ID: 1022331427

View in Genome Browser
Species Human (GRCh38)
Location 7:29382940-29382962
Sequence CTGAGGGGTGAGGATGTCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 429
Summary {0: 1, 1: 0, 2: 0, 3: 35, 4: 393}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022331420_1022331427 29 Left 1022331420 7:29382888-29382910 CCGAGGGTGTGCTTCAGAAACTA 0: 1
1: 0
2: 0
3: 7
4: 121
Right 1022331427 7:29382940-29382962 CTGAGGGGTGAGGATGTCGTGGG 0: 1
1: 0
2: 0
3: 35
4: 393

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022331427 Original CRISPR CTGAGGGGTGAGGATGTCGT GGG Intronic
900132911 1:1096821-1096843 CTGAGGTGGGAGGATGGCCTGGG - Intronic
900849405 1:5130532-5130554 CTGATGGGGGAGGTGGTCGTTGG + Intergenic
900973607 1:6004927-6004949 CTGAGGGGTGAGGGTGGAGTGGG + Intronic
900973626 1:6005006-6005028 CTAAGGGGTGAGGGTGGAGTAGG + Intronic
900973640 1:6005046-6005068 CTGAGGGGTGAGGGTAGAGTGGG + Intronic
900973650 1:6005085-6005107 CTGAGGGGTGAGGGTAGAGTGGG + Intronic
900973662 1:6005125-6005147 CTGAGGGGTGAGGGTGCAGTGGG + Intronic
900973674 1:6005165-6005187 CTGAGGGGTGAGGGTAGAGTGGG + Intronic
900973686 1:6005205-6005227 CTGAGGGGTGAGGGTGGAGTAGG + Intronic
900973698 1:6005245-6005267 CTGAGGGGTGGGGGTGGAGTTGG + Intronic
900973710 1:6005285-6005307 CTGAGGGGTGAGGGTAGAGTGGG + Intronic
900973720 1:6005324-6005346 CTGAGGGGTGAGGGTAGAGTGGG + Intronic
900973752 1:6005443-6005465 CTGAGGGGTGAGGGTGGAGGCGG + Intronic
900973886 1:6005925-6005947 CTGAGGGGTGAGGGTGGAGTGGG - Intronic
900973895 1:6005964-6005986 CTGAGGGGTGAGGGTGGAGTGGG - Intronic
900973904 1:6006003-6006025 CTGAGGGGTGAGGGTGGAGTGGG - Intronic
900973917 1:6006043-6006065 CTGAGGGGTGAGGGTGGAGTGGG - Intronic
900973926 1:6006082-6006104 CTGAGGGGTGAGGGTGGAGTGGG - Intronic
900973939 1:6006122-6006144 CTGAGGGGTGAGGGTGGAGTGGG - Intronic
900973952 1:6006162-6006184 CTGAGGGGTGAGGGTGGAGTGGG - Intronic
900973961 1:6006201-6006223 CTGAGGGGTGAGGGTGGAGTGGG - Intronic
900973970 1:6006240-6006262 CTGAGGGGTGAGGGTGGAGTGGG - Intronic
900973983 1:6006280-6006302 CTGAGGGGTGAGGGTGGAGTGGG - Intronic
900973992 1:6006319-6006341 CTGAGGGGTGAGGGTGGAGTGGG - Intronic
900974005 1:6006359-6006381 CTGAGGGGTGGGGGTGGAGTGGG - Intronic
900974020 1:6006399-6006421 TTGAGGGGTGAGGGTGGAGTGGG - Intronic
900974029 1:6006438-6006460 CTGAGGGGTGAGGGTGGAGTGGG - Intronic
900974042 1:6006478-6006500 CTGAGGGGTGAGGGTGCAGTGGG - Intronic
900974074 1:6006581-6006603 CTGAGGGGTGAGGGTGAAGTGGG - Intronic
900974086 1:6006621-6006643 CTGAGGGGTGAGGGTGGAGTGGG - Intronic
900974111 1:6006700-6006722 CTGAGGAGTGAGGGTGAAGTGGG - Intronic
900974120 1:6006740-6006762 CTGAGGGGTGAGGGTGGAGTAGG - Intronic
901844014 1:11970988-11971010 CTGAGGGGTGGGGATGGGGTTGG + Intronic
902791158 1:18769168-18769190 CTGAGGGGTGAGGAGATAGGAGG - Intergenic
902929616 1:19721688-19721710 CTGAGGTGGGAGGATGGCTTGGG + Intronic
903884865 1:26535269-26535291 CTCAGGGGGCAGGATGTCCTGGG + Intronic
904473710 1:30751265-30751287 CGGAGGGGTGAGGAGGCCGGTGG - Intronic
904554670 1:31351642-31351664 CTGAGGTGGGAGGATCTCTTGGG + Intronic
905515150 1:38557302-38557324 CTGAGAGGTGGGGATGTCATTGG - Intergenic
905705702 1:40055603-40055625 CTGAGGTGGGAGGATGGCTTAGG - Intronic
905982132 1:42238655-42238677 CTGAGGTGGGAGGATCTCTTGGG - Intronic
906023460 1:42652309-42652331 CTGAGGGGTGAGGAGGCAATGGG + Intronic
906110049 1:43316669-43316691 CTCAGGGCTGAGCATGTAGTAGG + Intronic
907039400 1:51245156-51245178 CTGAGGTGGGAGGATGGCTTGGG - Intronic
907114909 1:51959967-51959989 CTGAAGGGTGAAGATGGGGTTGG + Intronic
908002547 1:59694756-59694778 CTGAGGAGGGAGGATTTCTTGGG - Intronic
908774095 1:67623878-67623900 CTGAGGTGTGAGGATGGCTTGGG - Intergenic
908826749 1:68140809-68140831 CTCAGAGCTGAGGATGTCTTAGG - Intronic
