ID: 1022322116

View in Genome Browser
Species Human (GRCh38)
Location 7:29297379-29297401
Sequence CATCTTAGCCTCCTGCTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 166}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022322110_1022322116 30 Left 1022322110 7:29297326-29297348 CCGCTCTGAAGAAGTCCATCTGA 0: 1
1: 0
2: 9
3: 100
4: 242
Right 1022322116 7:29297379-29297401 CATCTTAGCCTCCTGCTGACAGG 0: 1
1: 0
2: 1
3: 7
4: 166
1022322111_1022322116 15 Left 1022322111 7:29297341-29297363 CCATCTGACTGCAGTTAGAAAGG 0: 1
1: 1
2: 7
3: 432
4: 15733
Right 1022322116 7:29297379-29297401 CATCTTAGCCTCCTGCTGACAGG 0: 1
1: 0
2: 1
3: 7
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022322116 Original CRISPR CATCTTAGCCTCCTGCTGAC AGG Intronic
902519701 1:17009204-17009226 CATCTGAGCCTGATGCTGAGGGG - Intronic
903760293 1:25693062-25693084 CTTATTAGCCTACTGTTGACTGG + Intronic
909404142 1:75267662-75267684 CATCTCAGCCTCCTGATAGCTGG + Intronic
915718100 1:157963357-157963379 CATATTAGCCACCTGCCTACAGG + Intergenic
916187281 1:162145588-162145610 CAGCTGAGCGTCCTGCTGAGCGG - Intronic
918671545 1:187223766-187223788 CAGGTCAGCCACCTGCTGACTGG - Intergenic
919025100 1:192157969-192157991 CACCTTAGCCTCCAGATTACAGG + Intergenic
921873002 1:220161447-220161469 CAGCCTAGCCTCCAGCTGAGTGG - Intronic
924741456 1:246796472-246796494 CATCCCAGCCACCTGGTGACAGG - Intergenic
1065794176 10:29291138-29291160 CTCCATAGCCTACTGCTGACTGG + Intronic
1066372108 10:34825916-34825938 CATCTCAGCCTCCTGAGTACTGG - Intergenic
1070567744 10:77616465-77616487 CACATTATCCTCCTGCTGCCTGG - Intronic
1070693998 10:78548358-78548380 CATCTAAGCCTCATGAAGACAGG + Intergenic
1072340793 10:94446636-94446658 CGTCTTAGCCTCCTGAGTACAGG + Intronic
1075531924 10:123236943-123236965 CATCTCAGCCTCCTTCTCTCAGG + Intergenic
1075810571 10:125222006-125222028 CCCCTTTGCCTCCTGCTCACAGG + Intergenic
1076545670 10:131244464-131244486 AATCTTAGCCAGCTGCTGAGAGG - Intronic
1077913211 11:6592472-6592494 TACCTTAGCCTCCTGATTACAGG + Intronic
1084552812 11:69857790-69857812 CATCTCAGCCTCCTGACTACAGG + Intergenic
1087278411 11:96183510-96183532 CACCTCAGCCTCCTGATAACTGG + Intronic
1087564174 11:99833122-99833144 CATCTGAGACTCCTGCAGCCAGG - Intronic
1090796896 11:130143004-130143026 CTTGCTAGCCTACTGCTGACTGG + Intronic
1090802039 11:130179069-130179091 CAGCTTCTCCTCCTGGTGACAGG + Intronic
1092184149 12:6466321-6466343 CAGCTCAGCCACCTGCTGAAGGG - Exonic
1092923179 12:13250552-13250574 TATCCTGGCCTCCAGCTGACTGG + Intergenic
1092987855 12:13864252-13864274 CATCTCTGCCTGCTGCCGACAGG + Intronic
