATAAACATATTTGGG - Intergenic
1008872317 6:56287279-56287301 ATTAGGACACGGACATTTTTGGG - Intronic
1009808840 6:68635646-68635668 ATTAAGCCACTTACATTTTGGGG + Exonic
1009887464 6:69640801-69640823 ATTAATTTACTGACATCTTTAGG + Intergenic
1010536299 6:77036063-77036085 ATTAGGACATAGACATCTTTGGG - Intergenic
1011214106 6:84986946-84986968 ATTAGCACATTAACACCTTTAGG + Intergenic
1011408921 6:87045516-87045538 AAAAAAACAGTAACATCTTTTGG + Intergenic
1011741012 6:90360676-90360698 ATTAAAACACTTTCACCTTTAGG + Intergenic
1011904907 6:92352580-92352602 ATTAGGACTTCAACATCTTTTGG + Intergenic
1012072552 6:94641031-94641053 ATAAGGACACGGACATCTTTAGG + Intergenic
1012580428 6:100862639-100862661 ATTAAGACCCTAAAATATTGTGG + Intronic
1012630570 6:101461686-101461708 ATTAAGACGTGAACATATTTGGG + Intronic
1012670271 6:102036318-102036340 ATTAAGACATGGACATCTCTGGG - Intronic
1012725216 6:102802023-102802045 ATTAAGACATGAACATCTTTTGG + Intergenic
1012728452 6:102847287-102847309 ATTAAGTCATGAGCATCTTTGGG + Intergenic
1013303531 6:108826705-108826727 ATTAGGACATGAACATCTTTAGG - Intergenic
1013869958 6:114744955-114744977 GTTAAGAAAGCAACATCTTTGGG + Intergenic
1014129589 6:117815677-117815699 ATTAAGACATGAACATCTTTGGG - Intergenic
1014331806 6:120077182-120077204 ATTTATACTCTAACATGTTTGGG - Intergenic
1014336658 6:120146068-120146090 ATTTAGGCTCTGACATCTTTAGG + Intergenic
1014469735 6:121799606-121799628 ATTAAGCCCATAACATCTCTGGG - Intergenic
1014713215 6:124833752-124833774 ATTAAGACATACACATCTTTGGG - Intergenic
1014749092 6:125235129-125235151 AATAAAACACCAACTTCTTTTGG + Intronic
1015724593 6:136287506-136287528 ATTAAGAAGCTAAAATCTCTGGG - Intronic
1015892392 6:137981760-137981782 ATTTAAACACTAATATTTTTTGG + Intergenic
1016090639 6:139974924-139974946 AATAAAATACTAACATATTTTGG + Intergenic
1016256748 6:142115761-142115783 ATTTAAACACTAAAATGTTTTGG + Intergenic
1017955439 6:159173877-159173899 ATTAGGACAAGGACATCTTTGGG + Intronic
1018045216 6:159959879-159959901 ATTAAGACCTCAACATCTTGGGG + Intergenic
1018878227 6:167845767-167845789 ACTAATACACTAAGATATTTTGG - Intronic
1019125426 6:169837544-169837566 ATTAAAACACAAACATTTTGGGG - Intergenic
1022128323 7:27379025-27379047 GTGAAGACACCAACAACTTTGGG - Intergenic
1022238453 7:28485989-28486011 ATTTAGACACAAATATCTTTGGG - Intronic
1022302015 7:29110671-29110693 ATTAAGACACTAACATCTTTAGG - Intronic
1023278312 7:38544214-38544236 ATTAATACAATAACCTATTTTGG - Intronic
1023381476 7:39612644-39612666 CTTAGGACATAAACATCTTTAGG - Intergenic
1023391457 7:39715178-39715200 ATTAGGACATGGACATCTTTGGG - Intergenic
1023476825 7:40589358-40589380 ATTAAGGCACCAGCATCTTAGGG + Intronic
1025551210 7:62252176-62252198 ATTAGGACACGAAAATTTTTGGG - Intergenic
1025837879 7:65112686-65112708 ATTAGGACATGAACATTTTTGGG + Intergenic
1025879390 7:65520400-65520422 ATTAGGACATGAACATTTTTGGG - Intergenic
1025885189 7:65583305-65583327 ATTAGGACATGAACATTTTTGGG - Intergenic
1026654960 7:72248724-72248746 ATTAGGACACGCACATCTTTAGG + Intronic
1027680716 7:81217566-81217588 ACTAAGAAACTAACTTTTTTTGG - Intergenic
1027693952 7:81385065-81385087 ATTAACACACAAACATTTTTTGG + Intergenic
1027724030 7:81780645-81780667 ATTAGGACATGGACATCTTTGGG - Intergenic
1028013109 7:85674283-85674305 ATCAATACAATAAAATCTTTTGG + Intergenic
1028047079 7:86134836-86134858 ATTAAGACACAAAGTTATTTGGG + Intergenic
1028538327 7:91914391-91914413 ATTAGGACTCCAACATCTTTTGG - Intergenic