911367519 1:96956426-96956448 CTGAGGCGAGAGGATGGCTTGGG + Intergenic
913194489 1:116444444-116444466 CTGAGGTGTGAGGAGGCGGTAGG - Intergenic
914865732 1:151427001-151427023 CTGAGGTGAGAGGATGGCTTGGG - Intronic
915153917 1:153858633-153858655 CTGAGGCGTGAGGATCACTTGGG + Intronic
916590276 1:166183542-166183564 CTGGGGGGTGAGGGTGCCTTTGG - Intergenic
919088374 1:192948685-192948707 CTGAGGTGGGAGGATCTCTTGGG + Intergenic
921202989 1:212824754-212824776 CTGAGGTGGGAGGATGGCTTGGG - Intergenic
923004166 1:230031989-230032011 CTGAGGGCTGAGGCTGTCCTGGG - Intergenic
924168659 1:241313064-241313086 CTGAGAGGTGAGGAAGTCACAGG + Intronic
1063958139 10:11284305-11284327 CTGAGGGATGAGTGTGTGGTGGG + Intronic
1064355811 10:14616824-14616846 CTGAGGTGGGAGGATGCCCTGGG + Intronic
1066975624 10:42365640-42365662 CTGGGAGGTGAGGATGCAGTGGG + Intergenic
1067519965 10:46992354-46992376 CTGAGGTGGGAGGATCTCTTGGG - Intronic
1068749461 10:60574706-60574728 TTGAGGGATGAGGATGAGGTAGG + Intronic
1068989025 10:63132521-63132543 CTGAGGTGTGAGGATCGCCTGGG + Intergenic
1070622472 10:78023902-78023924 CTGAGGTGAGAGGATCTCTTGGG + Intronic
1072817884 10:98527515-98527537 CTGAGGGATGAGAGTGCCGTGGG - Intronic
1073141540 10:101251675-101251697 CTGAGGTGGGAGGATGGCTTGGG - Intergenic
1073455117 10:103632066-103632088 CTGAGGTGAGAGGATGGCTTGGG + Intronic
1076008267 10:126965500-126965522 CCGAGGGGTGATGAAGTCTTGGG + Intronic
1076049762 10:127323162-127323184 CTGCTGGGTGAGGACCTCGTGGG + Intronic
1076581363 10:131514056-131514078 CTGCGGGGTGAGGCAGGCGTTGG - Intergenic
1076863676 10:133156289-133156311 CTGTGGGGTATTGATGTCGTTGG + Intergenic
1076863687 10:133156363-133156385 CTGTGGGGTATTGATGTCGTTGG + Intergenic
1076994880 11:292991-293013 CTGAGGGGTGAGGCCATGGTGGG + Exonic
1077194530 11:1272545-1272567 CTGAGGGGTGAGGGGGTCGCTGG - Intergenic
1077922132 11:6649512-6649534 GAGAGGGGAGAGGAGGTCGTAGG + Intronic
1078252125 11:9624743-9624765 CTGAGGTGGGAGGATGGCTTGGG + Intergenic
1079631630 11:22684661-22684683 CTGAGGTGAGAGGATGGCTTGGG - Intronic
1080085673 11:28278923-28278945 CTGAGGTGTGAGGATCGCTTGGG - Intronic
1080217963 11:29867320-29867342 CTGTGGGGTGAGGATGGGTTAGG - Intergenic
1081334654 11:41849487-41849509 CTGAGGTGGGAGGATGGCTTGGG - Intergenic
1081819368 11:45976741-45976763 CTGAGGTGGGAGGATGGCTTGGG + Intronic
1083309191 11:61775842-61775864 GTGAGGGGTGAGGAGGGTGTGGG + Intronic
1083559603 11:63662576-63662598 CTGAGGTGGGAGGATGACTTGGG - Intronic
1085509047 11:77076513-77076535 CTGAGGGGTGAGGGTGGGGAGGG - Intronic
1085535305 11:77213855-77213877 ATGAGTGGTGAGGATATCCTGGG - Exonic
1087093426 11:94298436-94298458 CTGAAGGGTGAGGATGGGATGGG + Intergenic
1087836163 11:102877415-102877437 CTGAGGTGGGAGGATCTCTTGGG + Intergenic
1089211468 11:116806648-116806670 CTGAGGTGAGAGGATCGCGTGGG - Intergenic
1089222887 11:116889796-116889818 CTGAGGTGGGAGGATGGCTTGGG + Intronic
1090409002 11:126494928-126494950 CTGAGGGATGCGGGTGGCGTGGG + Intronic
1090454257 11:126834229-126834251 CTGGGAGGTGAGGTTGTCATAGG + Intronic
1090665794 11:128914255-128914277 CTGGGGAGTGAGGATGGCCTTGG - Intronic
1091191690 11:133701084-133701106 CTGAGGTGGGAGGAAGGCGTGGG - Intergenic
1091294823 11:134466371-134466393 CTGAGGGGTGGGGAAGCCGTGGG - Intergenic
1092186867 12:6486793-6486815 CTGAGGTGGGAGGATGGCTTGGG - Intergenic
1093225136 12:16473780-16473802 CTGAGGCGGGAGGATGACTTGGG + Intronic
1093888019 12:24486049-24486071 CTGAGGTGGGAGGATGGCTTGGG - Intergenic
1094113327 12:26884051-26884073 CTGAGGTGGGAGGATCTCTTGGG + Intergenic
1095890656 12:47233033-47233055 CTGAGGCGGGAGGATGGCTTGGG - Intronic
1096163196 12:49398040-49398062 CTGAGGTGTGAGGATTGCTTGGG + Intronic
1096190268 12:49613026-49613048 CTGAGGTGTGAGAATATGGTTGG - Intronic
1096281478 12:50258528-50258550 CTGAGGCGTGAGGATCACTTAGG - Intronic
