ID: 1022312416

View in Genome Browser
Species Human (GRCh38)
Location 7:29209577-29209599
Sequence AGTAGGACAGTGAGGGTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022312412_1022312416 19 Left 1022312412 7:29209535-29209557 CCATTAATTTAAAACTGGATAGA 0: 1
1: 0
2: 4
3: 28
4: 391
Right 1022312416 7:29209577-29209599 AGTAGGACAGTGAGGGTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022312416 Original CRISPR AGTAGGACAGTGAGGGTTGA AGG Intronic
No off target data available for this crispr