1093226285 12:16487759-16487781 CACCTCAGCCTCCTGGTAACTGG + Intronic
1093916242 12:24805432-24805454 CATGTTAGCTTCTTGCTGTCTGG - Intergenic
1094713077 12:32985095-32985117 CATTTTTGCCTCCTTCTTACTGG + Intergenic
1096813471 12:54186454-54186476 CACCTTAGCCTCCTGGGTACTGG + Intronic
1098442207 12:70530992-70531014 CATCATTGCCTCCTGCAGGCAGG - Intronic
1098630452 12:72715504-72715526 CATCTGAGCCTCATTCAGACAGG - Intergenic
1099727632 12:86453652-86453674 CATGTTTGCCTCTTGTTGACAGG + Intronic
1099979527 12:89582606-89582628 CATCTCAGCCTCCTGAAGTCTGG - Intergenic
1100927467 12:99565891-99565913 TATCTTGGCTTCCTGCTGAGAGG + Intronic
1101066179 12:101023555-101023577 CATCTCAGCCTCCTGATGGCTGG - Intronic
1101865726 12:108518116-108518138 CTTCCTAGCCTCCTGCTTTCTGG - Intronic
1104580348 12:130006876-130006898 CATCTTAGCCTCCTGAAGAAGGG - Intergenic
1104982162 12:132578057-132578079 AAACTTAGCCTACTGTTGACAGG + Intronic
1105504712 13:20999580-20999602 CATCTCAGCCTCCTGTAGTCAGG + Intronic
1105612604 13:21982278-21982300 CTTCTGTGCCTCCTGCTCACTGG + Intergenic
1105847706 13:24307925-24307947 GATCCTGGCCTCCTGCTTACAGG - Intronic
1113556447 13:111239463-111239485 AACCTGAGCCTCCTGGTGACAGG + Intronic
1120226351 14:81795140-81795162 TTTCTGAGCCTGCTGCTGACTGG + Intergenic
1124444237 15:29714915-29714937 CACCTGAGCCTTCTTCTGACAGG + Intronic
1126221995 15:46224762-46224784 CATCTTAGCCTTCTGTTCTCTGG + Intergenic
1126336055 15:47587330-47587352 CATCTTACATTTCTGCTGACTGG + Intronic
1126357917 15:47815689-47815711 GCTCCTATCCTCCTGCTGACAGG + Intergenic
1127006571 15:54577447-54577469 CAGCTCAGCCTCCTGCGGAGTGG - Intronic
1127699264 15:61481237-61481259 CCTCTCAGCCTCCAGCTGGCGGG - Intergenic
1127821826 15:62665136-62665158 CATCTTAGCCTCCACCTCTCTGG + Intronic
1128229227 15:66023379-66023401 CAGCTGGGCCTCCTGCAGACTGG - Intronic
1128717105 15:69916766-69916788 CATTTTTGCTTCCTCCTGACTGG - Intergenic
1129268257 15:74406224-74406246 AATTTTAGCCTTCTGCTTACTGG - Intergenic
1129686689 15:77690124-77690146 AATCTTAGGATCCTGCTGACAGG - Intronic
1132145364 15:99426103-99426125 CACCGTAGCCTCCTGCTGGCTGG - Intergenic
1132558219 16:582049-582071 CATCAAAGCCTCCTGCAGCCAGG - Intronic
1132783926 16:1643926-1643948 AATCTTGCCATCCTGCTGACAGG - Intronic
1133038134 16:3046151-3046173 CTTCCCAGCCTCCTGCTGCCCGG + Intergenic
1135263057 16:20997891-20997913 CATCTTAGCCTCCTGAGTATGGG - Intronic
1136164394 16:28443281-28443303 CATCTCAGCCTCCAGATAACTGG - Intergenic
1136198572 16:28671699-28671721 CATCTCAGCCTCCAGATAACTGG + Intergenic
1136214918 16:28785875-28785897 CATCTCAGCCTCCAGATAACTGG + Intergenic
