ID: 1022310879

View in Genome Browser
Species Human (GRCh38)
Location 7:29194823-29194845
Sequence CGTCCCCAGGACTTTGCCAT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 101}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022310876_1022310879 -1 Left 1022310876 7:29194801-29194823 CCGGAGGCTGGTGCTTTCTGCGC 0: 1
1: 0
2: 0
3: 12
4: 151
Right 1022310879 7:29194823-29194845 CGTCCCCAGGACTTTGCCATGGG 0: 1
1: 0
2: 1
3: 13
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022310879 Original CRISPR CGTCCCCAGGACTTTGCCAT GGG Exonic
900154486 1:1198486-1198508 TGGCCCCAGGACTTAGCCAGGGG + Intergenic
900298270 1:1963854-1963876 CTTTCCCAGGACTTTGATATTGG - Exonic
901134607 1:6984857-6984879 CGTCCCCAGGAATTTGGCATTGG - Intronic
906776284 1:48532670-48532692 ACTCCCCAGGACTTTGACACGGG + Intergenic
906819275 1:48912457-48912479 CCTGCCCAGGACGTTGCCATTGG + Intronic
907308518 1:53526664-53526686 CGGCCCCAGGACTGTCCCTTGGG + Intronic
908428772 1:64035568-64035590 CTTTCCCAGGAATTTGCAATTGG + Intronic
910396636 1:86800418-86800440 CCTCCCCAAGAATTTGGCATAGG + Intergenic
910455524 1:87393540-87393562 CAGCCCCAGGTCTTTGCCACTGG - Intergenic
918490418 1:185075421-185075443 GTTCCCCAGAACTTTGCCAATGG + Intronic
922890603 1:229058862-229058884 CATCCCCAGGACTGAGGCATTGG - Intergenic
1067576581 10:47412509-47412531 GGTACCCAGGACTGTGGCATGGG - Intergenic
1069739934 10:70681049-70681071 CATCCCCAGGACTTGGCCAAGGG - Intronic
1069746088 10:70715933-70715955 CGTCCCTAGGACTTTACTGTTGG + Intronic
1071525277 10:86354706-86354728 CCTCCCCGGGACCTGGCCATAGG - Intronic
1075381431 10:122021940-122021962 CGTCCCCAGAATTTTGTCAGAGG - Exonic
1075488631 10:122847661-122847683 GGTCCCCAGGAAGTTGCCAGAGG - Intronic
1083232207 11:61329952-61329974 CCTCACCTGGACATTGCCATGGG + Exonic
1084035038 11:66504544-66504566 TGTCCACAGGGCTCTGCCATAGG - Intronic
1084545192 11:69811913-69811935 CATCCCCAAGACTTGGCCGTGGG + Intronic
1084651616 11:70492645-70492667 CCTTCCCAGGACCTTGCCCTCGG + Intronic
1084687359 11:70704403-70704425 CCTCACCAGGACCTTCCCATGGG - Intronic
1090835853 11:130453010-130453032 GGTCCCCAGGAATTCACCATGGG + Intronic
1092646808 12:10583430-10583452 AGTTCCCAGGACTATGCCATGGG + Intergenic
1095049189 12:37541830-37541852 CTTCCCCTGGACTCTGCCAGTGG - Intergenic
1096543510 12:52321775-52321797 CCACCCCAGGGCTTGGCCATGGG - Intergenic
1097156443 12:57015653-57015675 TGTCCCCAGTACTCTGCCAGGGG + Intronic
1099085142 12:78236678-78236700 AGTCCCCAGGGCTTTGTCCTTGG - Intergenic
1102735474 12:115155405-115155427 CTTTCCCAGGACTTTTCTATAGG - Intergenic
1103722611 12:122982683-122982705 CGTCCACAGGCCTTGGCCAGCGG - Exonic
1104261614 12:127188388-127188410 CTTTCCCAGGACGTTGGCATAGG + Intergenic
1105004773 12:132714716-132714738 CCTCCCCAGGGCTGTGCCAAGGG + Intronic
1107271198 13:38619004-38619026 CGTTCCCTGGACATAGCCATGGG - Intergenic
