ID: 1022319677

View in Genome Browser
Species Human (GRCh38)
Location 7:29277020-29277042
Sequence GTGGGTTACCACATGTTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 184}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022319671_1022319677 23 Left 1022319671 7:29276974-29276996 CCCTGGCTCAGCTGATGAAGGTT 0: 1
1: 0
2: 0
3: 16
4: 146
Right 1022319677 7:29277020-29277042 GTGGGTTACCACATGTTGCCAGG 0: 1
1: 0
2: 0
3: 15
4: 184
1022319670_1022319677 24 Left 1022319670 7:29276973-29276995 CCCCTGGCTCAGCTGATGAAGGT 0: 1
1: 0
2: 0
3: 21
4: 178
Right 1022319677 7:29277020-29277042 GTGGGTTACCACATGTTGCCAGG 0: 1
1: 0
2: 0
3: 15
4: 184
1022319668_1022319677 29 Left 1022319668 7:29276968-29276990 CCATGCCCCTGGCTCAGCTGATG 0: 1
1: 1
2: 4
3: 35
4: 360
Right 1022319677 7:29277020-29277042 GTGGGTTACCACATGTTGCCAGG 0: 1
1: 0
2: 0
3: 15
4: 184
1022319676_1022319677 -8 Left 1022319676 7:29277005-29277027 CCATTTCTTGATTTAGTGGGTTA 0: 1
1: 0
2: 1
3: 19
4: 267
Right 1022319677 7:29277020-29277042 GTGGGTTACCACATGTTGCCAGG 0: 1
1: 0
2: 0
3: 15
4: 184
1022319672_1022319677 22 Left 1022319672 7:29276975-29276997 CCTGGCTCAGCTGATGAAGGTTG 0: 1
1: 0
2: 1
3: 15
4: 150
Right 1022319677 7:29277020-29277042 GTGGGTTACCACATGTTGCCAGG 0: 1
1: 0
2: 0
3: 15
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022319677 Original CRISPR GTGGGTTACCACATGTTGCC AGG Intronic
900019223 1:176003-176025 TGGGGTTACAACATGTTGCCCGG - Intergenic
900049480 1:534590-534612 TGGGGTTACAACATGTTGCCTGG - Intergenic
900605543 1:3522034-3522056 GAGGGTCACCACCTGTTCCCAGG + Intronic
900851019 1:5143123-5143145 GTGGGGTGCAACCTGTTGCCAGG - Intergenic
902031123 1:13423075-13423097 CAGGGTTTCCCCATGTTGCCAGG - Intergenic
902604865 1:17563423-17563445 TGGGGTTTCCCCATGTTGCCCGG + Intronic
902903447 1:19536284-19536306 TGGGGTTTCCCCATGTTGCCCGG - Intergenic
903397489 1:23013053-23013075 TGGGGTTTCCTCATGTTGCCTGG + Intronic
903692932 1:25186886-25186908 ATGGGTTTCGCCATGTTGCCAGG - Intergenic
903937000 1:26902600-26902622 GTGAGTTACCACACCCTGCCAGG - Intronic
904596341 1:31648413-31648435 TTGGGTTCCCACCTCTTGCCAGG + Intergenic
905506088 1:38480839-38480861 GGGGGTTTCACCATGTTGCCTGG + Intergenic
907446353 1:54510433-54510455 CAGGGTTTCCCCATGTTGCCTGG - Intergenic
908460352 1:64342828-64342850 GTGGGTTATGACCTGGTGCCAGG + Intergenic
909442091 1:75708218-75708240 TGGGGTTTCCCCATGTTGCCAGG - Intergenic
909977025 1:82057533-82057555 CTGGGTTAGCACACCTTGCCTGG + Intergenic
910212680 1:84809668-84809690 GTGGGTTTCTCCATGTGGCCAGG + Intergenic