1096867450 12:54573249-54573271 GTGAGGGGTGGGGATGTGGCAGG + Intronic
1097043463 12:56170335-56170357 CTGAGGTGGGAGGATTGCGTGGG - Intronic
1097399809 12:59114866-59114888 CTGATGTGGGAGGATGCCGTGGG + Intergenic
1097869808 12:64591998-64592020 CTGAGGTGGGAGGATCTCGTGGG - Intergenic
1098311781 12:69156063-69156085 CTGAGGCGGGAGGATGGCTTGGG + Intergenic
1098858263 12:75678657-75678679 CTGAGTGGTGAAGATGTTCTTGG + Intergenic
1100857078 12:98766902-98766924 CTGAGGTGGGAGGATCTCTTGGG - Intronic
1100986066 12:100202756-100202778 CTGAGGCGGGAGAATGGCGTGGG + Intronic
1101269820 12:103131788-103131810 TTGAGGGGTGATGTTGTTGTTGG + Intergenic
1102413208 12:112738289-112738311 CTGAGGTGGGAGGATCTCTTGGG - Intronic
1102698542 12:114818784-114818806 CTGAGGTGGGAGGATCTCCTGGG - Intergenic
1102813686 12:115845011-115845033 CTGAGGTGGGAGGATTTCTTGGG + Intergenic
1102929294 12:116850251-116850273 CTGAGGCGGGAGGATGGCTTGGG - Exonic
1104898236 12:132174531-132174553 CTGCGGGGAGAGGCTGTCCTGGG + Intergenic
1105914950 13:24905678-24905700 CTTAGGGATGAGGATCTCGAGGG + Exonic
1106252482 13:27993204-27993226 CTGAGGTGAGAGGATGGCTTGGG + Intergenic
1106565777 13:30883502-30883524 CTGAGGGGTGAGGGAGTGGCAGG - Intergenic
1106791625 13:33161546-33161568 CTGAGGTGGGTGGATGTCTTGGG - Intronic
1106883715 13:34159815-34159837 TGGTGGGGTGGGGATGTCGTGGG + Intergenic
1107461700 13:40610136-40610158 CTGAGGAGTGAGGGTGTGGCAGG - Intronic
1107615288 13:42160674-42160696 CTGCAGGATGAGGAGGTCGTGGG + Intronic
1107859900 13:44650748-44650770 CTGAGGCGGGAGGATGGCTTGGG + Intergenic
1107921056 13:45208023-45208045 CTGAGGTGTGAGGATTGCTTGGG + Intronic
1108635348 13:52328764-52328786 CTGAGGTGGGAAGATCTCGTCGG + Intergenic
1110832564 13:80047926-80047948 CAGAGGTGTAAGGATGTGGTAGG + Intergenic
1110872008 13:80463282-80463304 CTGGGGGGTGAGCAGGTAGTGGG + Intergenic
1111813026 13:93115706-93115728 CTGAGGTGGGAGGATGGCTTGGG - Intergenic
1111950913 13:94708323-94708345 AGGAGGGGTGAGGATGCCGAGGG - Intergenic
1112204948 13:97315787-97315809 CTCATGGGTGAGGATGTGGAAGG + Intronic
1112299642 13:98218191-98218213 GTTCGGGGTGAGGATGGCGTGGG - Intronic
1113973504 13:114208938-114208960 CTGAGGGATGAGGCTGTCTTTGG - Intergenic
1115578571 14:34735863-34735885 CTGAGGTGGGAGGATCTCATGGG + Intergenic
1115731516 14:36274333-36274355 CTGAGGTGGGAGGATCTCTTGGG - Intergenic
1115798992 14:36971175-36971197 CTGAGGGGTAAGGAAGTCCTTGG + Intronic
1116897923 14:50335195-50335217 CTAAGGCGGGAGGATGGCGTGGG + Intronic
1117028819 14:51649855-51649877 CTGAGGTGGGAGGATGGCTTGGG - Intronic
1117072245 14:52068134-52068156 CTGAGTGGAGATGATGCCGTTGG + Exonic
1117247635 14:53901600-53901622 ATGAGAGGTGAGGACGTAGTGGG - Intergenic
1117646522 14:57859004-57859026 CTGAGGTGGGAGGATGGCTTGGG + Intronic
1117935228 14:60896717-60896739 CTGAGGCGTGTGGATCACGTGGG - Intronic
1118313105 14:64707138-64707160 CTGAGGAGGGAGGATGGAGTAGG - Intronic
1118453086 14:65921821-65921843 CTGAGGTGGGAGGATGGCTTGGG + Intergenic
1119197898 14:72731297-72731319 CTGAAGGGTGAGGACGGCATGGG + Intronic
1121885674 14:97540538-97540560 CTGCTGGGTGAGGAAGTCCTGGG - Intergenic
1122581799 14:102776411-102776433 CTGAGGGGTGAGGCCTTCGCTGG - Intergenic
1122935431 14:104953850-104953872 CTGAAGGGTGAGGAGGTGGAAGG - Exonic
1124945966 15:34266538-34266560 CTGAGGTGGGAGGATCTCTTGGG - Intronic
1124973821 15:34515087-34515109 GTGAGGGGTGAGGGTGACGGGGG - Intergenic
1125760921 15:42094812-42094834 CTGAGGGCAGAGGATGGGGTGGG + Intergenic
1126040364 15:44584726-44584748 CTGAGGTGGGAGGATCTCTTGGG - Intronic
1126909497 15:53402806-53402828 CTGAGGGATGAGACTGTCTTGGG + Intergenic
1127504544 15:59584964-59584986 CTGAGGTGGGAGGATGGCTTGGG + Intergenic
1128407908 15:67362679-67362701 CTATGGGGTGAGGATTTCCTGGG - Intronic
1130060728 15:80567963-80567985 CTGAGGGGAGGGGATGGCGAGGG + Intronic
