ID: 1022317687

View in Genome Browser
Species Human (GRCh38)
Location 7:29260773-29260795
Sequence ACCGGACCTGTTTTATGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 38}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022317683_1022317687 -3 Left 1022317683 7:29260753-29260775 CCAGCCTGCTAATTCTGGACACC 0: 1
1: 0
2: 0
3: 7
4: 122
Right 1022317687 7:29260773-29260795 ACCGGACCTGTTTTATGAGGTGG 0: 1
1: 0
2: 0
3: 2
4: 38
1022317685_1022317687 -7 Left 1022317685 7:29260757-29260779 CCTGCTAATTCTGGACACCGGAC 0: 1
1: 0
2: 0
3: 8
4: 64
Right 1022317687 7:29260773-29260795 ACCGGACCTGTTTTATGAGGTGG 0: 1
1: 0
2: 0
3: 2
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022317687 Original CRISPR ACCGGACCTGTTTTATGAGG TGG Intronic
908219402 1:61989152-61989174 AAAGGACCTGTTTTAGGAGATGG - Intronic
910316337 1:85888175-85888197 GCAGGACCTTTTTTATGAGCAGG - Intronic
916652805 1:166846614-166846636 ACCGGCCCTATTTGATGAGGTGG + Exonic
916975414 1:170072417-170072439 ACCTGACCTGGATTGTGAGGTGG + Intronic
1063797482 10:9528924-9528946 AGCGCAACAGTTTTATGAGGTGG - Intergenic
1066243955 10:33563827-33563849 ACCTGATCTTTTTTATGAGCTGG - Intergenic
1071724654 10:88185708-88185730 TCAAGACCTGTTCTATGAGGAGG + Intergenic
1076482651 10:130794914-130794936 ACTGCACCTGTTTTATGGGGAGG + Intergenic
1084296842 11:68217706-68217728 ACGGTACCTGTTTGAAGAGGTGG - Intergenic
1085481369 11:76825401-76825423 ACTGGACCTGTGTTTTCAGGGGG - Intergenic
1086267367 11:85017308-85017330 CCTGGACAAGTTTTATGAGGAGG - Intronic
1108176517 13:47798255-47798277 GCCGGACCTGTTGTAGAAGGTGG - Intergenic
1124374649 15:29122425-29122447 AAGGGACCTGCTTTATCAGGAGG + Exonic
1140201968 16:72902356-72902378 CCCGGACCAGCTTAATGAGGTGG + Intronic
1147533772 17:41304252-41304274 ACCGGACCTGGTTGGTGATGCGG - Intergenic
1155266499 18:24099423-24099445 ACTGGAACTGTATTAGGAGGTGG - Intronic
1156825052 18:41420631-41420653 ACAGGACCTGTGCTATGTGGAGG - Intergenic
1159137434 18:64352620-64352642 ACTGTGCCTATTTTATGAGGTGG + Intergenic
1164739092 19:30563702-30563724 ACAGGAGCTGTTGTGTGAGGTGG + Intronic
1167849050 19:52188262-52188284 ACCCGGCCTTTTTTTTGAGGCGG - Intergenic
1168414983 19:56161934-56161956 ACCAGTCCTGTCTTAGGAGGTGG - Intergenic
940952622 2:159693310-159693332 ACTGGTGCTTTTTTATGAGGTGG + Intergenic
1177371802 21:20214043-20214065 AGCAGACCTGTTGTATGATGTGG - Intergenic
957300485 3:78386882-78386904 ACCAGATCTGCTTTATAAGGTGG - Intergenic
962473255 3:135732180-135732202 ACCAGCCCTGTTTGCTGAGGAGG + Intergenic
977313386 4:95414219-95414241 ACCAGACCTATTTTTTGTGGGGG - Intronic
978957788 4:114635683-114635705 AATGGATCTTTTTTATGAGGGGG - Intronic
982577243 4:157129245-157129267 AACAGACCTCTTTTATGAGTGGG - Intronic
995807461 5:116069425-116069447 ACCAGGCCAGTTTTATGAGCTGG + Intergenic
1022317687 7:29260773-29260795 ACCGGACCTGTTTTATGAGGTGG + Intronic
1024512942 7:50217300-50217322 CCTGGACCTGTGATATGAGGAGG + Intergenic
1029305422 7:99616456-99616478 ATCGGAGCTGTTTTTTGTGGGGG - Intergenic
1033070075 7:138194011-138194033 ACAGGAACTGTTTTACCAGGTGG + Intergenic
1033737520 7:144237944-144237966 ATAGTACCTATTTTATGAGGTGG + Intergenic
1033745535 7:144313013-144313035 ATAGTACCTATTTTATGAGGTGG - Intergenic
1033762991 7:144456898-144456920 ACCTGATCTGTTTTATCAGCAGG - Intronic
1041201354 8:55453846-55453868 CACGGACCTGTTTGATGAGCTGG - Intronic
1053174387 9:35911697-35911719 CCAGGACCTGTTTGTTGAGGGGG + Intergenic
1056548917 9:87635530-87635552 AATGGACCAGTTTTAGGAGGAGG + Intronic
1186108382 X:6229340-6229362 ACAGGACCTGTTTTATGCTCAGG + Intergenic
1189942287 X:46137209-46137231 GTAGGACCTGTTTGATGAGGTGG + Intergenic