912035027 1:105301687-105301709 GTGTGTTTCGAAATGTTGCCTGG + Intergenic
914352142 1:146849695-146849717 CTGGGTTACCACTTGGTGCATGG - Intergenic
915996882 1:160572668-160572690 GTGGGTTACCACTTCTTCACTGG - Intronic
920977918 1:210803291-210803313 TGGGGTTTCCCCATGTTGCCAGG + Intronic
921243537 1:213212240-213212262 AGTGGTTACCACATGTTGGCAGG - Intronic
923170922 1:231416279-231416301 GTGAGTTACCACATCTGGCCCGG + Intronic
923265931 1:232314253-232314275 GTGGGTTGCCACAGCTGGCCAGG + Intergenic
1063771075 10:9201547-9201569 GGGGGTTTCACCATGTTGCCAGG - Intergenic
1063816172 10:9775925-9775947 CTGGGTTTCATCATGTTGCCAGG - Intergenic
1064889523 10:20154371-20154393 CAGGGTTACACCATGTTGCCAGG - Intronic
1066338557 10:34505848-34505870 GTGAGCTACCACATGCAGCCTGG - Intronic
1066671818 10:37848390-37848412 CGGGGTTTCCCCATGTTGCCAGG - Intronic
1067000634 10:42609223-42609245 GGGGGTTTCACCATGTTGCCTGG - Intronic
1067139867 10:43648345-43648367 GTGGTTTCCCACACGCTGCCTGG + Intronic
1071494040 10:86155606-86155628 GTGGGTTAGCACAGGTTCCTGGG + Intronic
1076975826 11:171194-171216 TGGGGTTACAACATGTTGCCCGG - Intronic
1078314733 11:10284849-10284871 GTGGGTTATCACTTGTGCCCAGG - Intronic
1079012240 11:16838363-16838385 GTGGGCCACCACATCATGCCTGG - Intronic
1079892841 11:26079679-26079701 CGGGGTTTCAACATGTTGCCCGG - Intergenic
1085169109 11:74433229-74433251 GGGGGTTTACCCATGTTGCCCGG - Intergenic
1088620739 11:111680375-111680397 GTGGGTTAGGACCTCTTGCCAGG + Intronic
1088988966 11:114935056-114935078 GTGTCTTACCTCAAGTTGCCTGG + Intergenic
1089167789 11:116490576-116490598 TGGGGTTTCGACATGTTGCCAGG + Intergenic
1092208984 12:6634195-6634217 GGGGGTTTCACCATGTTGCCTGG + Intronic
1095090836 12:38102915-38102937 GGGGGTTTCACCATGTTGCCCGG - Intergenic
1096068910 12:48763362-48763384 TGGGGTTTCAACATGTTGCCTGG + Intergenic
1098363959 12:69682765-69682787 CTGGGTTTCACCATGTTGCCAGG + Intronic
1101235920 12:102789942-102789964 GAGGGTTTCACCATGTTGCCAGG + Intergenic
1105489054 13:20869911-20869933 CTGGGTTTCACCATGTTGCCTGG - Intronic
1106361560 13:29035951-29035973 TGGGGTTTCCACATGTTGCCAGG - Intronic
1106480099 13:30130936-30130958 ATGGGTTTCACCATGTTGCCCGG - Intergenic
1106481890 13:30143130-30143152 GGGGGTGTCCACATGTGGCCTGG + Intergenic
1110642134 13:77837677-77837699 CTGGGTTTCACCATGTTGCCAGG + Intergenic
1113732024 13:112648379-112648401 GAGGGTTACCACATGGAGCCTGG + Intronic
1113903497 13:113808798-113808820 GGGGGTTACTCCATGTTTCCTGG + Intronic
1115238899 14:31235330-31235352 CAGGGTTTCCCCATGTTGCCTGG - Intergenic