1130613657 15:85383124-85383146 CTGAGGTGGGAGGATGGCTTGGG - Intronic
1131489026 15:92846138-92846160 CTGAGGCATGAGGATCTCTTGGG - Intergenic
1131602156 15:93860515-93860537 CTGAGGAGTGAGGAAGACGGGGG + Intergenic
1132373138 15:101311671-101311693 GTGAGGGGTGACGATGGGGTGGG - Intronic
1132373146 15:101311696-101311718 GTGAGGGGTGACGATGGGGTGGG - Intronic
1132373154 15:101311721-101311743 GTGAGGGGTGACGATGGGGTGGG - Intronic
1132373162 15:101311746-101311768 GTGAGGGGTGACGATGGGGTGGG - Intronic
1132373170 15:101311771-101311793 GTGAGGGGTGACGATGGGGTGGG - Intronic
1132373178 15:101311796-101311818 GTGAGGGGTGACGATGGGGTGGG - Intronic
1132373195 15:101311846-101311868 GTGAGGGGTGACGATGGGGTGGG - Intronic
1132373203 15:101311871-101311893 GTGAGGGGTGACGATGGGGTGGG - Intronic
1132373211 15:101311896-101311918 GTGAGGGGTGACGATGGGGTGGG - Intronic
1132373233 15:101311973-101311995 GTGAGGGGTGACGATGGGGTGGG - Intronic
1132373241 15:101311998-101312020 GTGAGGGGTGACGATGGGGTGGG - Intronic
1132373249 15:101312023-101312045 GTGAGGGGTGACGATGGGGTGGG - Intronic
1132373257 15:101312048-101312070 GTGAGGGGTGACGATGGGGTGGG - Intronic
1132373272 15:101312099-101312121 GTGAGGGGTGACGATGGGGTGGG - Intronic
1132373280 15:101312124-101312146 GTGAGGGGTGACGATGGGGTGGG - Intronic
1132373288 15:101312149-101312171 GTGAGGGGTGACGATGGGGTGGG - Intronic
1133394711 16:5437173-5437195 TTGAGGGGTGAAGATATCATAGG + Intergenic
1133620225 16:7518922-7518944 CTGAGGTGGGAGGATGGCTTGGG + Intronic
1133782299 16:8948863-8948885 CTGATGGGAGAGGATGGCTTTGG + Intronic
1135993542 16:27231833-27231855 CTCAGGGGTCTGGATGACGTCGG - Intronic
1136300538 16:29331399-29331421 CTGAGGGGTGGGGCTCTCATGGG + Intergenic
1136457830 16:30391934-30391956 CTGAGGTGAGAGGATCTCTTGGG - Intronic
1137399383 16:48140956-48140978 CTGAGGGCTGAGGCTGGCATAGG + Intronic
1137664208 16:50239476-50239498 CTGAGGTGGGAGGATGGCTTGGG - Intergenic
1137826305 16:51498893-51498915 CTGAGGTGGGAGGATGGCTTAGG + Intergenic
1137977928 16:53046584-53046606 CTGAGGAGGGAGGATGGCTTGGG + Intergenic
1138562168 16:57807829-57807851 CTGAGGCGGGAGGATGGCGTGGG + Intronic
1140411209 16:74741557-74741579 CTGAGGTGGGAGGATGGCCTAGG - Intronic
1141589863 16:85061334-85061356 GTAAGAGGTGAGGATGACGTGGG + Intronic
1142159850 16:88551628-88551650 CTGAGGCGGGAGGATGACTTGGG - Intergenic
1143735054 17:8905699-8905721 CAGCGGGGTGAGCAGGTCGTAGG + Exonic
1143787206 17:9264878-9264900 CTGAGGTGGGAGGATCTCTTGGG + Intronic
1144868481 17:18352719-18352741 CTGAGGTGGGAGGATGGCTTGGG + Intronic
1146940977 17:36844345-36844367 CAGAGGGGAGAGGAGGTCCTGGG - Intergenic
1148437448 17:47694756-47694778 CTGGGGGGAGGGGATGGCGTGGG + Intronic
1148914599 17:50964849-50964871 CTGAGGTGGGAGGATGACCTGGG - Exonic
1150113363 17:62521617-62521639 CTGAGGTGGGAGGATGGCTTGGG - Intronic
1150159124 17:62879705-62879727 CTTAGGGGTGAGGATGATGAAGG + Intergenic
1150559362 17:66281512-66281534 CTGAGGTGGGAGGATGGCTTGGG - Intergenic
1150920135 17:69474289-69474311 CTGATTGATGAGGATGTCATAGG + Intronic
1151161623 17:72170799-72170821 CTGAGGTGGGAGGATGGCTTGGG + Intergenic
1154390551 18:13932857-13932879 TTGAGGGCTGAGGATGTGGAAGG + Intergenic
1155133091 18:22958642-22958664 CTGAGGTGTGAGGATCACTTGGG - Intronic
1155472208 18:26203107-26203129 CTGAGGTGGGAGGATGAGGTGGG + Intergenic
1155925068 18:31647474-31647496 CTGAGGGGTGTGGATGGGGTGGG - Intronic
1155985088 18:32221749-32221771 CTGAGGTGTGAGGATTGCTTGGG + Intronic
1157258738 18:46160767-46160789 CTGAGGTGTGAGGATCACTTGGG - Intergenic
1157314250 18:46575127-46575149 CTGAGGGGTGGGGACGAGGTTGG - Intronic
1159493594 18:69170972-69170994 CTGAGTGGGGAGGATCTCTTGGG - Intergenic
1160480764 18:79237783-79237805 CGGAGGTGTGAGGATGGCTTTGG - Intronic
1160938909 19:1610769-1610791 CTGAGGGGAGAGGATGCGGCAGG + Exonic