1030177591 7:106670980-106671002 ATTAAGATATGAACATCTCTGGG + Intergenic
1030360492 7:108590382-108590404 ATTAGGACATGGACATCTTTGGG - Intergenic
1031137514 7:117901059-117901081 ATTAGGACATGGACATCTTTGGG + Intergenic
1031331231 7:120467118-120467140 ATTAAGATGTGAACATCTTTCGG + Intronic
1031398672 7:121304991-121305013 CTTAAGATGCTAATATCTTTGGG + Intergenic
1032039442 7:128546807-128546829 ATGAAGACAATAAAATCTTGAGG - Intergenic
1032292865 7:130605308-130605330 ATGAAGACATAGACATCTTTGGG - Intronic
1032603089 7:133320610-133320632 ATTAGGACATGAATATCTTTGGG + Intronic
1032986099 7:137339085-137339107 ATTAAGACAATAACATATCAAGG + Intronic
1034501014 7:151451203-151451225 ATTAAGACGTGGACATCTTTGGG + Intergenic
1034686493 7:152975919-152975941 ATTAGGACATGAATATCTTTGGG - Intergenic
1037794490 8:21980474-21980496 GTTAAGACTCTAACATCTCCGGG + Intronic
1038127060 8:24686115-24686137 ATTAGGACATGGACATCTTTAGG + Intergenic
1038848705 8:31253828-31253850 ATTTTGGCACTCACATCTTTGGG + Intergenic
1039817437 8:41106948-41106970 ATTAAGACATGGACATTTTTGGG - Intergenic
1040454633 8:47584223-47584245 ATTCAGAAACTATGATCTTTTGG + Intronic
1042227839 8:66528400-66528422 ATTAGGACATGGACATCTTTGGG + Intergenic
1042310691 8:67376223-67376245 ATTAGGACACAAACATCTTTGGG + Intergenic
1042413453 8:68491781-68491803 ATTAGGACATGAACATCTCTGGG + Intronic
1043039868 8:75249601-75249623 ATTAGGACACGAACATTTTTTGG - Intergenic
1043446200 8:80321743-80321765 TTTAAAAAACTTACATCTTTGGG - Intergenic
1043564252 8:81530620-81530642 ATTAAGACGTGAATATCTTTAGG - Intronic
1043853214 8:85237424-85237446 ATTAACACAGTAACATATTAAGG - Intronic
1044047962 8:87461909-87461931 ATCAAGGCATAAACATCTTTGGG - Intronic
1044398585 8:91743414-91743436 ATTAGGACATAACCATCTTTGGG - Intergenic
1044893340 8:96861127-96861149 AATAAGACTGTGACATCTTTTGG + Intronic
1044966112 8:97575525-97575547 ATTAGGACATGGACATCTTTGGG - Intergenic
1045239004 8:100381801-100381823 GTTAAAACACTTACATATTTGGG + Intronic
1046089723 8:109487364-109487386 ATTAAGAAATTAACATTTTTAGG - Intronic
1046248595 8:111600345-111600367 ATTAAGACACGGACATCTTTGGG + Intergenic
1046377994 8:113412250-113412272 ACTAAGACATTACTATCTTTTGG + Intronic
1046406923 8:113786053-113786075 ATAAAGAAACTGACATGTTTTGG + Intergenic
1046430267 8:114115049-114115071 ATTAAGACAAGAACACATTTGGG + Intergenic
1046447593 8:114343061-114343083 TTTAAAACACTAAATTCTTTAGG + Intergenic
1046477085 8:114759495-114759517 ATTAAAACACTAATAACTATTGG + Intergenic
1047063595 8:121255154-121255176 ATTAAGACACTGACATCTTTGGG - Intergenic
1047349094 8:124056178-124056200 ATTAGGATATGAACATCTTTGGG + Intronic
1047871120 8:129083269-129083291 ATTATGAGATTAACAGCTTTGGG + Intergenic
1047927939 8:129699424-129699446 ATTAAGACATGACCATCTTTTGG - Intergenic
1048035176 8:130671185-130671207 ACTAAGACATGGACATCTTTTGG - Intergenic
1048047476 8:130786416-130786438 ATTAAGACACAGGCATCTTTGGG - Intronic
1048323499 8:133420923-133420945 ATTAGGTCATGAACATCTTTAGG - Intergenic
1048689624 8:136946789-136946811 ATTATGGCACTAATATCTCTAGG + Intergenic
1048714032 8:137246935-137246957 ATAAAGACATGAACATTTTTTGG - Intergenic
1048722820 8:137346200-137346222 AGTAAGACATGGACATCTTTGGG + Intergenic
1050518152 9:6467436-6467458 ATTAGGACATGAACCTCTTTGGG + Intronic
1050760678 9:9066491-9066513 ATTAAGACATGACTATCTTTTGG - Intronic
1050799374 9:9591011-9591033 ATTAAGGCACGGACACCTTTAGG - Intronic