1115306747 14:31941576-31941598 CTGGGATACCATATGGTGCCTGG - Intergenic
1117749994 14:58911317-58911339 ATGGGTTTCACCATGTTGCCCGG + Intergenic
1119493604 14:75059305-75059327 CTGGGTTTCCCCATGTTGCCTGG - Intronic
1122091268 14:99342529-99342551 TGGGGTTTCAACATGTTGCCCGG + Intergenic
1122759783 14:104014469-104014491 CTGGGTTTCGCCATGTTGCCCGG + Intronic
1124034266 15:26039521-26039543 CAGGGTTTCCCCATGTTGCCTGG + Intergenic
1124107749 15:26756375-26756397 GGGGGTTTCACCATGTTGCCTGG - Intronic
1125928833 15:43585218-43585240 CTGGGTTTTGACATGTTGCCTGG - Intronic
1125941999 15:43685053-43685075 CTGGGTTTTGACATGTTGCCTGG - Intergenic
1126150417 15:45518754-45518776 GGGGGTTTCATCATGTTGCCAGG + Intronic
1126999204 15:54482094-54482116 GTGCTTTACCACATGTTCCCTGG + Intronic
1130701805 15:86191150-86191172 GGGGGTTTCACCATGTTGCCAGG - Intronic
1132093447 15:98964612-98964634 GTGTGTTCACGCATGTTGCCTGG + Intergenic
1132276439 15:100568930-100568952 GGGGGTTTCACCATGTTGCCAGG - Exonic
1132418642 15:101644296-101644318 GTGTGTCTCCAGATGTTGCCAGG - Intronic
1133432581 16:5751031-5751053 GTGGGTTTCACCATGTTGACTGG + Intergenic
1134621807 16:15694978-15695000 GGGGGTTTCACCATGTTGCCCGG - Intronic
1135386981 16:22051194-22051216 TGGGGTTTCAACATGTTGCCAGG - Intronic
1135565945 16:23510955-23510977 CTGGGTTTCACCATGTTGCCCGG + Intronic
1135565958 16:23511057-23511079 CTGGGTTTCACCATGTTGCCCGG + Intronic
1135795431 16:25436736-25436758 CTGGGTTTCACCATGTTGCCAGG - Intergenic
1138430800 16:56967462-56967484 GGGGGTTTCACCATGTTGCCAGG - Intronic
1138841584 16:60515265-60515287 TCGGTTTATCACATGTTGCCTGG - Intergenic
1138900227 16:61260103-61260125 CTGGATTACCATATGTTTCCGGG - Intergenic
1139419840 16:66843551-66843573 GGGGGTTTCACCATGTTGCCTGG - Intronic
1139981888 16:70865837-70865859 CTGGGTTACCACTTGGTGCATGG + Intronic
1140397946 16:74645541-74645563 GTGGGTTTCACCATGTTGGCCGG + Intronic
1141546090 16:84770209-84770231 GTGTGTTACCAGATGAGGCCAGG + Intronic
1142444434 16:90126470-90126492 TGGGGTTACAACATGTTGCCCGG + Intergenic
1142463075 17:109004-109026 TGGGGTTACAACATGTTGCTCGG - Intergenic
1142678346 17:1529662-1529684 CAGGGTTTCCCCATGTTGCCCGG - Intronic
1142691089 17:1606438-1606460 GCGGGTTTCAAAATGTTGCCAGG - Intronic
1144453074 17:15397329-15397351 CGGGGTTTCAACATGTTGCCAGG - Intergenic
1148273153 17:46279684-46279706 TGGGGTTTCCTCATGTTGCCCGG + Intronic
1152450872 17:80378981-80379003 CGGGGTTTCAACATGTTGCCCGG - Intronic
1154113613 18:11591892-11591914 CGGGGTTACACCATGTTGCCAGG + Intergenic
1159222450 18:65482207-65482229 TGGGGTTTCAACATGTTGCCAGG - Intergenic
