ID: 1022317101

View in Genome Browser
Species Human (GRCh38)
Location 7:29255461-29255483
Sequence CCTTCCAGCCATGAGGTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022317096_1022317101 5 Left 1022317096 7:29255433-29255455 CCTCCACACTGAGAAGCCTTTGT 0: 1
1: 0
2: 2
3: 14
4: 188
Right 1022317101 7:29255461-29255483 CCTTCCAGCCATGAGGTCAGAGG No data
1022317095_1022317101 6 Left 1022317095 7:29255432-29255454 CCCTCCACACTGAGAAGCCTTTG 0: 1
1: 0
2: 4
3: 63
4: 1030
Right 1022317101 7:29255461-29255483 CCTTCCAGCCATGAGGTCAGAGG No data
1022317097_1022317101 2 Left 1022317097 7:29255436-29255458 CCACACTGAGAAGCCTTTGTTAG 0: 1
1: 0
2: 4
3: 12
4: 126
Right 1022317101 7:29255461-29255483 CCTTCCAGCCATGAGGTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022317101 Original CRISPR CCTTCCAGCCATGAGGTCAG AGG Intronic
No off target data available for this crispr