1107999613 13:45894248-45894270 GGTCCACAGGACTCTGCCACAGG - Intergenic
1120812761 14:88821459-88821481 AGTCCCCACAACTTTGCCAAGGG + Intergenic
1122888964 14:104723979-104724001 CGCCCCCACGAATTTGCCAACGG - Intergenic
1128133901 15:65248865-65248887 CTTCCCAAGGACTCTGCCCTTGG + Intronic
1131429256 15:92373443-92373465 TTTCCCTAGGACTATGCCATAGG + Intergenic
1131771451 15:95742307-95742329 AGTCCCCATGACTTTCCCTTCGG - Intergenic
1134095659 16:11416794-11416816 CGGCCCCAGGACCTTGGCACGGG - Intronic
1140318164 16:73920419-73920441 CGTCTTCAATACTTTGCCATTGG + Intergenic
1141769119 16:86078184-86078206 CCTCCCGAGGACTTTGGCATTGG + Intergenic
1141920946 16:87134969-87134991 CGTCCCCAGGACTTGGTTTTAGG + Intronic
1142832309 17:2558317-2558339 CTACCCCAGGACTTTTGCATAGG - Intergenic
1146445316 17:32928175-32928197 CCGCGCCCGGACTTTGCCATCGG + Exonic
1148051393 17:44771705-44771727 CGTCCCCAGGCCTGGGCCAGAGG - Intronic
1148160528 17:45447345-45447367 AGTCACCAGGAGTTTGCCATTGG - Intronic
1148674013 17:49434660-49434682 CCTCCCCAGGATTTTCCAATAGG + Intronic
1149510085 17:57233751-57233773 CATCCCCAGGACCTGGCCCTTGG - Intergenic
1150391818 17:64794226-64794248 AGTCACCAGGAGTTTGCCATTGG - Intergenic
1150777686 17:68094779-68094801 CATCCCCAGCACTTTGCTAAAGG + Intergenic
1150788885 17:68184273-68184295 GGTCACCAGGAGTTTGCCACTGG - Intergenic
1151598583 17:75092944-75092966 CACCCCCAGGCCTTTCCCATCGG - Intronic
1167508433 19:49883134-49883156 CGTCCACAGAACTTGCCCATTGG - Intronic
925292313 2:2755967-2755989 AGTCCCCAGGACTTGCCCAAGGG - Intergenic
934729924 2:96650017-96650039 CCTCCCCAGAACATTACCATGGG - Intergenic
942245898 2:174007953-174007975 GGTACCCAGGATTTAGCCATGGG + Intergenic
942840798 2:180359054-180359076 CTTCCACAGGAGTTTGGCATGGG - Intergenic
948265112 2:236630199-236630221 CCTGCCCAGGACTCTGGCATAGG - Intergenic
1169871697 20:10254765-10254787 CGTCTCCAGCACTTTGCCCTGGG - Intronic
1171230572 20:23480857-23480879 CATTCCCATGAATTTGCCATAGG + Intergenic
1171249522 20:23637690-23637712 CGTGCACTGGACTTTGCCGTCGG - Exonic
1171524453 20:25798350-25798372 CTTCCCCAGGACTCTGCCTGGGG + Intronic
1171552374 20:26057533-26057555 CTTCCCCAGGACTCTGCCTGGGG - Intergenic
1172689330 20:36779465-36779487 CAGCCCCAGCACTTTGCAATGGG - Exonic
1172777375 20:37415373-37415395 CTTCCCCAGCACCTTGCCTTGGG + Intergenic
1174334743 20:49851566-49851588 CGTCCCCAGATCCTTGCCATGGG + Intronic
1176163249 20:63659224-63659246 CTTTCCCAGGTCTGTGCCATAGG + Exonic
1178308743 21:31511990-31512012 CATACCCAGGAGTTTGCCACGGG - Intronic
1181954476 22:26578509-26578531 GATCCTCAGGACTGTGCCATGGG + Intronic
1184159819 22:42691659-42691681 CGGCTCCAGGACTGGGCCATAGG - Intergenic
960418701 3:117416401-117416423 AGTCCCCAGGGCTTTGTCCTGGG + Intergenic
962435936 3:135366820-135366842 CTTTCACAGTACTTTGCCATAGG - Intergenic
964657243 3:159081304-159081326 ATTGCCCAGGACTGTGCCATAGG + Intronic
968520147 4:1031446-1031468 CCACCCCAGCACTCTGCCATGGG - Intergenic