1161059254 19:2206909-2206931 CTGTGGGGTGGGGCTGTCCTGGG + Intronic
1161694449 19:5758195-5758217 CTGAGGCATGAGGATTGCGTGGG + Intronic
1161728513 19:5944791-5944813 CTTGGGGGTGGGGATGTCCTGGG - Intronic
1162376195 19:10306714-10306736 CTGAGGAGGGAGGATGGCTTGGG + Intronic
1162714728 19:12622977-12622999 CTGAGGCAGGAGGATGTCTTGGG + Intronic
1162889338 19:13721159-13721181 CTGAGGTGGGAGGATGGCTTGGG - Intergenic
1162917232 19:13881102-13881124 CTTAGTGATGAGGATGTCGGGGG - Intergenic
1162967217 19:14161602-14161624 CTGAGGGGTGGGGAAGTGGCTGG + Exonic
1164641944 19:29832708-29832730 CTGAGGCGGGAGGATCTCTTGGG - Intergenic
1165437599 19:35804835-35804857 CTGAGGTGGGAGGATGGCTTGGG + Intronic
1165457101 19:35918991-35919013 CTGAGGTGGGAGGATGGCTTAGG - Intergenic
1165862156 19:38914994-38915016 CTGAGGGGTGAGGCTGGGGCTGG + Intergenic
1166089336 19:40497979-40498001 GTTAGGGGTGGGGATGGCGTTGG - Intronic
1166103092 19:40582815-40582837 CTGAGGTGGGAGGATGGCTTTGG + Intronic
1166396593 19:42445686-42445708 CTGAGGTGGGAGGATGGCTTGGG + Intergenic
1166631714 19:44412529-44412551 CTGTGGGGTGAGGATAGCCTGGG - Intergenic
1166636463 19:44456092-44456114 CTGTGGGGTGAGGATAGCCTGGG + Intergenic
1166638521 19:44473430-44473452 CTGAGGGGTGATGATTGCCTGGG + Intergenic
1166964463 19:46519879-46519901 CTGAGGTGGGAGGATCACGTGGG + Intronic
1168121994 19:54256798-54256820 CTGAGGGATGGGGATGTCTTGGG - Intronic
1168134066 19:54338705-54338727 CTGAGGGTTGAGGACATCTTGGG - Intronic
1168478062 19:56692363-56692385 ATGAGGAGTGAGGGTGGCGTGGG - Intergenic
1168704701 19:58463220-58463242 CTGAGGTGGGAGGATGGCTTGGG + Intergenic
925103486 2:1269420-1269442 CTGAGTGGGGAGGATCTCTTAGG + Intronic
925289872 2:2740354-2740376 CTGAGGGAGGAGGCTGTTGTTGG + Intergenic
927774336 2:25890528-25890550 CTGAGGTGGGAGGATCTCTTGGG + Intergenic
927929028 2:27032423-27032445 CTGAGGGGTGGGGGTGGGGTGGG + Intergenic
929289189 2:40169840-40169862 CTGAGGTGTGAGGATCCCTTGGG + Intronic
929314832 2:40464670-40464692 CTGAGAAGTGGGGATGTGGTGGG + Intronic
930298529 2:49585583-49585605 CTGAGGTGGGAGGATCTCTTGGG + Intergenic
931683807 2:64775288-64775310 CTGAGGTGGGAGGATGGCTTAGG + Intergenic
932631092 2:73344122-73344144 CTGGGGAGTGAGGATGAGGTGGG + Intergenic
933825758 2:86159182-86159204 CTGAGGTGAGAGGATGACTTGGG - Intronic
933826932 2:86170318-86170340 CTGAGGTGGGAGGATGGCTTTGG + Intronic
934034202 2:88075634-88075656 CTGAGGTGGGAGGATGGCTTGGG - Intronic
934582410 2:95454444-95454466 CTGAGGTGAGAGGATGGCTTGGG + Intergenic
934597040 2:95622270-95622292 CTGAGGTGAGAGGATGGCTTGGG - Intergenic
934842836 2:97640742-97640764 CTGAGGTGAGAGGATGGCTTGGG + Intergenic
937397886 2:121554529-121554551 TTGAGGTGGGAGGATGGCGTGGG + Intronic
937995048 2:127687432-127687454 CTGAGGGGGGAGGATCACTTGGG + Intergenic
938541296 2:132286146-132286168 CTGTGGGGTGAGGATAGCCTGGG + Intergenic
940023055 2:149176574-149176596 GTCAGGGGTTAGGATGTCATGGG - Intronic
940416840 2:153432712-153432734 CTGGGGGGTGGGGAGGTGGTTGG + Intergenic
940651096 2:156441458-156441480 CTGAGGTGAGAGGATCTCTTGGG + Intronic
940948435 2:159645171-159645193 CTGAGGTGTGAGGATCACTTGGG + Intergenic
942450586 2:176106067-176106089 CAGAGGGGTGAGGAGGACGAAGG + Intronic
943270453 2:185795513-185795535 CTGAGATGTGAGGATTTCATCGG - Exonic
943346907 2:186749362-186749384 CTGAGGGGTGAGGTTGAAGCAGG + Intronic
944099243 2:196004860-196004882 CTGAGGTGGGAGGATGGCTTGGG + Intronic
944240534 2:197481262-197481284 ATGAGGGGTGAGGAGGACTTGGG - Intergenic
944318017 2:198304415-198304437 CTGATGGCTGAGGAGGTGGTGGG - Intronic
945278600 2:208013720-208013742 CTGGGTGGTGAGGATGTCATGGG + Intronic
946229054 2:218280392-218280414 CTGGGGGGTCACGATGTAGTGGG + Intronic
946441179 2:219697802-219697824 TTGAAGTGTGAGGATGTGGTGGG + Intergenic
947236099 2:227942605-227942627 CTGAGAGGTGAGGATTACATGGG + Intergenic