1136259641 16:29065720-29065742 CATCTCAGCCTCCAGATAACTGG + Intergenic
1138453517 16:57107450-57107472 CACCCTGGCCTCCTGCAGACCGG + Intronic
1140216162 16:73010594-73010616 CATCTCAGCCTCCTCCTCTCAGG + Intronic
1140910891 16:79451308-79451330 CCTATTAGCCTCCTGTGGACAGG - Intergenic
1141350812 16:83293965-83293987 AATCTTCTCCTCCTGCTCACAGG - Intronic
1142417672 16:89951731-89951753 CATCCCTGCCTCCTGCTGCCTGG - Intronic
1146376612 17:32298818-32298840 CATCTGGGCCTCCAGCTGAGTGG + Intronic
1146645415 17:34573896-34573918 CATGTCAGCCTCATCCTGACTGG - Intergenic
1147790338 17:43010277-43010299 CATCTCAGCCTCCTGAGTACAGG - Intronic
1147860238 17:43516561-43516583 CATCTGAGCCTCCTGAATACTGG + Intronic
1148188983 17:45665767-45665789 CATCTTTCTCTCCTCCTGACAGG + Intergenic
1150788179 17:68179659-68179681 CATCTCCGCCTCCTGGTGAGAGG + Intergenic
1157031503 18:43915071-43915093 CCTCTTAGCATCTTGCTGTCTGG - Intergenic
1158704911 18:59783608-59783630 CTTTTTAGCCTCCTCCCGACCGG - Intergenic
1161769342 19:6222898-6222920 AATCTTAGCCTGCAGCTGCCGGG - Intronic
1162686753 19:12393095-12393117 CATCTTAGCCTACTATTGATGGG - Intronic
1162691105 19:12432869-12432891 CATCTTAGCCTACTATTGATGGG - Intronic
1163791664 19:19309993-19310015 CACCTCAGACTCCTGCTCACCGG - Intronic
1164485012 19:28648298-28648320 CAGCTTTGCCTTCTACTGACAGG - Intergenic
1165241627 19:34473177-34473199 CATCTAGACCTCCAGCTGACAGG + Intergenic
1165916264 19:39262736-39262758 CATCATAGCCTCCTGCTTTTTGG + Intergenic
1167277979 19:48550345-48550367 CAGCTCAGCCTCCTGGAGACGGG + Intergenic
1168408809 19:56125620-56125642 CATTTTCTCCTCCTGCAGACTGG - Intergenic
925811971 2:7709940-7709962 AACCTTAGCCTCCTGCTGAATGG - Intergenic
927062697 2:19439436-19439458 CATGTAAGCCTGCTGCTGTCTGG + Intergenic
928903814 2:36350283-36350305 CACCTTAGCCTCCTGAATACAGG + Intergenic
932213667 2:69952389-69952411 CATCTCAGCCTCCTGGTAGCTGG - Intergenic
937517437 2:122671158-122671180 CATTTTAGCAACCTGCTCACAGG - Intergenic
939715709 2:145581028-145581050 AATAATAGCCTCCTGTTGACTGG + Intergenic
945204300 2:207315268-207315290 CATCTTATCCTCCTGGGGAGAGG + Intergenic
946054428 2:216888425-216888447 CCTCTTAGCCTCCCCTTGACTGG + Intergenic
947507059 2:230715814-230715836 CACCTCAGCCTCCTGTAGACGGG + Intronic
1169066859 20:2698598-2698620 CTTCTTAGCCCCATCCTGACAGG - Intronic
1169706653 20:8513911-8513933 CACCTTAGCCTCCTGGTAGCTGG - Intronic
1170454831 20:16522130-16522152 CAGCTTAGCATCATGATGACAGG + Intronic
1172175108 20:32967464-32967486 CATCTTGGGCACCTGCTGCCTGG - Intergenic
1174040275 20:47694457-47694479 CATCTCACCCTCCTGCTCACAGG - Intronic
1174358081 20:50011295-50011317 TGTCTCAGCCTCCTGGTGACTGG - Intergenic