1050960575 9:11724956-11724978 AATAAGACAATAACTTCTTTAGG + Intergenic
1051646810 9:19276809-19276831 ATAAAGACACTATCATTTTAAGG + Intronic
1052110107 9:24571741-24571763 ACTAAGACAATAACATGTTATGG - Intergenic
1052177264 9:25477681-25477703 ATTAAAACACAGACACCTTTGGG - Intergenic
1054919239 9:70525291-70525313 ATTAGGACATGGACATCTTTGGG + Intergenic
1056010922 9:82329116-82329138 ATTAATACACTAGCATGGTTTGG + Intergenic
1056169526 9:83970723-83970745 TTAAAGATACTTACATCTTTGGG + Exonic
1057533291 9:95874457-95874479 ATTAGGAGATAAACATCTTTGGG - Intergenic
1057738612 9:97690975-97690997 ATTAAGGCATGGACATCTTTGGG + Intronic
1058308686 9:103473804-103473826 ATTAGGACATGAGCATCTTTGGG + Intergenic
1058577104 9:106415546-106415568 ATTAGGACATGAACATCTTCAGG - Intergenic
1058671080 9:107360849-107360871 ACTAAGACATGAACATCTTTGGG + Intergenic
1059087119 9:111316184-111316206 ATTAAGACATGGACATCTTTAGG - Intergenic
1060541008 9:124430124-124430146 ATCAGGACATTGACATCTTTGGG - Intergenic
1061384366 9:130279763-130279785 ATTAGGACAGGCACATCTTTGGG - Intergenic
1185560238 X:1055384-1055406 ATTAAGACTCTAAGATGTTTTGG + Intergenic
1185691211 X:2156555-2156577 ATTAAGACTTTGATATCTTTAGG + Intergenic
1185743838 X:2555599-2555621 ATTAGGACATGGACATCTTTGGG + Intergenic
1186366084 X:8895175-8895197 ATTAGGACTTCAACATCTTTTGG - Intergenic
1186461555 X:9752425-9752447 ATTAGGACAGGGACATCTTTAGG - Intronic
1186611511 X:11142535-11142557 ATTATGACACAGATATCTTTGGG - Intronic
1186659664 X:11656832-11656854 ATTAGGACATGAACATCTTTGGG + Intronic
1188022439 X:25173676-25173698 ATTAAAACACTAATGTCCTTGGG + Intergenic
1188152468 X:26695058-26695080 ATTAGGACATGAACATCTTTTGG - Intergenic
1189055284 X:37693202-37693224 ATTAAGCCATTAAAATCTTCTGG + Intronic
1189660523 X:43292084-43292106 ATTAGAACATGAACATCTTTGGG - Intergenic
1190040089 X:47064326-47064348 ATTAGGACATGGACATCTTTGGG - Intergenic
1190858872 X:54324334-54324356 ATTAGGACATGGACATCTTTGGG + Intronic
1191025923 X:55913312-55913334 ATTAAGACTCCAACATATATTGG - Intergenic
1191171406 X:57451059-57451081 ATTTAGACACAAAAATCTTTAGG + Intronic
1192927309 X:75768737-75768759 ATTAAGACCCTTTGATCTTTGGG - Intergenic
1193288328 X:79739924-79739946 ATTAGGACATAAACATATTTGGG - Intergenic
1194763179 X:97818090-97818112 ATTAGGACATGGACATCTTTGGG - Intergenic
1195334341 X:103834765-103834787 ATTAAAACATTAACGTCTCTTGG + Intergenic
1195662943 X:107399166-107399188 ATTAGAACATGAACATCTTTGGG - Intergenic
1196797889 X:119516669-119516691 ACTAAGACCCTAACATCGCTTGG - Intergenic
1196987951 X:121295468-121295490 ATTTGGACATTGACATCTTTGGG - Intergenic
1198267718 X:135024753-135024775 ATTAGGACACACACATCTTTGGG + Intergenic
1198848189 X:140936348-140936370 ATTAGGACGTGAACATCTTTGGG + Intergenic
1199228958 X:145412374-145412396 ATTAGGACATGGACATCTTTGGG + Intergenic
1199730782 X:150630064-150630086 ATTAGGACATGGACATCTTTGGG + Intronic
1199765428 X:150937798-150937820 ATTAGGACATGGACATCTTTGGG + Intergenic
1199802454 X:151265155-151265177 ATTAGGACACAGATATCTTTGGG + Intergenic
1200008855 X:153106820-153106842 GTTAGGCCACGAACATCTTTGGG + Intergenic
1200030745 X:153293102-153293124 GTTAGGCCACGAACATCTTTGGG - Intergenic
1200326117 X:155241576-155241598 ATAAAGACACTGACATCTGTAGG + Intergenic
1201594799 Y:15656265-15656287 ATTAAAACATGGACATCTTTAGG - Intergenic
1202047751 Y:20751535-20751557 ATTAGGACAGGGACATCTTTAGG - Intergenic