948295170 2:236855303-236855325 CTGAAGGGTGAGTATCTCCTGGG - Intergenic
948426672 2:237892355-237892377 CTGAGGTGGGAGGATCTCTTGGG - Intronic
1168925269 20:1574159-1574181 CTGAGGAGTGAGGATTTGCTGGG + Intronic
1168929147 20:1607187-1607209 CTGAGGAGTGAGGATTTGCTGGG + Intronic
1168936959 20:1673844-1673866 CTGAGGAGTGAGGATTTGCTGGG + Intergenic
1170874072 20:20234469-20234491 CTGTGGGGAGAGGATTTTGTGGG + Intronic
1171353351 20:24522588-24522610 CTGTGGGATGAGGCTGTGGTTGG + Intronic
1171458386 20:25284531-25284553 CTGAGGTGGGAGGATTTCCTGGG - Intronic
1172340176 20:34151362-34151384 CTGAGGTGGGAGGATGGCTTCGG - Intergenic
1172761291 20:37324820-37324842 CTGAGGTGAAAGGATGTCTTGGG - Intergenic
1173942358 20:46922177-46922199 CTCCGGGGTGATGATGTCCTGGG - Intronic
1174387075 20:50193559-50193581 CTGAGAGTTGAGGATGTAGATGG + Intergenic
1174429170 20:50455708-50455730 CCGAGGGGTGAAGATGAGGTTGG - Intergenic
1174440323 20:50546474-50546496 CTGAGGGGTAAGGATGAAGAAGG - Intronic
1174891182 20:54396103-54396125 CTGAGGTGTGAAGATGGCTTGGG + Intergenic
1176174268 20:63711126-63711148 CTGAGGTGGGAGGATGGCTTGGG - Intronic
1177072530 21:16528294-16528316 CTGAGGTGGGAGGATGGCTTTGG - Intergenic
1177424995 21:20911309-20911331 CTGAGGTGAGAGGATCTCTTGGG - Intergenic
1177641956 21:23855113-23855135 CTGAGGGGTGAAGAGTTTGTGGG - Intergenic
1179176683 21:39012639-39012661 GTGAGGGGTGAGGTTGCAGTAGG - Intergenic
1179415729 21:41197058-41197080 CTGAGGTGGGAGGATGCCTTGGG - Intronic
1180922491 22:19528264-19528286 CTGAGGGGTGCGGCTGAGGTTGG - Intergenic
1181161487 22:20962603-20962625 CTGAGGTGGGAGGATGGCTTGGG - Intergenic
1181806381 22:25376873-25376895 CTGAGGGCTGGGGATGTGGCAGG - Intronic
1181861699 22:25823918-25823940 CTGTGGGGAGGGGATGCCGTGGG + Intronic
1182767985 22:32772523-32772545 TTTAGGGGTGAGGATATCATTGG - Intronic
1183686816 22:39365804-39365826 CAGATGGGGGAGGAAGTCGTGGG - Intronic
1184084442 22:42251283-42251305 CTGAGGTGGGAGGATCTCTTGGG - Intronic
1184121645 22:42454453-42454475 CTGAGGTGGGAGGATGACCTGGG + Intergenic
1184546421 22:45172211-45172233 CTGAAGGGAGAGGATGTACTGGG - Intronic
1185095392 22:48803578-48803600 CTGAGCAGTGAGGATCTCCTGGG - Intronic
1185414742 22:50703911-50703933 GTGTGAGGTGAGGCTGTCGTAGG - Intergenic
949551435 3:5115373-5115395 CTGAGAGGGGAGGATGACATGGG + Intergenic
952341269 3:32449546-32449568 CGGAGCGGTGAGGATGTTTTGGG + Exonic
952914491 3:38223363-38223385 CTGAGGTGGGAGGATGAGGTGGG - Intronic
953157573 3:40388485-40388507 GTGAGGGGTGGGGGTGTTGTAGG - Intronic
953455932 3:43042382-43042404 CTGAGGGGGAAGGATCTCTTGGG + Intronic
953489253 3:43334360-43334382 CTGAGGTGGGAGGATGGCATGGG + Intronic
954427882 3:50453194-50453216 CTGAGGGGTGAGCATTTCTGGGG - Intronic
954800216 3:53182984-53183006 CTGCGGGGTGAGGGTGTGGGCGG + Intronic
955508219 3:59653297-59653319 CTGAGGTGGGAGGATGGCTTGGG - Intergenic
955932224 3:64068366-64068388 CTGAGGGGTGGGGAAGACATGGG + Intergenic
956269437 3:67434426-67434448 CTGAGGTGGGAGGATTTCTTGGG + Intronic
956949749 3:74268201-74268223 CTAAGGGGTGAGGGTGTTGAGGG + Intronic
957303974 3:78431910-78431932 ATGAGGGGTGAGGAACACGTGGG + Intergenic
957866548 3:86031980-86032002 CTGAGTGGGGAGGATGTTGACGG + Intronic
959817539 3:110692575-110692597 CTGGGGGTTGAGGTTGTGGTGGG - Intergenic
960586742 3:119327039-119327061 CTGAGGTGGGAGGATGGCTTGGG + Intronic
963039011 3:141055232-141055254 CGGAGGGAAGAGGATGTAGTGGG + Intronic
963633050 3:147758033-147758055 CTGAGGGGTGGGGATGGGGGTGG + Intergenic
963789569 3:149569906-149569928 CTGAGGTGGGAGGATCTCTTGGG - Intronic
965776202 3:172234032-172234054 TTGAGGGGAGGGGATGTCCTTGG - Intronic
966374272 3:179279660-179279682 CTGAGGGGTGAAGTTGTGGGTGG - Intergenic
966830439 3:184003364-184003386 CTGGGGAGTAAGGATGTGGTGGG - Intronic
968667708 4:1829719-1829741 CTGAGGTGGGAGGATGGCTTGGG + Intronic
