ID: 1022308587

View in Genome Browser
Species Human (GRCh38)
Location 7:29174024-29174046
Sequence GTGTGAACTCCGCTTGTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 57}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022308587_1022308593 18 Left 1022308587 7:29174024-29174046 CCAGACACAAGCGGAGTTCACAC 0: 1
1: 0
2: 0
3: 2
4: 57
Right 1022308593 7:29174065-29174087 TCATAGTCTCCATGGGGAAGAGG 0: 1
1: 0
2: 0
3: 41
4: 201
1022308587_1022308594 19 Left 1022308587 7:29174024-29174046 CCAGACACAAGCGGAGTTCACAC 0: 1
1: 0
2: 0
3: 2
4: 57
Right 1022308594 7:29174066-29174088 CATAGTCTCCATGGGGAAGAGGG No data
1022308587_1022308596 21 Left 1022308587 7:29174024-29174046 CCAGACACAAGCGGAGTTCACAC 0: 1
1: 0
2: 0
3: 2
4: 57
Right 1022308596 7:29174068-29174090 TAGTCTCCATGGGGAAGAGGGGG 0: 1
1: 0
2: 2
3: 20
4: 258
1022308587_1022308595 20 Left 1022308587 7:29174024-29174046 CCAGACACAAGCGGAGTTCACAC 0: 1
1: 0
2: 0
3: 2
4: 57
Right 1022308595 7:29174067-29174089 ATAGTCTCCATGGGGAAGAGGGG No data
1022308587_1022308591 11 Left 1022308587 7:29174024-29174046 CCAGACACAAGCGGAGTTCACAC 0: 1
1: 0
2: 0
3: 2
4: 57
Right 1022308591 7:29174058-29174080 CTTCTCTTCATAGTCTCCATGGG 0: 1
1: 0
2: 0
3: 21
4: 214
1022308587_1022308592 12 Left 1022308587 7:29174024-29174046 CCAGACACAAGCGGAGTTCACAC 0: 1
1: 0
2: 0
3: 2
4: 57
Right 1022308592 7:29174059-29174081 TTCTCTTCATAGTCTCCATGGGG 0: 1
1: 0
2: 1
3: 23
4: 248
1022308587_1022308590 10 Left 1022308587 7:29174024-29174046 CCAGACACAAGCGGAGTTCACAC 0: 1
1: 0
2: 0
3: 2
4: 57
Right 1022308590 7:29174057-29174079 GCTTCTCTTCATAGTCTCCATGG 0: 1
1: 0
2: 0
3: 13
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022308587 Original CRISPR GTGTGAACTCCGCTTGTGTC TGG (reversed) Intronic
901319684 1:8332173-8332195 GTGTGCACCCCACTTGTTTCTGG + Intronic
901921882 1:12542475-12542497 CTGTGAACTCCGCTTGGGCAGGG + Intergenic
902709462 1:18228600-18228622 GAGTGAAATCTTCTTGTGTCTGG + Intronic
903742618 1:25567007-25567029 GTGTCAGGGCCGCTTGTGTCCGG - Exonic
907324093 1:53625643-53625665 GAGTGAGCTCCTATTGTGTCTGG + Intronic
907397892 1:54204751-54204773 GTGTGAATTCCTCTAGTGGCAGG + Intronic
911375253 1:97044066-97044088 GTGGCAACTCCGCTTTTCTCTGG - Intergenic
912519262 1:110234107-110234129 GTGTGCACTCCTCAGGTGTCAGG - Intronic
915742125 1:158126689-158126711 GGGTGGACTCCCCTTGGGTCTGG + Intergenic
917776716 1:178344937-178344959 GTATGATCTCAGCTTGTGTTTGG + Intronic
918226754 1:182490982-182491004 GTGGGAGCTTCGCTTGAGTCTGG - Intronic
923826204 1:237503460-237503482 GTGTGAAGGCAGCTTGCGTCAGG - Exonic
1073868203 10:107829768-107829790 GTGTGATCTCTGTGTGTGTCGGG + Intergenic
1075451187 10:122552919-122552941 GTGTGGACTCCTCTTATGTGTGG + Intergenic
1077036380 11:496841-496863 GCGGGAACCCCGCCTGTGTCAGG - Intronic
1079403816 11:20128006-20128028 GTGTGAACTCCAGTGGTGACAGG - Intergenic
1080447319 11:32349474-32349496 CTGTGAACTCCACTAGGGTCAGG - Intergenic
