ID: 1022322365

View in Genome Browser
Species Human (GRCh38)
Location 7:29299023-29299045
Sequence TTGAATTTATTGGGAAAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022322359_1022322365 17 Left 1022322359 7:29298983-29299005 CCTCTTATTTTTTCTCAGATACT 0: 1
1: 0
2: 2
3: 56
4: 498
Right 1022322365 7:29299023-29299045 TTGAATTTATTGGGAAAAAAGGG No data
1022322358_1022322365 23 Left 1022322358 7:29298977-29298999 CCAAGGCCTCTTATTTTTTCTCA 0: 1
1: 1
2: 0
3: 42
4: 495
Right 1022322365 7:29299023-29299045 TTGAATTTATTGGGAAAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022322365 Original CRISPR TTGAATTTATTGGGAAAAAA GGG Intronic
No off target data available for this crispr