ID: 1022312412

View in Genome Browser
Species Human (GRCh38)
Location 7:29209535-29209557
Sequence TCTATCCAGTTTTAAATTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 424
Summary {0: 1, 1: 0, 2: 4, 3: 28, 4: 391}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022312412_1022312416 19 Left 1022312412 7:29209535-29209557 CCATTAATTTAAAACTGGATAGA 0: 1
1: 0
2: 4
3: 28
4: 391
Right 1022312416 7:29209577-29209599 AGTAGGACAGTGAGGGTTGAAGG No data
1022312412_1022312415 12 Left 1022312412 7:29209535-29209557 CCATTAATTTAAAACTGGATAGA 0: 1
1: 0
2: 4
3: 28
4: 391
Right 1022312415 7:29209570-29209592 AATGAGAAGTAGGACAGTGAGGG No data
1022312412_1022312413 2 Left 1022312412 7:29209535-29209557 CCATTAATTTAAAACTGGATAGA 0: 1
1: 0
2: 4
3: 28
4: 391
Right 1022312413 7:29209560-29209582 CTTTAGCTCTAATGAGAAGTAGG 0: 1
1: 0
2: 0
3: 20
4: 136
1022312412_1022312414 11 Left 1022312412 7:29209535-29209557 CCATTAATTTAAAACTGGATAGA 0: 1
1: 0
2: 4
3: 28
4: 391
Right 1022312414 7:29209569-29209591 TAATGAGAAGTAGGACAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022312412 Original CRISPR TCTATCCAGTTTTAAATTAA TGG (reversed) Intronic
900084411 1:883357-883379 TTTATCCAGTTTATCATTAATGG + Intergenic
900639183 1:3680745-3680767 ACTCTCCCATTTTAAATTAACGG + Intronic
901142671 1:7045068-7045090 TCTATCCTGTTTTTAATCATGGG + Intronic
902175371 1:14646190-14646212 TCTATACATTGTTAAATTCATGG + Intronic
902460905 1:16576002-16576024 TCTATCTAGTTTTAAAGGACAGG - Intronic
905983711 1:42256206-42256228 TTTATCAATTTTTAATTTAATGG - Intronic
906882929 1:49612174-49612196 TCCACCAAGTGTTAAATTAAAGG - Intronic
907058628 1:51397656-51397678 TCTGTCCAGTTTTTATTCAATGG + Intronic
907861051 1:58353531-58353553 TTTATCGAGTTTAAAATTAGTGG + Intronic
908309417 1:62862207-62862229 TAGATGCATTTTTAAATTAAAGG + Intronic
908620123 1:65969322-65969344 TATATCCAGTTATAAATCACTGG + Intronic
909689741 1:78393955-78393977 TCTATCCAGTTTATTATTGATGG + Intronic
909867315 1:80689451-80689473 TCTATCCATTTTTAAATTATAGG - Intergenic
910339972 1:86174974-86174996 TATATACATTTTAAAATTAATGG - Intergenic
910902809 1:92140474-92140496 TTTATTCAGTTTAAAATTAAAGG - Intronic
911940062 1:104034481-104034503 TCTATCCCACTCTAAATTAAAGG + Intergenic
912310305 1:108614125-108614147 TCTATCCAGCTTAAATTTCATGG + Intronic
912423717 1:109567017-109567039 TCTTTCCTGTTGTAAATGAAAGG + Intronic
913091770 1:115480954-115480976 TCTAGCCACTTTTTAATTCATGG + Intergenic
913640619 1:120809002-120809024 TCTATCTAGTTTTAAAGGACAGG + Intronic
913641388 1:120815286-120815308 TCTATCTAGTTTTAAAGGACAGG + Intronic
914211907 1:145587622-145587644 TCTATCTAGTTTTAAAGGACAGG - Intergenic
914277858 1:146141339-146141361 TCTATCTAGTTTTAAAGGACAGG - Intronic
914364184 1:146963552-146963574 TCTATCTAGTTTTAAAGGACAGG + Intronic
914364951 1:146969839-146969861 TCTATCTAGTTTTAAAGGACAGG + Intronic
914487498 1:148123588-148123610 TCTATCTAGTTTTAAAGGACAGG - Intronic
914538903 1:148592287-148592309 TCTATCTAGTTTTAAAGGACAGG - Intronic
914587061 1:149072453-149072475 TCTATCTAGTTTTAAAGGACAGG - Intronic
914587842 1:149078742-149078764 TCTATCTAGTTTTAAAGGACAGG - Intronic
914627776 1:149479337-149479359 TCTATCTAGTTTTAAAGGACAGG + Intergenic
914861833 1:151392669-151392691 CCTGTCCAGTTTTCAATCAAAGG + Intergenic
915234658 1:154471737-154471759 TGTATGCATTATTAAATTAAGGG + Intronic
917600057 1:176565160-176565182 TGTATCCAGTCTTCAATTACTGG + Intronic
921628632 1:217406243-217406265 CCTAACAATTTTTAAATTAATGG + Intergenic
922319401 1:224472389-224472411 TTTATCCACTTATAGATTAATGG - Intronic
922379500 1:225008308-225008330 TTTATCCAGTCTAACATTAATGG + Intronic
922692419 1:227705374-227705396 TTTATCCAGTCTAACATTAATGG - Intergenic
923413177 1:233730119-233730141 TCTATCCACTTTTAATTTCTGGG + Intergenic
924188423 1:241520432-241520454 TTTATACATTTTCAAATTAAAGG + Intergenic