1086884053 11:92183326-92183348 GTATGAACTACTCTTGTATCTGG - Intergenic
1093938336 12:25025455-25025477 GTGTGTAAGCCCCTTGTGTCTGG - Intronic
1095532697 12:43208353-43208375 GTGTGAACTCAGCATTTGGCAGG - Intergenic
1110363811 13:74659249-74659271 GTGTGCACACCCCTTCTGTCTGG + Intergenic
1111920199 13:94402367-94402389 GTGTGGCCTCCCCTTGAGTCTGG + Intronic
1117835360 14:59799604-59799626 ATGTGAACTCTCCATGTGTCTGG - Intronic
1122143178 14:99674452-99674474 GGGGGAACTCTGGTTGTGTCTGG - Intronic
1128229914 15:66027262-66027284 GTGTGGACTCAGCCTGTGGCTGG - Intronic
1130145252 15:81269124-81269146 CTGAGAACTCCCCTTGTGCCAGG - Intronic
1130605559 15:85313341-85313363 GTGTGAACTTCCCTGGTGTCTGG + Intergenic
1140637277 16:76929876-76929898 GTGTGTCCTCTGCTTGGGTCAGG + Intergenic
1145094994 17:20017550-20017572 GTGGGAACACCTTTTGTGTCCGG - Intronic
1147950967 17:44107843-44107865 GTGTGAATCCTGCTTGTGCCAGG - Intronic
1156208725 18:34914579-34914601 GAGTGAACTCCGCTGGGGTGCGG - Intergenic
925351493 2:3204002-3204024 GTGTGACCTCAGCTTTTGTGTGG - Intronic
926238880 2:11069786-11069808 GTGTGAACTGGACTTGCGTCAGG - Intergenic
941065613 2:160899274-160899296 CTGTGAGCTCTTCTTGTGTCTGG + Intergenic
1172978087 20:38921130-38921152 GTGTGAAGTCGGCTCCTGTCAGG - Exonic
949321780 3:2819650-2819672 CTGTGCACTCAGCTGGTGTCAGG - Intronic
955921354 3:63960012-63960034 GTGTGAAATCAGATTGTTTCAGG + Intronic
961015232 3:123463170-123463192 GTATGTACTCCTTTTGTGTCTGG - Intergenic
961270526 3:125684304-125684326 GTGTGTTCATCGCTTGTGTCTGG - Intergenic
967391862 3:188964053-188964075 GTGTGAGCTCCGCGAGTGTAGGG + Intronic
968541303 4:1169704-1169726 GTCTGAAGTCCGCTGTTGTCTGG + Intronic
975784994 4:77878003-77878025 GTGTGAACTCCCCGTATGCCTGG + Intronic
978423542 4:108559338-108559360 GTGTGAACTCCTGGAGTGTCAGG + Intergenic
979741677 4:124159124-124159146 GTGTGATCTGGGCTTCTGTCTGG + Intergenic
984250851 4:177332665-177332687 GTGTGTATTCTCCTTGTGTCTGG + Intronic
989720840 5:44526072-44526094 GTGTAAACTCTCCTTGTATCTGG + Intergenic
991553581 5:67870369-67870391 GCGTGGACTCCTCTTTTGTCTGG + Intergenic
995692313 5:114841231-114841253 TTGTGAACTCATCTTGTATCAGG - Intergenic
999816188 5:155178782-155178804 GTACAAACTCCTCTTGTGTCAGG - Intergenic
1005978030 6:30815201-30815223 GTGTGATCTTAGCTTGTGTCCGG + Intergenic
1020004695 7:4776043-4776065 GTGAGAACTCCGCGTCTGGCAGG + Intronic
1021922991 7:25505833-25505855 GTGGGAACTCAGGTTGTGACTGG - Intergenic
1022141662 7:27498291-27498313 GTGTCACCTCCAATTGTGTCTGG + Intergenic
1022308587 7:29174024-29174046 GTGTGAACTCCGCTTGTGTCTGG - Intronic
1030149700 7:106391451-106391473 GTGCCAACTCCACTGGTGTCTGG + Intergenic
1032046920 7:128618897-128618919 CTGTGAACTCTCCATGTGTCAGG + Intergenic
1043311798 8:78870022-78870044 GTGTAAACTACACTTGTGTTAGG - Intergenic
1062310181 9:135931235-135931257 CTGTGAACACAGCCTGTGTCTGG - Intergenic
1186342242 X:8657270-8657292 CTGTGAACTCCTCTTTTGGCTGG + Intronic
1188188266 X:27143677-27143699 GGGTGAACTCTGCAAGTGTCTGG - Intergenic