1175887148 20:62298697-62298719 CATCAGAGCCTCCTGCTGCTTGG - Intergenic
1178328038 21:31660916-31660938 CATCTTAGCAACCTGCCTACTGG - Intronic
1179333842 21:40431714-40431736 TATAGTAGCCTACTGCTGACTGG - Intronic
1181980359 22:26761709-26761731 CACCTTAGCCTCCTGATAGCTGG + Intergenic
1183217774 22:36492242-36492264 CATCTGAGCCCCCTGCAGAAGGG - Intronic
1184448693 22:44570041-44570063 CATCTTTGCATGCTGCTGGCCGG + Intergenic
1184857252 22:47153162-47153184 CCTTTTATCCTCCTGCTGCCAGG - Intronic
949430738 3:3972810-3972832 CCTTTTATCCTCCTGCTGTCAGG + Intronic
949449319 3:4167376-4167398 ACTCTTAGACTCCTGCTGAATGG + Intronic
950187372 3:10953459-10953481 CGTGTTAGCCTGCTGCTGCCAGG - Intergenic
950226755 3:11241958-11241980 ACTTTTAGACTCCTGCTGACTGG - Intronic
950713407 3:14830019-14830041 CAGCTAAGCCTCCTGCTGACTGG + Intronic
951166400 3:19488684-19488706 CATCTTAGCCTCCCTGTGTCTGG + Intronic
951886990 3:27534051-27534073 CAGCTTGGCCTCCTGGTGATGGG + Intergenic
952750104 3:36817948-36817970 CAGCTCAGCCTGCAGCTGACAGG + Intergenic
953545940 3:43863616-43863638 GAGCTGAGCCCCCTGCTGACTGG - Intergenic
953790142 3:45941131-45941153 CATCTTAGCCTCTTGAGTACTGG + Intronic
954529318 3:51304525-51304547 TGTCTTAGCCTCCAGCTGAGTGG + Intronic
961813930 3:129538239-129538261 CATCTTTTCTTCCTGCTGGCTGG + Intergenic
965114471 3:164470253-164470275 GAACCTAGCCTCCAGCTGACAGG + Intergenic
965774061 3:172209899-172209921 CATGTCAGCCCCCTGCTGCCTGG - Intronic
966379198 3:179326210-179326232 AATCCCAGCCTCCTGCTGGCGGG + Intronic
968236518 3:197033929-197033951 CATGTTACACTCTTGCTGACTGG + Intergenic
968236543 3:197034166-197034188 GATGTTACTCTCCTGCTGACGGG + Intergenic
968236570 3:197034406-197034428 GATGTTACTCTCCTGCTGACGGG + Intergenic
969831478 4:9801157-9801179 CCTCTTTCCCTCCAGCTGACAGG + Intronic
971372053 4:26027734-26027756 CATCATAACCTCCAGCTGGCAGG - Intergenic
972379717 4:38508106-38508128 CGTCTCAGCCTGCTGCAGACAGG - Intergenic
973759271 4:54101571-54101593 CGTCAGAGCCTCCTGCGGACCGG - Exonic
978383479 4:108155618-108155640 CATCTTAGACTCCTGCTCTGCGG + Intronic
978954461 4:114598002-114598024 CCTCTCAGGCTCCTGCTGAAAGG - Intergenic
981324058 4:143426475-143426497 CATCTTAGCTTACTGCAGCCTGG - Intronic
993316782 5:86417790-86417812 CATCTTATTCTCATTCTGACAGG + Intergenic
995059915 5:107802689-107802711 GTTCTTAGCCTTCTGCTGATTGG + Intergenic
995064215 5:107841906-107841928 CATCTTACCCTGCTTCTGAAGGG - Intergenic
997772077 5:136564598-136564620 ACTCTTAGACTCCTGCTGATTGG - Intergenic
1002065189 5:176648172-176648194 CACCTTAGGCTCCTGCAGAGTGG + Intronic