924284513 1:242471973-242471995 ACCATCCTTTTTTAAATTAAGGG + Intronic
924717911 1:246595167-246595189 CCTATTCAGTTTAAAATTAAGGG - Intronic
1063843429 10:10098652-10098674 TTTATACAGTTTTAAATTTGTGG - Intergenic
1065022013 10:21509042-21509064 GCTTTCCAGGTTTTAATTAATGG - Intergenic
1065064672 10:21949164-21949186 CCTAACCAGTTTTAAAATGAGGG + Intronic
1067795909 10:49321876-49321898 TCTACCCATTTTTAAATCAGCGG + Intronic
1068802401 10:61157009-61157031 TCTATCCTGTTTTCTATAAAAGG + Intergenic
1068807918 10:61221169-61221191 TTTCTCCATTTTTAAAATAAGGG - Intergenic
1069059851 10:63884040-63884062 TCTATTGATTTATAAATTAATGG - Intergenic
1069330465 10:67286016-67286038 TCTAGGCATTTTAAAATTAATGG + Intronic
1069363349 10:67669796-67669818 TCTATCCATTTAAAAATCAAAGG - Intronic
1070686518 10:78488332-78488354 TCTAGCTAGCTTTAAATTTATGG - Intergenic
1074598050 10:114885440-114885462 TCTATCCTGTTTTCATTTTAAGG + Intronic
1075372410 10:121949129-121949151 TCTGTCCAGTGTTAATATAAAGG + Intergenic
1077744140 11:4881794-4881816 TATATACAATTTTAAATTTAAGG - Intronic
1078117767 11:8471726-8471748 TTTTTCCTGTTTTAAATTAGAGG - Intronic
1078337001 11:10472691-10472713 TCTATCCCCTTTTAAAGTTAGGG + Intronic
1079425300 11:20335203-20335225 GCCATCCAATTTTAAATTGAGGG + Intergenic
1079627100 11:22629055-22629077 TTTATCCACTTTTCAATTGATGG + Intronic
1079647756 11:22888363-22888385 TTTATCCATTTTTACTTTAATGG - Intergenic
1079965886 11:26979283-26979305 TTTATCCAGTCTAACATTAATGG + Intergenic
1080151237 11:29054865-29054887 TTTATCCAGTCTTTAATTGATGG - Intergenic
1080334556 11:31181095-31181117 TCTGCCCAGTTTTAACTTACCGG - Intronic
1081220035 11:40448633-40448655 TTTATCCAGTTTAACATTAATGG + Intronic
1081249166 11:40808532-40808554 TCTCTCCTGTTATAAAGTAAAGG + Intronic
1081251234 11:40837136-40837158 TCTATGCACTTATGAATTAAAGG + Intronic
1082198800 11:49337540-49337562 TCTTTCCAGTTTCAAATGTATGG + Intergenic
1082300969 11:50505677-50505699 TCTTTCCAGTTTTTAACTGAAGG + Intergenic
1082742010 11:56921348-56921370 TTTATCCAGTCTAACATTAATGG - Intergenic
1085171726 11:74455311-74455333 TTTGTCCAGTTTCAACTTAAGGG - Exonic
1085496080 11:76971096-76971118 TTTATCCACTTGTCAATTAATGG + Intronic
1085676778 11:78528307-78528329 TCAATCCCGTTTTAAAGAAAAGG + Intronic
1086248518 11:84785588-84785610 TCTATACAATTTCAAATTCAAGG - Intronic
1087464948 11:98492530-98492552 TCTGCAAAGTTTTAAATTAATGG - Intergenic
1087656306 11:100927387-100927409 TCTATCCTGTTTAAAATCTAAGG + Intronic
1088000435 11:104873749-104873771 TTTATCCAATTTTATATTAAAGG - Intergenic
1088133000 11:106518257-106518279 TTTATCAATTTTTAAATTTATGG - Intergenic
1090683714 11:129090911-129090933 TGTATTTAGTTTGAAATTAATGG - Intronic
1093335479 12:17900095-17900117 TTTATCCAGTTTATCATTAATGG + Intergenic
1093339981 12:17961964-17961986 TTTATCCAGTTTAACATTGATGG + Intergenic
1093587924 12:20864105-20864127 TTTTTCCAATTTTAAATAAAGGG - Intronic
1093601118 12:21024498-21024520 TTTTTCCAATTTTAAATAAAGGG - Intronic
1094087680 12:26611442-26611464 TCTATCTAGTTTTTACTTCAAGG - Intronic
1094225978 12:28046731-28046753 TTTATCCAGTTTGTCATTAATGG - Intergenic
1094781556 12:33797232-33797254 TTTATCCAGTCTAAGATTAATGG + Intergenic
1095074537 12:37900940-37900962 TCTATCCAGTTTTTATCTGAAGG + Intergenic
1095344913 12:41138990-41139012 TTTATCCAGTCTTACATTGATGG - Intergenic
1095530252 12:43178805-43178827 TATATCCTTTTTTAAAATAAAGG + Intergenic
1095589844 12:43891142-43891164 TTTATCTACTTTTAAAATAATGG + Intronic
1099489374 12:83269328-83269350 TCTAAGCAGCTTTAAATTGATGG - Intergenic
1099730724 12:86496996-86497018 TATTTACAGTTTCAAATTAAAGG + Intronic
1100908283 12:99327896-99327918 TATATCTATTTTTAAACTAACGG + Intronic
1101677585 12:106932271-106932293 TTTATCCATTTTTAACTTAATGG - Intergenic
1101744291 12:107526739-107526761 TTTATACAGTTGTAAATTAATGG - Intronic
1104429261 12:128703530-128703552 TTTATCCAGTTTATCATTAATGG + Intronic