1161003796 19:1924537-1924559 GCGGGTGACCACACGTTTCCGGG - Exonic
1161536950 19:4825428-4825450 CTGGGTCTCCCCATGTTGCCTGG + Intronic
1161696268 19:5770235-5770257 GTGGGTTTCATCATGTTGGCTGG - Intronic
1162430755 19:10626702-10626724 GTGAGTTACCACACCTGGCCTGG + Intronic
1162674955 19:12292135-12292157 TGGGGTTTCCTCATGTTGCCAGG - Intronic
1162839857 19:13348510-13348532 CTGGGTTTCAACATGTTGGCCGG - Intronic
1163151969 19:15420922-15420944 GGGGGTTTCACCATGTTGCCCGG - Exonic
1163745421 19:19043697-19043719 GTGAGGTGCCACATGCTGCCTGG - Intronic
1164982726 19:32626454-32626476 GTGAGCTACCACATCTGGCCAGG + Intronic
1167902935 19:52635670-52635692 GAGGGTTTCAACATGTTGGCAGG - Exonic
1168038072 19:53736255-53736277 TGGGGTTACACCATGTTGCCGGG + Intergenic
1168039315 19:53745486-53745508 TGGGGTTACACCATGTTGCCGGG + Intergenic
1168041229 19:53760552-53760574 TGGGGTTACACCATGTTGCCGGG + Intergenic
930079937 2:47437865-47437887 GGGGGTTTCATCATGTTGCCAGG + Intronic
930645759 2:53905218-53905240 GGGGGTTTCACCATGTTGCCAGG + Intronic
933652342 2:84859599-84859621 GTGCGTTACCTCAAGTTGCAGGG - Intronic
935233463 2:101118815-101118837 TGGGGTTTCAACATGTTGCCCGG - Intronic
936067527 2:109343662-109343684 GTGGGTTACCACCTGTGGAGAGG + Intronic
938248392 2:129796211-129796233 GTGGGTGTCCCCATGTTGCGTGG - Intergenic
940115208 2:150201075-150201097 GGGGGTTTCACCATGTTGCCCGG - Intergenic
940568673 2:155402888-155402910 GTGAATTACCAAATGTGGCCTGG + Intergenic
941101402 2:161299596-161299618 GAGGGTTTCATCATGTTGCCTGG + Intergenic
942349902 2:175040912-175040934 ATGGGTTTCTCCATGTTGCCCGG - Intergenic
945456690 2:210058892-210058914 GGGAGATACCACATGTTGGCAGG - Intronic
1169233142 20:3906231-3906253 CAGGGTTTCCCCATGTTGCCAGG - Intronic
1172380990 20:34491377-34491399 ATGGGTTACCAGAAGTTGCAGGG + Intronic
1174855167 20:54037788-54037810 TTTGGTTACCACATGTTGTTGGG - Intronic
1175053615 20:56177839-56177861 CAGGGCTTCCACATGTTGCCAGG - Intergenic
1177091645 21:16776791-16776813 CTGGGTGAACACAAGTTGCCTGG - Intergenic
1178365967 21:31989011-31989033 GGGGGTTTCAACATGTTGCCCGG + Intronic
1182956168 22:34428705-34428727 GCGGGATCCCACATGTTGCAAGG - Intergenic
1183178822 22:36244860-36244882 GTGGGTCTCCACATGCTGTCCGG + Intergenic
1183942706 22:41305019-41305041 CTGGGTTTCACCATGTTGCCAGG - Intronic
1184235669 22:43181854-43181876 GTGGGTGACCACGTGATGCAGGG + Intronic
1184451343 22:44584502-44584524 GTGGGCTGCCACTTGGTGCCAGG - Intergenic
1184698581 22:46153357-46153379 GTGGGTTTCACCATGTTGGCTGG + Intronic
951961095 3:28321590-28321612 GTGGGTTACCACATATTAACAGG - Exonic
