ID: 1022317685

View in Genome Browser
Species Human (GRCh38)
Location 7:29260757-29260779
Sequence GTCCGGTGTCCAGAATTAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 64}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022317685_1022317691 24 Left 1022317685 7:29260757-29260779 CCTGCTAATTCTGGACACCGGAC 0: 1
1: 0
2: 0
3: 8
4: 64
Right 1022317691 7:29260804-29260826 GTAGTTTCTCCCAATAGCAGAGG 0: 1
1: 0
2: 0
3: 12
4: 93
1022317685_1022317686 -10 Left 1022317685 7:29260757-29260779 CCTGCTAATTCTGGACACCGGAC 0: 1
1: 0
2: 0
3: 8
4: 64
Right 1022317686 7:29260770-29260792 GACACCGGACCTGTTTTATGAGG 0: 1
1: 0
2: 0
3: 1
4: 56
1022317685_1022317690 2 Left 1022317685 7:29260757-29260779 CCTGCTAATTCTGGACACCGGAC 0: 1
1: 0
2: 0
3: 8
4: 64
Right 1022317690 7:29260782-29260804 GTTTTATGAGGTGGTGTCTGTGG No data
1022317685_1022317687 -7 Left 1022317685 7:29260757-29260779 CCTGCTAATTCTGGACACCGGAC 0: 1
1: 0
2: 0
3: 8
4: 64
Right 1022317687 7:29260773-29260795 ACCGGACCTGTTTTATGAGGTGG 0: 1
1: 0
2: 0
3: 2
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022317685 Original CRISPR GTCCGGTGTCCAGAATTAGC AGG (reversed) Intronic
903624781 1:24722728-24722750 ATCCTGTGTCCAGAATTGGTGGG - Intergenic
907298508 1:53470714-53470736 GCCCGGTGTCCTGAAGAAGCCGG - Intergenic
908301269 1:62762643-62762665 CTGCTGTGTCCAGAATTAGTGGG - Intergenic
916193309 1:162199563-162199585 CTCTGTTGTCCAGAATTATCAGG - Intronic
1065005826 10:21379220-21379242 GTCACATGTCCAGAGTTAGCTGG + Intergenic
1066661082 10:37738696-37738718 GTTCTGTGTCCAGAATTGGTGGG - Intergenic
1074799731 10:116987446-116987468 ATCCGGTGTTAAGAATTAGTTGG + Intronic
1077037953 11:504305-504327 GCAGGGTGTCCAGAACTAGCAGG - Intronic
1077181435 11:1218960-1218982 GCCTGGTGTTCAGAAGTAGCAGG - Intergenic
1077194971 11:1274890-1274912 GAGCGGTCCCCAGAATTAGCTGG - Exonic
1098595790 12:72272433-72272455 GCCCGGTGTCCAGAGTGAGGCGG + Intronic
1098853921 12:75630587-75630609 GTCCGGTGGCCACGACTAGCAGG - Intergenic
1103713945 12:122932281-122932303 GTCAGGTGGCCAGAAGCAGCGGG - Exonic
1108686878 13:52827323-52827345 GTACTGTGTCCGGAATTGGCGGG - Intergenic
1109379475 13:61540847-61540869 GTAGGGTGTCCAGAAATAACAGG + Intergenic
1118037587 14:61884652-61884674 TTCCTGTTTCCAAAATTAGCAGG + Intergenic
1118887769 14:69880476-69880498 GTCCTGTGCACAGAATTGGCAGG - Intronic
1119370080 14:74132358-74132380 GACTGGTGTCCAGTATCAGCAGG - Intronic
1120701343 14:87702747-87702769 ATCCAGTGCCCAGAAATAGCGGG - Intergenic
1133890226 16:9872193-9872215 GACAGATTTCCAGAATTAGCGGG + Intronic
1135970252 16:27067049-27067071 ATCCTCTGTCCAGAATGAGCAGG + Intergenic
1138650565 16:58458675-58458697 GTGGGGTGTCCAGAGTTACCAGG + Intergenic
1139055138 16:63174180-63174202 GTCCGAAGTCCAGAATTAGGTGG + Intergenic
1139676605 16:68528218-68528240 CTCCTGTGTCCAGAATTGGTGGG - Intergenic
1140722339 16:77783516-77783538 GTACTGTGTCCAGAATTAGTGGG + Intergenic
1153159742 18:2190440-2190462 GTCCAGTGGCCAGTATTTGCTGG + Intergenic
1154169972 18:12044363-12044385 GTCTGGTGTCACGGATTAGCAGG + Intergenic
1161391759 19:4024717-4024739 TTCTGGTGTCCAGCATGAGCAGG + Intronic