968678096 4:1896465-1896487 CTGAGGTGTGAGGATGGCTTGGG - Intronic
968948636 4:3678861-3678883 CTGAGGAGTGAGGATATAGGAGG + Intergenic
969119257 4:4895540-4895562 CTAAGGTGTGATGATGTGGTAGG + Intergenic
969308888 4:6340680-6340702 CTGAGGGGTGAGGTAGAAGTGGG - Intronic
971014056 4:22469196-22469218 CTGTGGGTTGAGGGTGTCCTCGG - Intronic
972440947 4:39090899-39090921 CTGAGGTGGGAGGATCTCTTGGG - Intronic
972536505 4:40004512-40004534 CTGAGGTGTGAGGATTGCTTGGG - Intergenic
976387018 4:84471905-84471927 CTAAGGGATGAGGATGCTGTTGG + Intergenic
977291243 4:95167072-95167094 CTCAGGGATGAGGATGGCGGAGG + Exonic
977295104 4:95201221-95201243 CTCAGGGGTCAGGATGCCTTGGG - Intronic
978501669 4:109416869-109416891 CTGAGGTGGGAGGATCTCTTGGG - Intergenic
978583771 4:110257094-110257116 CTGAGGTGGGAGGATTTCTTTGG - Intergenic
978814900 4:112893250-112893272 CTGAGGTGAGAGGATCTCTTGGG - Intronic
980138625 4:128888313-128888335 CTGAGGCAGGAGGATGGCGTGGG - Intronic
981011578 4:139930661-139930683 CTGAGGGGAGAGTGTGTCATGGG - Intronic
982124994 4:152176901-152176923 CTGAGGTGGGAGGATGGCTTGGG - Intergenic
982246758 4:153360936-153360958 CTGAGGCGGGAGGATGGCTTGGG - Intronic
982268195 4:153559667-153559689 CAGAGAGATGAGGATGTCCTGGG - Intronic
982273538 4:153616163-153616185 CTGAGGGATGTGGATGGCATAGG + Intronic
985668216 5:1192817-1192839 CTGAGTGGGGGAGATGTCGTGGG + Intergenic
988462964 5:31457789-31457811 CTGAGGTGGGAGGATGTGTTGGG + Intronic
989824765 5:45839649-45839671 GTAAGGGGTGAGGAGGTGGTGGG + Intergenic
993339003 5:86698868-86698890 GTGGGGGGTGAGGAAGTCGCAGG - Intergenic
994554291 5:101278266-101278288 CTGAGGTGGGAGGATGACCTGGG + Intergenic
996706699 5:126505301-126505323 CTGAGGTGGGAGGATCTCTTGGG - Intergenic
996792465 5:127307349-127307371 CTGAGTGGTGAGAATGGGGTGGG + Intronic
998246889 5:140514871-140514893 CTGAGGCGAGAGGATCTCTTGGG + Intronic
999249370 5:150173024-150173046 CTGAGGGGTGAGCGTGGCATGGG - Intronic
999419041 5:151425227-151425249 ATGTGGGGTGGGGATGTCTTTGG - Intergenic
999438912 5:151586126-151586148 CTGAGGGGAGAGGATGCTGCAGG + Intergenic
999663860 5:153893013-153893035 CTGAGGTGGGAGGATCTCTTGGG + Intergenic
999910618 5:156194278-156194300 CTGAGGTGGGAGGATCTCTTGGG + Intronic
1003391757 6:5719282-5719304 CTGAGGTGGGAGGATCTCTTGGG + Intronic
1004042209 6:11991312-11991334 CTGAGGTGTGAGGATCCCTTGGG - Intergenic
1006331725 6:33396539-33396561 CTGAGGTGGGAGGATGGCTTGGG - Intronic
1006335267 6:33417262-33417284 CTGAGGGATGAGGTTGACGCAGG + Exonic
1006900031 6:37494003-37494025 CTGAGGGGAGAGAATGGCCTAGG - Intronic
1007162288 6:39801371-39801393 CTGAGGGGTGTGGATGTATCTGG + Intronic
1007614842 6:43173824-43173846 CTGAGGGGTGAGGAGGGAGATGG - Intronic
1007773861 6:44212927-44212949 CTGAGGTGGGAGGATGGCTTGGG + Intergenic
1008460031 6:51757910-51757932 CTGAGGTGGGAGGATGGCTTAGG + Intronic
1014987850 6:128033776-128033798 CTGAGGGGGGAGTATTTCTTGGG + Intronic
1015591036 6:134823259-134823281 CTGTGGGGTGAGGAGGTTGTAGG - Intergenic
1017385279 6:153875882-153875904 GTGAGGGGTGAGGGTGTGGAGGG - Intergenic
1017406948 6:154129830-154129852 CTGGGGGGGGAGGGTGTCGGTGG - Intronic
1017861482 6:158402244-158402266 CTGAGGGGTGGGGAAGGGGTGGG - Intronic
1018528859 6:164742228-164742250 GGGAGGGGTGAGGAGGTGGTGGG - Intergenic
1019624455 7:2008943-2008965 CTGAGGGGTGCGGAGGCTGTGGG + Intronic
1019759452 7:2799344-2799366 CTGAGGGGAGAGGATCACTTGGG + Intronic
1019763122 7:2828972-2828994 CTGAGGTGAGAGGATGGCTTGGG + Intronic
1020075757 7:5257743-5257765 CTGAGATGGGAGGATGGCGTGGG + Intergenic
1020725007 7:11801066-11801088 CTGAGGTGGGAGGATCTCTTGGG + Intronic
1021991423 7:26145189-26145211 CTGAGGTGGGAGGATCTCTTTGG + Intergenic
1022331427 7:29382940-29382962 CTGAGGGGTGAGGATGTCGTGGG + Intronic
1024254208 7:47527807-47527829 CTGAGGTGGGAGGATGGCTTGGG + Intronic