956102825 3:65786496-65786518 CAGGGTTTCCCCATGTTGCCTGG + Intronic
956761868 3:72450894-72450916 GAGGGTTTCACCATGTTGCCCGG + Intergenic
957299348 3:78371134-78371156 CTGGGTTTCGCCATGTTGCCAGG - Intergenic
959626955 3:108463522-108463544 TTTGGTTTCCACATGTTGCTCGG + Intronic
960989914 3:123303630-123303652 TGGGGTTTCCCCATGTTGCCAGG - Intronic
962620804 3:137176392-137176414 TTGTGTTACTACATGTTTCCGGG + Intergenic
962763501 3:138540302-138540324 GTGGGTTTCACCATGTTGGCCGG - Intronic
964868478 3:161287876-161287898 CTGGGTTTCACCATGTTGCCCGG - Intergenic
965746188 3:171928701-171928723 CTGGGTCACCCTATGTTGCCCGG - Intronic
968365053 3:198178591-198178613 TGGGGTTACAACATGTTGCCCGG + Intergenic
968926162 4:3549538-3549560 GGGGGCTCCCACATGTTCCCAGG - Intergenic
971136166 4:23871115-23871137 GGAGGTTACAAAATGTTGCCTGG - Intronic
971528845 4:27659084-27659106 TGGGGTTTCTACATGTTGCCAGG + Intergenic
974293851 4:59968920-59968942 CAGGGTTTCCCCATGTTGCCCGG + Intergenic
975121894 4:70737862-70737884 CAGGGTTACACCATGTTGCCAGG + Intronic
975467990 4:74732007-74732029 GTGAGCCACCACATGTGGCCAGG - Intergenic
976238024 4:82921531-82921553 CGGGGTTTCCTCATGTTGCCAGG - Intronic
977639137 4:99335210-99335232 ATGGGATACCACCTGTTGCTGGG - Intergenic
982495836 4:156091072-156091094 GTGGGTTTCACCATGTTGGCTGG - Intergenic
982570096 4:157038474-157038496 ATGGGTTTCGCCATGTTGCCTGG - Intergenic
984758376 4:183343872-183343894 CCGGGGAACCACATGTTGCCTGG - Intergenic
988572072 5:32377473-32377495 GAAAGTTACCACATTTTGCCGGG - Intronic
988957327 5:36332582-36332604 CTGGGTCACCAAATGTTACCAGG + Intergenic
989594962 5:43147861-43147883 GTGGGTTTCACCATGTTGCCAGG - Intronic
994181196 5:96768273-96768295 GGGGGTTTCGCCATGTTGCCAGG + Intronic
997308417 5:132857929-132857951 ATGGGTTTCACCATGTTGCCAGG - Intergenic
997700051 5:135891040-135891062 GTGGTTTACCACCTGTGGCATGG - Intergenic
998473508 5:142401576-142401598 GGGGGTTTCGCCATGTTGCCTGG - Intergenic
1002626580 5:180533860-180533882 GTGGGTCACCACCTGGGGCCTGG + Intronic
1002635137 5:180603519-180603541 CGGGGTTTCCCCATGTTGCCTGG - Intronic
1003546251 6:7061509-7061531 GTGGGTTTCCCTATGTTGGCCGG + Intergenic
1006778822 6:36617939-36617961 GAGGGTTTTGACATGTTGCCCGG + Intergenic
1006791878 6:36706923-36706945 GCGGGTTTCTCCATGTTGCCCGG + Intronic
1008121960 6:47628872-47628894 CTGGGTTTCACCATGTTGCCTGG + Intergenic
1012467669 6:99533358-99533380 CTGGGTTTCACCATGTTGCCCGG - Intergenic
1012613009 6:101239049-101239071 ATAGTTTACCAAATGTTGCCAGG + Intergenic
