ID: 1022329778

View in Genome Browser
Species Human (GRCh38)
Location 7:29366542-29366564
Sequence GATCCCAATGAACCAATACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 82}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022329778_1022329781 -1 Left 1022329778 7:29366542-29366564 CCATGTATTGGTTCATTGGGATC 0: 1
1: 0
2: 0
3: 12
4: 82
Right 1022329781 7:29366564-29366586 CTGAAGGCTCTTCCTCTACAGGG 0: 1
1: 0
2: 3
3: 17
4: 137
1022329778_1022329782 2 Left 1022329778 7:29366542-29366564 CCATGTATTGGTTCATTGGGATC 0: 1
1: 0
2: 0
3: 12
4: 82
Right 1022329782 7:29366567-29366589 AAGGCTCTTCCTCTACAGGGAGG No data
1022329778_1022329783 6 Left 1022329778 7:29366542-29366564 CCATGTATTGGTTCATTGGGATC 0: 1
1: 0
2: 0
3: 12
4: 82
Right 1022329783 7:29366571-29366593 CTCTTCCTCTACAGGGAGGCAGG No data
1022329778_1022329780 -2 Left 1022329778 7:29366542-29366564 CCATGTATTGGTTCATTGGGATC 0: 1
1: 0
2: 0
3: 12
4: 82
Right 1022329780 7:29366563-29366585 TCTGAAGGCTCTTCCTCTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022329778 Original CRISPR GATCCCAATGAACCAATACA TGG (reversed) Intronic
910820343 1:91338519-91338541 GATGCCACTGAACCATTAGATGG + Intronic
912050146 1:105519446-105519468 GATCCCCATGAACTAAATCACGG + Intergenic
922041520 1:221902925-221902947 GATCCCATAATACCAATACATGG - Intergenic
922362944 1:224839720-224839742 GAACCCAATAAACCAAGACACGG - Intergenic
923587433 1:235286801-235286823 GATACCAATGTACAAATACAAGG + Intronic
923750784 1:236744519-236744541 GATTCCAAAGAACCAAGAGAAGG - Intronic
923967698 1:239159888-239159910 GATCACAATAAATCCATACATGG + Intergenic
924590210 1:245396714-245396736 GATGCCAATTATCCATTACATGG + Intronic
1063084599 10:2804971-2804993 GACCAGAATGCACCAATACATGG - Intergenic
1066362254 10:34742629-34742651 CATCCCAACCAACCAATCCAGGG + Intronic
1071464732 10:85928714-85928736 GAACCCCCTGAACCAGTACAGGG - Intronic
1080108894 11:28543438-28543460 GATCTCAAAGAACCAATTGATGG + Intergenic
1084655391 11:70512776-70512798 GAACCAAATAAACAAATACAGGG - Intronic
1090195565 11:124813661-124813683 GATAAGAATGATCCAATACAAGG - Intergenic
1091322439 11:134661587-134661609 GATCCCAGTGCACCAAGACTGGG + Intergenic
1092481467 12:8862759-8862781 CATCACAATAAACCAATACACGG - Intronic
1097417782 12:59334326-59334348 GATTCCACTGAAACAATTCAAGG - Intergenic
1100699113 12:97127599-97127621 AATGCCAATAAACCAATACCTGG + Intergenic
1103173243 12:118840405-118840427 GATCCCTGTGAACCATTACAGGG + Intergenic
1104265266 12:127226342-127226364 GATGCCACTGAATAAATACATGG - Intergenic
1105340926 13:19524821-19524843 GATCATAATGAACAAATACATGG + Intronic
1118655160 14:67939562-67939584 AATCCCAGTGAAGCTATACATGG - Intronic
1121921405 14:97885263-97885285 GACCAAAATGAACCAATACTTGG + Intergenic
1132385414 15:101396924-101396946 GAAACCAATGACCAAATACAGGG - Intronic
1133223673 16:4329839-4329861 AATCCCAATGAACAAACGCAAGG + Intronic
1140965317 16:79960413-79960435 GATACCAATGACCCAAAGCATGG - Intergenic
1141795687 16:86272082-86272104 GGTCCCAATGAACAAATGCCAGG + Intergenic
1144325268 17:14173310-14173332 GATACCAAAGAAGGAATACATGG + Intronic
1144474144 17:15570192-15570214 GATACCAAAGAAGGAATACATGG + Intronic
1152162640 17:78678453-78678475 GATGCCAATGAATCCATAAATGG + Intronic
1153736598 18:8076466-8076488 GTTCCCACTGAATCCATACAAGG + Exonic
1157042624 18:44058949-44058971 GAGCCCAATGAACCAGCACAGGG - Intergenic
1164510468 19:28892623-28892645 GCTCTCAATGAACCAAAACTAGG - Intergenic
932089691 2:68795236-68795258 GAAACCAAAGAAACAATACAAGG - Intronic
933273321 2:80257094-80257116 GATCCAGATGCACCATTACAAGG + Intronic
933282105 2:80343695-80343717 GATCCTTTTGAACCAATAAAAGG + Intronic
938258917 2:129881403-129881425 GAACCCAAGGAGCCAATGCAAGG + Intergenic
943305364 2:186255200-186255222 TCTCTCAATGAATCAATACATGG + Intergenic
944041806 2:195364612-195364634 GAGCCCAATCTACCAATAGAAGG - Intergenic