1106087398 13:26555922-26555944 TCTAAGCAGTTTTTATTTAAAGG + Intergenic
1106640270 13:31577390-31577412 TGTATCTGGTTTCAAATTAAGGG + Intergenic
1107036325 13:35906117-35906139 TCTATCCTGTTCCAAATTACTGG + Intronic
1107160555 13:37222089-37222111 TCTGTCCATTTCTAAAATAAGGG + Intergenic
1108892922 13:55284254-55284276 TCTATTCAGTTTAAAATAATTGG - Intergenic
1109454246 13:62563189-62563211 TCTATCAACTTTTAAGTTCAGGG + Intergenic
1109508779 13:63340525-63340547 TTTAACCATTTTTAAATAAAAGG - Intergenic
1110075275 13:71232530-71232552 TTTATTAAATTTTAAATTAATGG + Intergenic
1110476418 13:75919806-75919828 TCTATCCAGTGTGTCATTAATGG - Intergenic
1110992522 13:82060780-82060802 TTTATCCAGTTTACAGTTAATGG + Intergenic
1111563204 13:89979517-89979539 TTTATCCAATTTTTAATTCAAGG + Intergenic
1111653415 13:91122532-91122554 ACTATCCAATTTAAAGTTAAAGG + Intergenic
1115025318 14:28738169-28738191 TATATCCAGTTATAAATGATTGG + Intergenic
1115996527 14:39201279-39201301 TTTATTCATTTTTTAATTAATGG - Intergenic
1116526282 14:45910015-45910037 TTTATCCATTCATAAATTAATGG + Intergenic
1117024652 14:51607362-51607384 TGTATCCAGTTTAAAACTGAGGG + Intronic
1117060813 14:51961181-51961203 TCTGCCCAGTTTTTAATTTAAGG + Intronic
1117592192 14:57282153-57282175 TTCATGAAGTTTTAAATTAATGG - Exonic
1118103740 14:62634609-62634631 TCTTTCCCCTTTTTAATTAAGGG - Intergenic
1119459347 14:74786676-74786698 TTTATCCATTTTAATATTAATGG + Intronic
1121743624 14:96270823-96270845 CCTGTCCAGTGCTAAATTAAGGG - Intergenic
1122185788 14:99994062-99994084 TGTATCCAGTTTGGAATTACAGG + Intronic
1125089904 15:35778151-35778173 TCTAGCCAGCTTTTCATTAATGG + Intergenic
1126522922 15:49617157-49617179 TCTATCCATTTTGAAATACAAGG - Intronic
1126766152 15:52013408-52013430 TCCATCCATTTTTAAAATCAAGG + Intronic
1127594663 15:60467422-60467444 TTTTTCCCATTTTAAATTAAAGG + Intronic
1128485884 15:68088197-68088219 TATATCCCATTTTAAATTAAAGG + Intronic
1130818914 15:87471676-87471698 TCTATCCAGTTTAAAAATAAAGG + Intergenic
1137081482 16:36064156-36064178 TCTGTCCAGTTTTAATGTGAAGG - Intergenic
1137225372 16:46500607-46500629 AATGTCCAGTTTTAAATTGAAGG - Intergenic
1137804603 16:51292257-51292279 TCTATCAGGTTTTAACTTACAGG - Intergenic
1138708578 16:58942999-58943021 TCTGTCCATTTTTAAATAATTGG + Intergenic
1138966100 16:62085881-62085903 TCTATCCAGTCTATCATTAATGG - Intergenic
1139667330 16:68466815-68466837 TCTATCCAGGTGTAAATAAAAGG - Intergenic
1140069579 16:71637527-71637549 TATTTTCAGTTTTAAATTAGAGG + Intronic
1142732987 17:1874838-1874860 TCTATCCAGTATTTATTTACTGG - Intronic
1145034491 17:19531576-19531598 TCTATTAAATTTTAAAATAATGG + Intronic
1149021951 17:51978661-51978683 TTTATTCATTTTTCAATTAATGG - Intronic
1149246473 17:54713898-54713920 TCTATCCATTTTATAATTCATGG - Intergenic
1150043161 17:61885216-61885238 TCTGTCTAGTTTTAAATTTCAGG - Intronic
1150921118 17:69484226-69484248 TCTTTTCAGTATTAAATGAAAGG - Intronic
1151117205 17:71750623-71750645 TAAATCCAGTTTTAAAAAAATGG - Intergenic
1153120135 18:1713709-1713731 TCTATCCAGCTTTAAGATGAAGG + Intergenic
1153125242 18:1783717-1783739 TCTGTCCAGTGTTAAGATAAAGG + Intergenic
1154475452 18:14750313-14750335 TTTGCCCAGTTTTAAATTAGAGG - Intronic
1156516040 18:37681457-37681479 TATCTCCAGTTTTAAAGGAAAGG - Intergenic
1156770708 18:40719502-40719524 TCTATTTAGTTTTAAAGAAAAGG + Intergenic
1158494440 18:57941734-57941756 TCTATGAAGTTTTAGATTGAGGG - Intergenic
1159477311 18:68938745-68938767 TCTATGCACTCTTGAATTAATGG + Intronic
1159564766 18:70036301-70036323 TTTATCCAGTTTTCCATTGATGG - Intronic
1159826380 18:73216662-73216684 AATATTCAGTTTTAAATAAATGG + Intronic
1159982395 18:74800116-74800138 TCTTTCCATTTTTAAAGTCATGG + Intronic
1160380664 18:78452634-78452656 GCTATCCATTTTTCAATTACTGG + Intergenic
1164055196 19:21616244-21616266 TCTCTCCTGTTAAAAATTAAAGG - Intergenic