928587198 2:32772379-32772401 GTCCGGTATTTAGAATTAGCAGG - Intronic
932811845 2:74832943-74832965 GTCTGGTGTCTAGCATTAGCTGG + Intergenic
935896678 2:107746620-107746642 CTCCTGTGTCCAGAATTGGTGGG + Intergenic
947769929 2:232662455-232662477 CTCCAGTGTCCAGCATTAGGAGG + Intronic
948229402 2:236338598-236338620 CTCTGGTGTCCAGATTTAGAGGG + Intronic
1174779722 20:53377888-53377910 GTCCCGTGGCCAGAGTTTGCTGG + Intronic
1178599916 21:33986302-33986324 GTCAGGTGTTCAGAATTAGGAGG + Intergenic
1182254656 22:29029831-29029853 GTAGGGTGTCCAGACTTTGCAGG + Intronic
960733637 3:120753661-120753683 TTCCTGGGTCCAGAATTTGCAGG - Intronic
961484703 3:127208671-127208693 GTCAGGTGTCCAGCCTGAGCTGG + Intergenic
962568828 3:136691556-136691578 GTTTGGTGTCCAGTAGTAGCTGG + Intronic
964896818 3:161607647-161607669 GTTCAGTGGCCAGAATCAGCAGG + Intergenic
966076244 3:175938660-175938682 GTACTGTGTCCAGAATTGGTGGG - Intergenic
968801498 4:2746078-2746100 TTCCTGTGTCCAGAATCACCTGG - Intronic
972627167 4:40810951-40810973 TTCCATTGTCCAGAAGTAGCTGG + Intronic
980563168 4:134502909-134502931 ATGCTGTGTCCAGAATTGGCGGG - Intergenic
984522266 4:180816393-180816415 AACTGGTGTCCAGAGTTAGCAGG + Intergenic
987099360 5:14578643-14578665 ATACTGTGTCCAGAATTGGCGGG - Intergenic
988048728 5:25995130-25995152 TCTCGGTGTCCAGCATTAGCTGG - Intergenic
988330732 5:29836681-29836703 GTCTGGTTTCCAGAATTATGGGG + Intergenic
988605103 5:32672567-32672589 GTCCTGTGTCCAGAATTGGTGGG + Intergenic
993678416 5:90846449-90846471 GTCCTGTGTCCGGAATTGGTGGG + Intronic
995529294 5:113076132-113076154 GTCCTGTGTCCAGTATTGGTGGG - Intronic
996292040 5:121862938-121862960 GTCTGTTGTCCAGAATTGCCAGG - Intergenic
1002290506 5:178197186-178197208 GTCCTGTGTCCAGAATCAGTGGG - Intergenic
1002688412 5:181033405-181033427 GTACGGTGTCCAGAATTCGTGGG - Intergenic
1005751150 6:28884286-28884308 GCCTGGTGTCCAGAATTGGTGGG + Intergenic
1009510645 6:64546922-64546944 GTGCTGTGTCCAGAATTGGTGGG + Intronic
1015834079 6:137400405-137400427 GCAAGGTGTTCAGAATTAGCAGG + Intergenic
1020358625 7:7303759-7303781 ATCCGGTGTGCAGAATTCACAGG - Intergenic
1022317685 7:29260757-29260779 GTCCGGTGTCCAGAATTAGCAGG - Intronic
1027751254 7:82149569-82149591 CTCAGGTGGCCAGAATGAGCAGG - Intronic
1032303033 7:130707532-130707554 TTCCATTATCCAGAATTAGCTGG + Intergenic
1036822162 8:11949987-11950009 GACCGGTGCCCAGAATCACCGGG + Intergenic
1039242906 8:35576089-35576111 GTCCTGTGTACATAATTTGCAGG + Intronic
1044919044 8:97148521-97148543 GTCCAGTGGCCAGGATTAGGTGG - Intronic
1050657043 9:7840298-7840320 GGGCGGTGTCTAGAGTTAGCAGG + Intronic
1061745165 9:132734146-132734168 GTCTGGTGTTGAGAATTATCTGG + Intronic
1061845418 9:133385421-133385443 GTCCTGTCTCCAGCATGAGCTGG - Intronic
1199284941 X:146045319-146045341 GTCATGTGTCCAGAATTGGTGGG + Intergenic
1199534932 X:148891684-148891706 GTCTGGTGTCCACAGGTAGCGGG + Intronic
1200973961 Y:9187785-9187807 CTCCTGTGTCCAGAATTGGTGGG - Intergenic
1202136918 Y:21675840-21675862 CTCCTGTGTCCAGAATTGGTGGG + Intergenic
1202342651 Y:23886129-23886151 GTACTGTGTCCAGAATTCGGGGG + Intergenic
1202528118 Y:25783956-25783978 GTACTGTGTCCAGAATTCGGGGG - Intergenic