1013428493 6:110035624-110035646 CTTGGTTACCACCTGTTCCCTGG + Intergenic
1017328487 6:153168589-153168611 GTGGTTTTCCATGTGTTGCCTGG + Intergenic
1019251138 7:12300-12322 TGGGGTTACAACATGTTGCCTGG - Intergenic
1020650061 7:10863703-10863725 CTGGGTTTCACCATGTTGCCAGG + Intergenic
1021994173 7:26163627-26163649 GTGAGCTACCACACGTGGCCAGG + Intronic
1022319677 7:29277020-29277042 GTGGGTTACCACATGTTGCCAGG + Intronic
1022686972 7:32606190-32606212 GTGAGCTACCACAAGTAGCCTGG + Intergenic
1026526197 7:71155462-71155484 GAGGGTTTCGCCATGTTGCCCGG + Intronic
1026611199 7:71861491-71861513 GTGAGCCACCACATCTTGCCTGG - Intronic
1026642764 7:72141407-72141429 CTGGGTTTCACCATGTTGCCAGG - Intronic
1028483772 7:91336284-91336306 GAGGGTTACCAGATGTTGTGTGG - Intergenic
1029591363 7:101509252-101509274 GTGGGTTTCATCATGTTGGCCGG - Intronic
1030291526 7:107877797-107877819 CTGGGTTTCACCATGTTGCCCGG - Intergenic
1033284310 7:140027199-140027221 GCTGGTTGCCACATGTGGCCCGG - Intronic
1035816619 8:2548176-2548198 GGGGGTTTCGCCATGTTGCCCGG - Intergenic
1036947658 8:13109691-13109713 CTGGGTTTCACCATGTTGCCAGG - Intronic
1037461803 8:19118069-19118091 GGGGGTTTCGCCATGTTGCCAGG + Intergenic
1041127824 8:54662893-54662915 GTGGGTTACTCCATATTACCTGG + Intergenic
1041598049 8:59680627-59680649 CTGGGTTTCACCATGTTGCCAGG - Intergenic
1041921632 8:63188515-63188537 GAGGGTTTCACCATGTTGCCCGG + Intronic
1042861367 8:73317481-73317503 GTGGGGTACTACATGATGACTGG + Intronic
1045290379 8:100827705-100827727 GCAGGTTACCACATGCAGCCAGG - Intergenic
1045632867 8:104146884-104146906 ATGGGGTCTCACATGTTGCCAGG + Intronic
1046910162 8:119617755-119617777 GGGGGTTTCACCATGTTGCCAGG - Intronic
1052754844 9:32530082-32530104 CTGGGTTTCACCATGTTGCCTGG + Intergenic
1054144109 9:61549893-61549915 GGGGGCTCCCACATGTTCCCAGG + Intergenic
1054648993 9:67611515-67611537 GGGGGCTCCCACATGTTCCCAGG + Intergenic
1055350289 9:75379547-75379569 ATGGGTTTCACCATGTTGCCAGG + Intergenic
1056717947 9:89048759-89048781 GTGGGTTCTCTCATGTTCCCAGG + Intronic
1060292834 9:122320063-122320085 TGGGGTTTCCCCATGTTGCCAGG + Intronic
1061867769 9:133503304-133503326 GGGGGTCTCCATATGTTGCCAGG + Intergenic
1062749422 9:138241470-138241492 TGGGGTTACAACATGTTGCCCGG + Intergenic
1189833172 X:44995657-44995679 CTGAGTTTCCCCATGTTGCCAGG + Intronic
1190456497 X:50633194-50633216 CTGGGTTTCCAAGTGTTGCCAGG + Exonic
1191143788 X:57143666-57143688 GGGGGTTTCTCCATGTTGCCTGG + Intergenic
1197283308 X:124563840-124563862 ATGGTTTACCATCTGTTGCCTGG + Intronic
1200290995 X:154873508-154873530 GTGGGCCACCACATGCAGCCTGG + Intronic