944417911 2:199497202-199497224 GCTCCCAACAAGCCAATACATGG + Intergenic
944618402 2:201485831-201485853 GATCCCAGTGAAGCAGAACAGGG - Intergenic
946810160 2:223514976-223514998 GATTTCAATGAATAAATACAGGG - Intergenic
948018526 2:234710402-234710424 AATCCCTCTGAACAAATACAGGG + Intergenic
948102395 2:235385213-235385235 CATCCCCAAGAACCAAGACAGGG - Intergenic
948555252 2:238805646-238805668 GATGAAAATGCACCAATACAAGG - Intergenic
1173923666 20:46764691-46764713 CATTGCAATGAACTAATACATGG + Intergenic
1174492203 20:50908040-50908062 GATCTCCATGAACAAATGCATGG - Intronic
1181178713 22:21052744-21052766 GAGCCCTATGAACCACAACATGG - Intronic
1183719904 22:39556832-39556854 GATGCAAATGAACAAATAAAAGG + Intergenic
1184365074 22:44045880-44045902 GATCCCAAATAGCCAACACAAGG - Intronic
962857809 3:139364886-139364908 GATCAAAATGAAGCAATAAAAGG + Intronic
962927090 3:140004933-140004955 GGTCCCAGTGGACCAATAGAAGG - Intronic
965905292 3:173698097-173698119 GATCCTAATGAACTAGAACATGG - Intronic
967354100 3:188548544-188548566 GAATCCAATGAACCAATGCATGG - Intronic
973834609 4:54796771-54796793 GATGCTAATGAACAATTACAAGG + Intergenic
977905182 4:102468818-102468840 GATACCAATGGAACAAGACAGGG + Intergenic
977959234 4:103066455-103066477 GATGCAAATGAACCAACAGAAGG - Exonic
983190369 4:164747734-164747756 GCTATCAAAGAACCAATACAAGG + Intergenic
984178050 4:176443844-176443866 GATCCCAAAGAACCAAAGGAGGG - Intergenic
984206194 4:176791563-176791585 GATCACAATCAAGCAATGCAAGG - Intronic
984368614 4:178831587-178831609 GAGCCCAAAGACCCAATATATGG + Intergenic
986155631 5:5172830-5172852 GATCCCAATGAAAAAATAGCTGG - Intronic
990660783 5:58013027-58013049 GAACCCAATGAGCCATAACATGG - Intergenic
992630412 5:78675112-78675134 TACAGCAATGAACCAATACAGGG - Intronic
1003038177 6:2662914-2662936 GGTTCCAATGTACCAAGACAAGG - Intergenic
1007148623 6:39664231-39664253 GATCCCAAAGAAGAAATAGAAGG + Intronic
1008151715 6:47960683-47960705 GATCCTAATGAAACATTAGAAGG + Intronic
1011350052 6:86413143-86413165 GATCCAAATGAACAAGTACTGGG - Intergenic
1011611923 6:89160686-89160708 GAACCAAATCATCCAATACATGG + Intronic
1015571837 6:134629906-134629928 GATGACAATGAACCATTAAAGGG + Intergenic
1017951950 6:159142435-159142457 GATCCCAGTGCTCCAATGCATGG - Intergenic
1018626141 6:165780862-165780884 GACCCAAATGCACCAATAAAGGG - Intronic
1021012362 7:15486087-15486109 TATAGCAATGATCCAATACATGG - Intronic
1022329778 7:29366542-29366564 GATCCCAATGAACCAATACATGG - Intronic
1028146311 7:87323537-87323559 AATGCAAATGAAACAATACATGG - Intergenic
1031453483 7:121951018-121951040 GATCCAAATGAGTCAATACAAGG + Intronic
1033579558 7:142719704-142719726 GATCACAAGGAACAAAGACATGG + Intergenic
1034559089 7:151868248-151868270 GATTCCAATTAACCATTCCAAGG + Intronic
1035005572 7:155656895-155656917 AATCCCAATAAACTAATATATGG - Intronic
1041191009 8:55354251-55354273 GTTCTCAATGATCCAATGCAGGG + Intronic
1042302055 8:67294653-67294675 GATTCCAGTGCAACAATACAGGG - Intronic
1046895286 8:119464757-119464779 AATCACAATAAAGCAATACAAGG + Intergenic
1048312208 8:133332632-133332654 CCTCCAGATGAACCAATACAGGG - Intergenic
1050955324 9:11650439-11650461 TATCCAAATGAAGCAAAACAAGG - Intergenic
1052902836 9:33809204-33809226 GATCATAATGAACAAATACATGG + Intergenic
1053487745 9:38472687-38472709 GATCATAATGAACAAATACATGG - Intergenic
1056122113 9:83499008-83499030 AAACCCAAGGACCCAATACAAGG - Intronic
1056349320 9:85732745-85732767 GATCCCATTGCACAAATACATGG + Intronic
1056423819 9:86456265-86456287 GACCCCAATGACCCAATATCAGG - Intergenic
1058730365 9:107844223-107844245 GATCCCTATCACCCAACACAGGG + Intergenic
1059823001 9:117994868-117994890 AATCCAAATCAACCTATACATGG - Intergenic
1061353903 9:130088575-130088597 GAGACTAATGAACCAATACCAGG + Intronic
1189632540 X:42970067-42970089 GATGCAAATGAAACCATACATGG - Intergenic
1190835497 X:54097121-54097143 GATCCAAGTGAAACAATTCATGG + Intronic
1202591239 Y:26485781-26485803 GATCATAATGAACAAATACATGG - Intergenic