1166595206 19:44041686-44041708 TCAATCAGGTTATAAATTAATGG + Intergenic
925617408 2:5756808-5756830 TCTTTCCATTTCTAATTTAAAGG - Intergenic
925890373 2:8428915-8428937 TCTATCCAGTTCTCTATTAAAGG + Intergenic
927120371 2:19954903-19954925 TTTATTCATTTTTCAATTAATGG - Intronic
927235044 2:20865502-20865524 TTTATCCAGTTTATAATTGATGG - Intergenic
927781771 2:25945224-25945246 TATATGCAGATTTAAATTAATGG + Intronic
928272465 2:29868792-29868814 TCTGTCCAGATTTAAGATAAGGG - Intronic
928750309 2:34462997-34463019 TCTATGCAGTTTAAGATTATTGG + Intergenic
930393638 2:50792265-50792287 TCTTTCCATTATTCAATTAATGG - Intronic
930402679 2:50910581-50910603 TATTTTCAGTTTTGAATTAAGGG - Intronic
930425595 2:51208428-51208450 TTTATCAAGTTATACATTAAAGG - Intergenic
930498301 2:52176746-52176768 TCTATCCAGTTTTAATTCTTGGG - Intergenic
933106414 2:78332273-78332295 TCTAACCCTTTTTATATTAATGG - Intergenic
933308476 2:80631531-80631553 TATTTCCAGTTTTAGATTGAAGG + Intronic
933498818 2:83086352-83086374 TCTATCTCTTTTAAAATTAAGGG + Intergenic
933569960 2:83998660-83998682 CGTATCCAGTTTTAAATTGGTGG - Intergenic
933704638 2:85280589-85280611 TCTATCCTGTTTAATATTAGGGG + Intronic
934083862 2:88492933-88492955 TATCTCCACTTTGAAATTAATGG + Intergenic
935796752 2:106649352-106649374 TGTAGCAAGTTTTAATTTAAGGG - Intergenic
935799003 2:106673853-106673875 TTTATCCAGTTTATCATTAATGG + Intergenic
936000186 2:108819900-108819922 TCTTTCCATTTTTAAATTATCGG - Intronic
936434455 2:112492267-112492289 TGCATCCGTTTTTAAATTAAAGG + Intronic
939077281 2:137618994-137619016 CCTACCAAGTTTCAAATTAATGG + Intronic
940153881 2:150632503-150632525 TTTTTTCAGTTTTAAATTATTGG + Intergenic
940554619 2:155207739-155207761 TCTAACCTTTTTTGAATTAATGG - Intergenic
940584676 2:155631203-155631225 TTTCTAAAGTTTTAAATTAATGG - Intergenic
940698831 2:157016139-157016161 TCTTTCAATTTTTAATTTAAGGG + Intergenic
941065060 2:160892526-160892548 TCTCTTCAGTTTTTAATTATTGG + Intergenic
941372669 2:164686059-164686081 GCTATCCCATTTTAAATTGATGG - Intronic
941559998 2:167033051-167033073 TTTATCCAGTCTAACATTAATGG - Intronic
942099928 2:172570250-172570272 TATCTCTAGTTTGAAATTAAGGG - Intronic
942331397 2:174828405-174828427 TATATGCAGTTTTACATTATCGG + Intronic
942573732 2:177340280-177340302 TGTATTCATTGTTAAATTAAGGG + Intronic
942785660 2:179698512-179698534 AATATCCATTTTTAAATCAAGGG + Intronic
942899292 2:181094975-181094997 TTTATCCAGTTTAACATTGATGG - Intergenic
943001727 2:182336375-182336397 TTTATCCAGTCTAAAATTGATGG - Intronic
943182780 2:184564590-184564612 TATATCTGGTTTCAAATTAAAGG + Intergenic
943505247 2:188747420-188747442 TCCATCTAGCTTTAAATTAGGGG + Intronic
943837354 2:192530252-192530274 TTTATCCAGTTTATAATTGATGG - Intergenic
943849631 2:192701659-192701681 TCATTGCAGTGTTAAATTAATGG - Intergenic
943915080 2:193621366-193621388 TGGATACAGTTTTAATTTAATGG - Intergenic
943936928 2:193931088-193931110 TCTAACCAGTGTTAAATATAAGG - Intergenic
944053630 2:195499703-195499725 TCAATCCACTTTTGAATTAATGG - Intergenic
944113539 2:196162127-196162149 TCTTTTGAGCTTTAAATTAAAGG - Intronic
944254287 2:197609017-197609039 TTTATCCAGTTTATCATTAATGG + Intronic
944644822 2:201768472-201768494 TATGTCCAGTTATAATTTAAGGG - Intronic
944696646 2:202207386-202207408 TCTTTGCACTTTTAAATTAGTGG - Intronic
946981436 2:225220337-225220359 TTTATCCAGTTTATCATTAATGG + Intergenic
946992010 2:225343859-225343881 TATATCCAGTCTTACATTGATGG + Intergenic
1169288658 20:4330538-4330560 TCAATCCATTTATAAATTAATGG - Intergenic
1169585438 20:7078483-7078505 TCTATCCTGATATAAATAAATGG - Intergenic
1169879396 20:10329925-10329947 TCTATCCAGTTTTCCAGTAAAGG - Intergenic
1170309788 20:14980223-14980245 TCAATCCATTCTTGAATTAATGG + Intronic
1170403713 20:16014146-16014168 TCTATTCAGCTTTAAAATATAGG + Intronic
1171215835 20:23351299-23351321 TCTGTCTAGGTTTGAATTAAAGG + Intronic
1171817064 20:29795804-29795826 TTTATCCAGTTTATCATTAATGG - Intergenic