978761643 4:112359698-112359720 AGTCCCCTGGACTTTCCCACGGG + Intronic
985197021 4:187442631-187442653 CAGCCCCATGACTTTGCCCTGGG + Intergenic
991115194 5:62946701-62946723 CATCCCCAGGACTGTGCCCACGG + Intergenic
992612591 5:78520253-78520275 CTTGCCTATGACTTTGCCATTGG - Intronic
995128190 5:108600986-108601008 CTTTCCCAGGAATTTGGCATTGG - Intergenic
996530762 5:124524599-124524621 AGTCACCAGGACTTTGACATGGG + Intergenic
1000132456 5:158313244-158313266 CGTGCCCTGGAATTTGCAATCGG - Intergenic
1002075298 5:176704981-176705003 TGTCTCCAGGAGGTTGCCATGGG - Intergenic
1006423430 6:33949443-33949465 AGACCCCAGGACTTTGGCTTGGG + Intergenic
1007262826 6:40575602-40575624 GGTCCCCAGGCCTTTCCCCTGGG + Intronic
1007595056 6:43046135-43046157 CACCCCCTGGACTTGGCCATGGG - Intronic
1008546834 6:52590582-52590604 CCTCCCCAAGACTTTGCCCTGGG - Intergenic
1008699351 6:54080115-54080137 CTTCCCCAGAACTTTTCCACTGG + Intronic
1008964679 6:57302385-57302407 TTTCCCCAGCACTTTTCCATGGG + Intergenic
1009450310 6:63792168-63792190 CATCCCCAGTCCTTTGCCCTGGG - Intronic
1009523030 6:64708428-64708450 CTTCCCCAGGAATTTGGAATTGG - Intronic
1013068238 6:106704318-106704340 CCACCCCAGGACCTTGGCATAGG - Intergenic
1018399805 6:163411559-163411581 CCTCCCCAGGACTCTGCCCTTGG - Intergenic
1018583105 6:165324883-165324905 CTTCCCCAGGACTGAGCCACAGG + Intergenic
1019176536 6:170162165-170162187 CGTCCCCGGGACTTGGCAAGAGG + Intergenic
1019196886 6:170288310-170288332 CGTCCCCGGGACGATGCCTTCGG - Exonic
1019390455 7:783839-783861 CGTCCTCAGGACCTTGCTCTAGG + Intronic
1021121268 7:16798384-16798406 CTTCCCCAGCACTTGGCCATAGG - Intronic
1022310879 7:29194823-29194845 CGTCCCCAGGACTTTGCCATGGG + Exonic
1024518707 7:50284092-50284114 CACCCCCAGGAATTTGGCATTGG - Intergenic
1025098074 7:56112883-56112905 TGACCCCAGGACTTTGCCTTTGG - Intergenic
1026957830 7:74389019-74389041 CCTGCCCAGGTCTTTGCCCTTGG + Intronic
1027665777 7:81042003-81042025 CATCCCCAGGACTTAGCCTGGGG - Intergenic
1040669741 8:49675337-49675359 CGCCCCCAGGAAATTGACATTGG - Intergenic
1042797356 8:72678908-72678930 CCTGCCTAGGACCTTGCCATGGG + Intronic
1045378644 8:101600810-101600832 CTTCCCAAGGACTCTGACATAGG - Intronic
1045812533 8:106239825-106239847 TTTCCCCTTGACTTTGCCATGGG - Intergenic
1048391783 8:133973920-133973942 CCTCCCCAGGAATTTCCCAAGGG + Intergenic
1052342825 9:27380214-27380236 CCTCCCCAGAACTTTGTGATTGG - Intronic
1057733254 9:97630382-97630404 CATTCCCAGGACTATTCCATGGG - Intronic
1186841978 X:13493523-13493545 AGTTCCCATGATTTTGCCATTGG + Intergenic
1189661370 X:43303320-43303342 CTTCCCAAGGTCTTTTCCATGGG - Intergenic
1189971559 X:46422919-46422941 GGTTCTCAGGACTTTGACATTGG - Intergenic
1190280823 X:48928610-48928632 TGTCCCCAGGAATTTGAGATTGG + Intronic
1190881118 X:54493606-54493628 CCACCCCAGGACTTTTGCATTGG - Intronic
1192145566 X:68680047-68680069 TGTCTCTAGGACTTTGGCATGGG + Intronic