1002362623 5:178685232-178685254 TTTCTTAGCCACCTGCTGTCTGG + Intergenic
1003478193 6:6504763-6504785 CATCTGAGCCTCCTCTTGAGAGG - Intergenic
1004110418 6:12712860-12712882 CATCTTACCCTTCTGCCAACTGG - Intergenic
1006089694 6:31620982-31621004 CATTTTGTCCTCCTGCTGCCGGG + Intronic
1006124874 6:31831094-31831116 CACCTTAGCCTCCTGAGTACTGG + Intergenic
1006610884 6:35293729-35293751 CATCTTCCCCTCCTGTTGGCAGG + Exonic
1010703330 6:79077852-79077874 TACCTGAGCCGCCTGCTGACAGG + Exonic
1013122355 6:107151903-107151925 CCTCTCAGCCTGCTGCTGCCTGG - Intergenic
1013532994 6:111037184-111037206 CATGTAAGCCTGCTGCTGAAAGG + Intergenic
1016695621 6:146991610-146991632 CATCTTGGGCTCCTGCTAGCCGG + Intergenic
1018716624 6:166538077-166538099 CATCTTAGGCACCTGCTGGGTGG + Intronic
1018845305 6:167551691-167551713 CTTCTTTGCCTCTTGCTGGCCGG - Intergenic
1022171556 7:27836711-27836733 CACCTCAGCCTCCTGCTTTCTGG - Intronic
1022322116 7:29297379-29297401 CATCTTAGCCTCCTGCTGACAGG + Intronic
1033210656 7:139457702-139457724 CCTCTGGGCCTCCTGGTGACGGG + Intronic
1033543338 7:142376856-142376878 GATCTTTCCCTCCTGCTAACGGG - Intergenic
1034702583 7:153109294-153109316 CATCTTACCCTCCTGGTACCTGG + Intergenic
1034776886 7:153835980-153836002 CAGCTTTACTTCCTGCTGACGGG - Intergenic
1035156508 7:156918569-156918591 AAACTTAGCCTCCTGCTTTCAGG + Intergenic
1038367165 8:26948215-26948237 CATGTTGGCCTCCTGCTGGGAGG + Intergenic
1038561531 8:28585307-28585329 CACCTGAGCCTCCTGATAACTGG + Intergenic
1046546797 8:115662902-115662924 CATTTTAGGCTCTTGCTAACAGG + Intronic
1047769320 8:128017935-128017957 CATCTTACCCTCCTGCGCCCTGG + Intergenic
1048426060 8:134324480-134324502 CATCTTATCTACCTGCTCACTGG + Intergenic
1048572271 8:135666026-135666048 CAGCTGAGGCTCCTGCTGCCTGG + Intergenic
1048638939 8:136331200-136331222 CACCTCAGCCTCCTGCTGGCTGG - Intergenic
1061308427 9:129746273-129746295 CGTCCTGGCCTCCTGCTGCCTGG + Intronic
1061590124 9:131592694-131592716 CATTTCAGGATCCTGCTGACGGG - Intronic
1061798572 9:133102356-133102378 AATCCTACCCTGCTGCTGACTGG - Intronic
1187523103 X:20030842-20030864 CATCATAGCCTCCTGATAAGAGG + Intronic
1187625436 X:21107306-21107328 CATCTTTTCATCCTCCTGACAGG + Intergenic
1192013017 X:67295647-67295669 AAACCTAGCCTCCTGCTGATAGG + Intergenic
1192215274 X:69153625-69153647 CAGCTTAGCCTCTTGGTGAAGGG - Intergenic
1193791685 X:85822042-85822064 CTTCTTGGCCTCCTGCTGGGAGG - Intergenic
1195046597 X:101060059-101060081 CACCTCAGCCTCCTGCTAGCTGG - Intergenic
1201642441 Y:16193918-16193940 CATCTCAGCCTCCAGATTACAGG - Intergenic
1201660373 Y:16391402-16391424 CATCTCAGCCTCCAGATTACAGG + Intergenic