1171901287 20:30860201-30860223 TTTATCCAGTTTATCATTAATGG + Intergenic
1172883192 20:38214835-38214857 GCTATCGGGTTCTAAATTAATGG - Intronic
1173346001 20:42200593-42200615 CCTATCCAGTTAAAATTTAAAGG - Intronic
1174274603 20:49394686-49394708 TCTATCCAGTTTCAATATGAAGG - Intronic
1174687593 20:52470388-52470410 TCTATGCAATTATAAATTACTGG - Intergenic
1177127515 21:17214309-17214331 TCTAGCCAATTTTAACTTAGTGG - Intergenic
1177234304 21:18366489-18366511 TCTATTCAGATATAAATTAAAGG - Intronic
1179018993 21:37620943-37620965 TTTACTCAATTTTAAATTAAAGG + Exonic
1180320395 22:11314571-11314593 TTTATCCAGTTTATCATTAATGG - Intergenic
1180334654 22:11566153-11566175 TTTATCCAGTTTATCATTAATGG + Intergenic
1180398220 22:12378693-12378715 TCTATCCAGTTTTTATGTGAAGG - Intergenic
1180403638 22:12522981-12523003 TCTGTGCAGTTTTTAATTGAAGG - Intergenic
1182236613 22:28881930-28881952 TCCATCCAGTTCTTAATTAAGGG - Intergenic
1182808739 22:33097898-33097920 TGTATCCAGTTATATAGTAATGG - Intergenic
1182841923 22:33398034-33398056 TCTTCCCACTTTTAAAGTAAAGG + Intronic
949378410 3:3416358-3416380 TTTATCCAGTTATTAATTGATGG - Intergenic
949665513 3:6334171-6334193 ACTATCCAGTATTAGCTTAATGG - Intergenic
949791317 3:7795497-7795519 TGTGTCCAGTTTTAATTTCACGG + Intergenic
950964734 3:17138336-17138358 TCTATCCAGTTACAAACAAAAGG + Intergenic
951088302 3:18540966-18540988 TCTTTCTAGTTTTATATAAATGG - Intergenic
951700233 3:25488853-25488875 GTTCTCCAGTTTTCAATTAAAGG - Intronic
952393294 3:32899364-32899386 TTTATCCAGTTTTCAGTTGAGGG - Intergenic
952730302 3:36631427-36631449 TCCATCCAGTTTTAAAGGACAGG - Intergenic
956961398 3:74406342-74406364 TCTTTACAGTTTTCAATTATGGG + Intronic
957176517 3:76817886-76817908 TTTATCCACTTGTTAATTAATGG + Intronic
957509657 3:81170752-81170774 TCTGGCCAGTTTTGAATCAATGG - Intergenic
957554601 3:81749989-81750011 ACCATACAGTTTTTAATTAAAGG + Intronic
957701692 3:83723796-83723818 TCCATCCATTTTTGAATAAATGG + Intergenic
957839922 3:85654670-85654692 GCTATCCAATTTTAAACTCATGG - Intronic
958055282 3:88402970-88402992 TCAAACCAATTTAAAATTAAAGG + Intergenic
958153279 3:89719600-89719622 TCTATCCACTACAAAATTAAGGG + Intergenic
959057154 3:101578658-101578680 TCTATACAGTTTTGGAATAATGG - Intronic
959077932 3:101770527-101770549 TCTGTCTAATTTTAAATAAAAGG + Exonic
959686901 3:109157408-109157430 TCTATACAATTATAAATTAAGGG - Intergenic
959778294 3:110198358-110198380 TTTCTACAGTTTTAAATTACTGG - Intergenic
959976142 3:112462271-112462293 TTTATCCAGTCTTCCATTAATGG - Intergenic
960729423 3:120709638-120709660 ACTATGCAGATTTAAATCAAGGG + Intronic
960863444 3:122176391-122176413 TCTATCCAGTCTATCATTAATGG - Intergenic
962078145 3:132106930-132106952 TCTAGTCAGTTATAAATTACTGG + Intronic
962293618 3:134159812-134159834 TATTTAAAGTTTTAAATTAAAGG + Intronic
963660214 3:148116002-148116024 TCTATCCTTTCTAAAATTAATGG - Intergenic
964218843 3:154321411-154321433 TCTTTCAAGTTTCAACTTAAGGG + Intronic
964744098 3:159996414-159996436 TCTATACAGTTTTAAACAAATGG - Intergenic
965137702 3:164794219-164794241 TCTTTGCAGATTTAAATAAATGG + Intergenic
965214382 3:165842773-165842795 TCTGTACAATTTTAAATTTATGG + Intergenic
966105460 3:176327470-176327492 TCTTTCCACTTCTAAAATAATGG + Intergenic
966358011 3:179102924-179102946 TCTAGCCAGTTTTTAATTTGGGG + Intergenic
966948258 3:184793043-184793065 TTTATCCACTTGTTAATTAATGG + Intergenic
967016209 3:185484152-185484174 TCAATGCAGTTTTAAATAACTGG + Exonic
967556128 3:190861175-190861197 TCTACCCAGATCTAAATAAAGGG + Intronic
970291201 4:14574315-14574337 TCTTTTCATTTTTAAATAAAGGG + Intergenic
971183947 4:24355826-24355848 GCTAACCTGTTTTAAATTGATGG - Intergenic
971575728 4:28271851-28271873 TTTATCCAGTCTAACATTAAGGG - Intergenic
971652169 4:29292358-29292380 TTTATCCAGTTTTTCATTGATGG - Intergenic
972207535 4:36794982-36795004 TCAAACCAGTTTTACATTCAGGG + Intergenic