1026021327 7:66708711-66708733 CTGAGGTGGGAGGATCTCCTGGG + Intronic
1028543738 7:91974947-91974969 CTGAGGTGGGAGGATGGCTTGGG - Intronic
1028563048 7:92196625-92196647 CTGAGGTGGGAGGATTTCTTGGG - Intergenic
1029122886 7:98280511-98280533 CTGAGGTGGGAGGATGGCTTGGG + Intronic
1029497454 7:100903708-100903730 CTGAGGTGGGAGGATGGCTTGGG + Intergenic
1029533504 7:101141410-101141432 CTGAGGTGCGAGGATGGCTTTGG - Intergenic
1032276374 7:130459787-130459809 CTGAGGTGGGAGGATGGCTTGGG - Intergenic
1034604988 7:152303887-152303909 CTGAGGTGGGAGGATGACTTGGG + Intronic
1034963234 7:155375019-155375041 CTGAGGGTGGAGGAGGTCGCGGG - Intergenic
1035186699 7:157131829-157131851 CTGAGGTGGGAGGATGGCTTGGG + Intergenic
1035230551 7:157463527-157463549 GTGAGGGGTGAGGATGGGGATGG - Intergenic
1035682081 8:1495496-1495518 ATGAGGGGTCAGAATGTGGTGGG + Intergenic
1037837966 8:22225384-22225406 CTGAGGAGGGAGGATGGCTTGGG + Intronic
1038750046 8:30286484-30286506 CTGAGGTGGGAGGATCTCTTGGG - Intergenic
1038799607 8:30737747-30737769 CTGAGGTGGGAGGATCACGTGGG + Intronic
1039444262 8:37618399-37618421 CTGAGGTGGGAGGATGGCTTGGG + Intergenic
1041245988 8:55889114-55889136 CTGAGGTGAGAGGATGGCTTGGG - Intronic
1041896801 8:62934277-62934299 CTGAGGTGGGAGGATCTCTTGGG + Intronic
1043372267 8:79609133-79609155 CTGAGGGGAAAGGGTGTGGTGGG + Intergenic
1044651377 8:94499232-94499254 CTGAGGTGGGAGGATCTCTTGGG - Intronic
1044871896 8:96627950-96627972 CTGAGGGGGGAGGATCACCTGGG - Intergenic
1045141132 8:99284647-99284669 CTGAGGGAGGAGGATCTCTTGGG - Intronic
1045913308 8:107435999-107436021 CTGAGGTGAGAGGATGGCTTGGG - Intronic
1046888755 8:119398983-119399005 CTGAGGTGGGAGGATGGCTTGGG - Intergenic
1047225756 8:122954404-122954426 CTGAGGGGGGAGGATCGCTTGGG - Intronic
1047424953 8:124736738-124736760 CTGAGGTGGGAGGCTGTCTTGGG - Intergenic
1049399667 8:142419286-142419308 CTGAGAGGTCAGGAGGGCGTGGG + Intergenic
1049435616 8:142584897-142584919 CTCAGGGGTGAAGATGACCTTGG - Intergenic
1049594467 8:143477076-143477098 CTGAGTGGTGGGGATGGCGGTGG - Intronic
1049702526 8:144021643-144021665 CTGAGGGGGGAGGATCTTGAGGG - Intronic
1049702731 8:144022490-144022512 CTGAGGGGGGAGGATCTTGAGGG - Intronic
1050766499 9:9141233-9141255 CTGAGGGGAGAGGAAGACGGGGG - Intronic
1050958052 9:11689252-11689274 CTGAGGTGGGAGGATTTCTTGGG + Intergenic
1052790395 9:32870162-32870184 CTGAGTGGGGAGGATGGCCTAGG - Intergenic
1053270334 9:36745249-36745271 CTTAGGGATGAGGATGTGGTTGG + Intergenic
1055079843 9:72258212-72258234 CTGAGGTGTGAGGATCACTTGGG + Intergenic
1055238801 9:74158541-74158563 CTGAGGAGTGAGGACGTGGAGGG + Intergenic
1056385283 9:86091655-86091677 CTGAGGTGTGAGGATTGCTTAGG - Intronic
1056638180 9:88348418-88348440 CTGAGGTGGGAGGATGGCTTGGG - Intergenic
1057070626 9:92096284-92096306 TAGAGGGGTGAGGATGGGGTGGG - Intronic
1057493980 9:95545142-95545164 CTGAGGTGGGAGGATCTCCTGGG + Intergenic
1059441323 9:114308662-114308684 CAGAGGGGTGAGGCTGGAGTTGG + Intronic
1060962478 9:127690778-127690800 CTGTGGGGTGAGGATGTGTGTGG - Exonic
1061344119 9:130008248-130008270 CTGAGGTGGGAGGATGACCTGGG + Intronic
1062397006 9:136356623-136356645 CTGAGGGGTGAGGTGGGCGCTGG + Intronic
1203706732 Un_KI270742v1:56645-56667 CTGAGGTGTGAGGATCTGATGGG - Intergenic
1186148430 X:6648816-6648838 CTGAGGTGGGAGGATGGCTTGGG - Intergenic
1187712740 X:22070585-22070607 CTGAGGTGAGAGGATGGCTTGGG + Intronic
1187919426 X:24186378-24186400 CTGAGGTGGGAGGATCTCGAGGG + Intronic
1189343511 X:40222587-40222609 CTGAGGTGTGAGGATCACTTGGG + Intergenic
1192143022 X:68661044-68661066 GTGAGGGGTGGGGATGTTGGAGG + Intronic
1192280001 X:69675079-69675101 CTGAGGTGGGAGGATCTCTTGGG - Intronic
1192380554 X:70612034-70612056 CTGAGGTGTGAGGATCACTTGGG + Intronic
1195378435 X:104249814-104249836 TAGAGGGGTGAGGATGGGGTGGG + Intergenic