972605986 4:40614377-40614399 TCTATCTAATTTTAAAAGAAAGG + Intronic
973920541 4:55680685-55680707 TTTATCCACTTGTTAATTAATGG - Intergenic
974632089 4:64506201-64506223 TATATCCACTTCTAAAATAAGGG - Intergenic
974755423 4:66200158-66200180 TGTATTCACTTTTACATTAACGG + Intergenic
975167313 4:71191575-71191597 TTTATCCTGTTTTAAAGTGATGG + Intronic
975389148 4:73796401-73796423 TCTATCCAGTCTATAATTGATGG - Intergenic
975999365 4:80354905-80354927 TTTATCCAGTTGGTAATTAATGG + Intronic
976629718 4:87223957-87223979 CCTTTCCAGTTTTAATTTATCGG - Intronic
977632194 4:99255401-99255423 TTTATCCAGTTTATAATTGATGG + Intergenic
978901660 4:113957452-113957474 TATTTCCATTTTTAAATAAAAGG - Intronic
978973413 4:114838425-114838447 TTTATCCAGTCTAAAATTGATGG - Intronic
979307572 4:119165133-119165155 TTTATTCATTTTTAAATGAATGG - Intronic
980620154 4:135290855-135290877 TATATCCAGATTTACATAAATGG - Intergenic
980845502 4:138319285-138319307 TCTAAGCTGTTTTAAATAAATGG - Intergenic
981046193 4:140267481-140267503 TCTACCCTGTTCTAAATCAAAGG + Intronic
981685184 4:147446482-147446504 TGTATCCAGCTTTGAATTCAAGG + Intergenic
981891288 4:149741181-149741203 ACTCTTCAGTTCTAAATTAAAGG + Intergenic
982648698 4:158058076-158058098 TCTATGCAGTTTAAAAATACAGG + Intergenic
982842305 4:160205548-160205570 TCTATGGACTTTTAAGTTAAGGG - Intergenic
982920052 4:161262235-161262257 ACTATTCAGTTCTAAATTATTGG - Intergenic
983956633 4:173705752-173705774 TCTATCCATTTTTAAACTCTTGG + Intergenic
984037638 4:174690504-174690526 TTTATTCAGTTTTAAATTTTAGG + Intronic
984076865 4:175194147-175194169 TCTATTTATTTTTAAATGAAAGG + Intergenic
987033767 5:13999523-13999545 ACTATTCAGTTTTAAAATGAAGG - Intergenic
989871615 5:46609055-46609077 TCTGTCTAGTTTTAATTTGAAGG - Intergenic
989872580 5:46626794-46626816 TCTGTCTAGTTTTAATTTGAAGG - Intergenic
989876132 5:46692980-46693002 TCTGTCTAGTTTTTATTTAAAGG - Intergenic
990569966 5:57068234-57068256 TCTATGAGGTTTGAAATTAAAGG - Intergenic
991040480 5:62169856-62169878 TTTATCCAGTTTATCATTAATGG - Intergenic
993323507 5:86505168-86505190 TCTCTCGAGTTTTAATCTAAAGG - Intergenic
993865269 5:93187213-93187235 TTTATCCATTTTTAAATAGAGGG + Intergenic
993933297 5:93969860-93969882 TCTAGCTAGTTATAATTTAAGGG + Intronic
994970986 5:106736463-106736485 TCTATCCAGTTTACCATTGATGG - Intergenic
996051482 5:118939290-118939312 TCAATTCATTTTTTAATTAAAGG - Exonic
997052081 5:130394597-130394619 TCTATCCAGTCTATAATTGATGG - Intergenic
997488744 5:134254582-134254604 TCTACCCAGTCTGAAATAAAGGG - Intergenic
997711833 5:136011393-136011415 TCTTGCCAGTTTTAAATCAAAGG - Intergenic
998090504 5:139364546-139364568 TCTATCTAGATTTATAATAAAGG - Exonic
1002825713 6:771939-771961 TTTATCCAGTCTTTTATTAATGG + Intergenic
1002958285 6:1889992-1890014 TTTATCCATTTATGAATTAATGG + Intronic
1005112545 6:22299174-22299196 TCTTTATTGTTTTAAATTAAGGG - Intergenic
1008011294 6:46470347-46470369 TTTATCCAGTTTTATATATATGG - Intronic
1008354638 6:50537627-50537649 TTTATCTAGTTTTCCATTAATGG - Intergenic
1008550546 6:52625555-52625577 TTTATCCAGTTTACCATTAATGG - Intergenic
1008839643 6:55886847-55886869 TGTACACAGTTTTAAATTATAGG + Intergenic
1008929440 6:56923159-56923181 TCACTACAGTTATAAATTAAAGG + Intronic
1009193038 6:60652323-60652345 TTTATCCAGTTTAACATTGATGG + Intergenic
1009542540 6:64980895-64980917 GATATCCAGTTTTAAATTAAGGG - Intronic
1009785168 6:68327384-68327406 TCTTTTCAGTTGTAAAGTAATGG - Intergenic
1009853858 6:69233718-69233740 TCTTTCCAGCTTTAAAATAAAGG - Intronic
1010702425 6:79066755-79066777 ACTTTCTAATTTTAAATTAAGGG - Intronic
1010760913 6:79722273-79722295 ACTATTCAGTTTTATATTTAAGG - Intergenic
1011414652 6:87105180-87105202 TCAATACATTTTTAAAATAAGGG + Intergenic
1011427700 6:87248633-87248655 ACTATGCAGTTTTAAATCATAGG + Intronic
1011762433 6:90582768-90582790 TATATTCAGTTTTAAATTTGTGG + Intronic
1012046941 6:94288429-94288451 TCTTGCCAGTTTATAATTAAGGG - Intergenic
1012816545 6:104029486-104029508 TCTATCCAGTTATAATTTTCTGG - Intergenic
1013025558 6:106268633-106268655 TCTATCCAGTCTAACATTGATGG - Intronic
1013673109 6:112427160-112427182 TTTATCCAGTCTAACATTAAAGG - Intergenic
1013701491 6:112775700-112775722 CATATCCAGTTTTAAAATATGGG - Intergenic
1013898210 6:115119298-115119320 TTTATCCAGTCTCAAATAAAAGG - Intergenic
1013944873 6:115710251-115710273 GTTATCCAATTTTAAATTATTGG + Intergenic
1014105892 6:117560422-117560444 TCTATCCAGTCTTACACTTATGG - Exonic
1014854705 6:126385363-126385385 TTTATCCAGTCTTTTATTAATGG - Intergenic
1015077396 6:129176027-129176049 TTTATCTATTTTTAAAATAATGG + Intronic
1015479503 6:133692232-133692254 TGTCTCCATTTTTTAATTAAAGG + Intergenic
1015949751 6:138540160-138540182 TATATGCAATTTTAAATGAAAGG + Intronic
1016258191 6:142135321-142135343 ACTATACAGTTTTAAATTTGAGG + Intergenic
1016477585 6:144444845-144444867 TTAATCCAGTGTTAAATCAAAGG - Intronic
1017383116 6:153853009-153853031 TCTGACCTGTTTTAAATTAACGG + Intergenic
1017577936 6:155826337-155826359 TCTATCCATTCTTTCATTAATGG - Intergenic
1018340772 6:162848558-162848580 TCTTTCCAGTTTTGAAATTAAGG + Intronic
1018692540 6:166360159-166360181 TCTACCCAATTTTAAATATAAGG - Intergenic
1018702028 6:166434842-166434864 TCTCTCCATTTTTAAAACAAGGG - Intronic
1020571953 7:9874754-9874776 TCTCTCCAGTTTGAGATTATTGG - Intergenic
1020927016 7:14341626-14341648 TCTTTTCAGTTTTAAAATAGAGG + Intronic
1021544900 7:21802572-21802594 TTTATCCATTTATCAATTAAGGG - Intronic
1022288978 7:28983005-28983027 TTTATCCACCTTTAAGTTAAGGG - Intergenic
1022312412 7:29209535-29209557 TCTATCCAGTTTTAAATTAATGG - Intronic
1022555646 7:31292839-31292861 TCTCTCTAGTTTTTATTTAAAGG + Intergenic
1024684422 7:51729886-51729908 TGCATCCAATTTCAAATTAAAGG - Intergenic
1025584328 7:62763281-62763303 TCTTTCTAGTTTTTAATTCAGGG + Intergenic
1026082924 7:67238299-67238321 TCTTTCCAGTTTAAAATTGGTGG + Exonic
1026694134 7:72575706-72575728 TCTTTCCAGTTTAAAATTGGTGG - Exonic
1027496833 7:78898410-78898432 TTTATCCAGTTTAACATTAATGG - Intronic
1027949168 7:84790949-84790971 TCTAACCATTTTTCAATTATTGG - Intergenic
1028379965 7:90189146-90189168 TTTATCCATTTATACATTAATGG + Intronic
1028486897 7:91369253-91369275 TATATCCAGTTTTTATTTTATGG + Intergenic
1028551681 7:92074619-92074641 TTTATCCAGTTTATCATTAATGG - Intronic
1028992732 7:97066870-97066892 TCTATTATGTTTTAAATAAAGGG + Intergenic
1029879271 7:103789941-103789963 TTTATCCAGTCTAACATTAATGG - Intronic
1030810377 7:113965022-113965044 TATATTTATTTTTAAATTAATGG - Intronic
1030834193 7:114263164-114263186 TTTATTCAGTTTCAAATCAAAGG + Intronic
1031289394 7:119913978-119914000 TCTATACAGTTTAGATTTAATGG + Intergenic
1032301945 7:130695840-130695862 TAGGTCCAGATTTAAATTAAAGG - Intergenic
1032763286 7:134965235-134965257 TCTAGCCAGCTCTAAATAAATGG - Intronic
1032968296 7:137128977-137128999 TTTATCCAGCTCTAAATTTAAGG - Intergenic
1033772669 7:144570290-144570312 CTAATCCAGTTTTAAAATAAAGG + Intronic
1033992055 7:147300253-147300275 TCTCGCCAGTTTTAACTTGAAGG - Exonic
1035462107 7:159047275-159047297 CTTTTCAAGTTTTAAATTAAAGG - Intronic
1037038552 8:14201382-14201404 TCTATCCATTTGAAAGTTAAAGG - Intronic
1038942032 8:32315462-32315484 TCTATCCAGTCTATCATTAATGG + Intronic
1039602515 8:38852404-38852426 TCTTGACAGTTCTAAATTAAAGG - Exonic
1039853038 8:41387781-41387803 TCCAGCCAGTTTTATATTTAAGG - Intergenic
1040114471 8:43600160-43600182 TCTTTCTAGTTTTTAATCAAAGG - Intergenic
1040658424 8:49540950-49540972 TCTATCCAGTCTATAATTGATGG + Intronic
1041801109 8:61800862-61800884 GGTATCTATTTTTAAATTAATGG - Intergenic
1041873879 8:62665613-62665635 TGTATTCAGTTTTAGTTTAAAGG + Intronic
1042102807 8:65292323-65292345 TTTATCCAGTTTTCTATTTATGG - Intergenic
1043318552 8:78951874-78951896 TTTATCCAGTTTAACATTGATGG - Intergenic
1043463562 8:80484907-80484929 TCTTTACAGTTATAGATTAATGG - Intergenic
1043835578 8:85041803-85041825 TCTTTCCTGTTTTGAATTAATGG - Intergenic
1044157401 8:88864567-88864589 TCTCTGCAGGTTTAAATTTAGGG - Intergenic
1044235618 8:89826796-89826818 TCTACCCATATTTAAGTTAAGGG + Intergenic
1044381315 8:91537288-91537310 TCTATACAGTTTTCCATAAATGG + Intergenic
1044397693 8:91732612-91732634 TTTTTCCAGTTTTGAATTAGTGG - Intergenic
1044612038 8:94101177-94101199 TCTATCCAGTTAGAAAGAAATGG - Intergenic
1045564998 8:103305376-103305398 TCTATTCAGTTAAAAATAAATGG + Intronic
1045903995 8:107320873-107320895 CAAATCCACTTTTAAATTAAAGG + Intronic
1046162056 8:110378570-110378592 TCTACAAAGTTTTAATTTAACGG - Intergenic
1046354872 8:113069451-113069473 TCTATCCAAGTTTACATTCATGG - Intronic
1046540748 8:115579138-115579160 TCCATCCAGTAATAAATTAATGG + Intronic
1048650523 8:136471078-136471100 TCTCTCCAGTTATATGTTAATGG + Intergenic
1049938467 9:522228-522250 TTTATTTATTTTTAAATTAAAGG + Intronic
1050239392 9:3618716-3618738 TTTATCCAGTCTAACATTAATGG + Intergenic
1050910534 9:11063805-11063827 GCTAAGCACTTTTAAATTAAAGG - Intergenic
1052136453 9:24918131-24918153 TCTATCTAGGTTTAAATCAGAGG + Intergenic
1052504527 9:29335610-29335632 TCTATACAATTTTAAAATAGAGG - Intergenic
1052711479 9:32061876-32061898 TTTATCCAGTCATCAATTAATGG + Intergenic
1053542519 9:38989107-38989129 TCTATCCAGTCTAACATTGATGG + Intergenic
1053806972 9:41812624-41812646 TCTATCCAGTCTAACATTGATGG + Intergenic
1054623620 9:67374803-67374825 TCTATCCAGTCTAACATTGATGG - Intergenic
1055765283 9:79656518-79656540 TCAATACAAATTTAAATTAATGG + Intronic
1055930819 9:81558270-81558292 TGCAGCCAGTTTTAAAGTAATGG + Intergenic
1056337264 9:85584914-85584936 TCTCTCCAACTTTAAATTCAAGG + Intronic
1057295520 9:93834741-93834763 TCTGTCTAGTTTTGAAATAAGGG + Intergenic
1058241266 9:102563939-102563961 TTTATCCATTTTTATATTAATGG + Intergenic
1060193759 9:121609682-121609704 TCTATCCATTTTAGAATTAGGGG + Intronic
1061637778 9:131925476-131925498 TTTATCCATTTTTCAATCAATGG - Intronic
1203368608 Un_KI270442v1:280320-280342 TTTATCCAGTTTATCATTAATGG - Intergenic
1185840806 X:3389676-3389698 TTTATCCAGCATTAAATTAAAGG + Intergenic
1186447903 X:9647577-9647599 TTTCTCCAGTTCTAAAATAAAGG - Intronic
1187326884 X:18299207-18299229 TTTGTCCACTTTTTAATTAAGGG - Intronic
1188386875 X:29572139-29572161 TCAAACCAGTTTTGAATCAAGGG + Intronic
1189649988 X:43178382-43178404 TCCATCTTGTTTTAAATTATTGG + Intergenic
1189733484 X:44046115-44046137 TTTATCCAGTTGTCAATTGATGG + Intergenic
1190178931 X:48175033-48175055 TCTATGCAGTTTTAGCTTATAGG + Intergenic
1191019610 X:55845237-55845259 TTTATCCAGTCTATAATTAATGG - Intergenic
1191677145 X:63803507-63803529 TTTATCCAGTTTATAATTGATGG - Intergenic
1192353458 X:70377370-70377392 TCTATCCATTATTAAAGTAGGGG - Intronic
1192879713 X:75270512-75270534 TTTATCCAGTCTAAAATTGATGG - Intergenic
1193286133 X:79717390-79717412 TTTATGCATTTTTAAATAAAAGG - Intergenic
1193322179 X:80135682-80135704 TATATCCAAATTTAAATAAAGGG - Intergenic
1193864658 X:86716331-86716353 GCCATCCAGTTTCAAAATAATGG - Intronic
1194220283 X:91181877-91181899 TCTATCCAGTCTATCATTAATGG - Intergenic
1194307246 X:92262737-92262759 TCTATCCATTTTTAAATGAATGG - Intronic
1194963503 X:100262009-100262031 TTTATCCAGTTTATAATTGATGG - Intergenic
1195774805 X:108391445-108391467 TCTACCCAGTTTTAACTTCCTGG + Intronic
1196403520 X:115340775-115340797 TCTATCCTGTTTTAAAGTCTTGG + Intergenic
1197119714 X:122875963-122875985 TCTATCCAATTTTAAATGGAGGG + Intergenic
1197430677 X:126359189-126359211 TTTATCCAGTTTAACATTGATGG - Intergenic
1197539716 X:127743163-127743185 TCTATCCAGTCTTTCATTGATGG + Intergenic
1200355879 X:155550107-155550129 TTTATCCAGTCTCAAATTGATGG + Intronic
1201235177 Y:11902422-11902444 TTTATCCAGCATTAAATTAAAGG - Intergenic
1201716561 Y:17050377-17050399 TTTCTCCAATTTTAAAATAATGG + Intergenic