ID: 1022332618

View in Genome Browser
Species Human (GRCh38)
Location 7:29394661-29394683
Sequence TAGATTAGACAGTAGGGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 149}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022332618_1022332622 -10 Left 1022332618 7:29394661-29394683 CCATGCCCCTACTGTCTAATCTA 0: 1
1: 0
2: 1
3: 11
4: 149
Right 1022332622 7:29394674-29394696 GTCTAATCTATGTTGTAGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022332618 Original CRISPR TAGATTAGACAGTAGGGGCA TGG (reversed) Intronic
901023115 1:6264975-6264997 TAGAGGAGACACTAAGGGCATGG + Intronic
901135289 1:6989040-6989062 TTGATAAGGCAGGAGGGGCAGGG + Intronic
901698225 1:11027067-11027089 TGGCTTAGAAAGTGGGGGCAAGG - Exonic
902075364 1:13780594-13780616 TGGACTCAACAGTAGGGGCAGGG - Exonic
905842281 1:41192131-41192153 TGGATTAGGCAGAATGGGCAGGG - Intronic
906443055 1:45867568-45867590 GAGAGTAGACAGTGGAGGCAAGG + Intronic
906511761 1:46414027-46414049 TAGGTGAGAGAGGAGGGGCACGG - Intergenic
907173192 1:52491367-52491389 TAGATTAGACATTTATGGCATGG - Intronic
907359343 1:53902243-53902265 TATTTTAGACAGGCGGGGCAGGG - Intronic
911414343 1:97552154-97552176 TAGATTTGAAATTAGGCGCAGGG - Intronic
915610342 1:156986827-156986849 TAGAAAAGACAGTAGAGGAACGG + Intronic
915928050 1:160039284-160039306 TAGAATAGACAGCAGGGGAATGG + Exonic
919837238 1:201583270-201583292 GAGAGGAGACAGCAGGGGCAAGG + Intergenic
921545814 1:216473621-216473643 TAGATTACAAAATAGGGGCAAGG + Intergenic
1065477408 10:26155169-26155191 TAGAGTAGACAGATAGGGCAAGG + Intronic
1067572634 10:47383176-47383198 TACATTAGATAGGAGGGCCAAGG - Intronic
1069395830 10:67986649-67986671 TACATTATACAGTATGGGCTGGG - Intronic
1071000543 10:80825958-80825980 TAGACTAGAGTGCAGGGGCATGG - Intergenic
1075198976 10:120386114-120386136 TTGATTAGACAGCATGGTCAAGG + Intergenic
1076242425 10:128918812-128918834 TAGATTAAAGAATAGGGCCAGGG + Intergenic
1078350816 11:10591725-10591747 AAGATTGGAAAGTGGGGGCATGG - Intronic
1078704253 11:13724250-13724272 TTAAATAGACAGTAGGGGCCGGG + Intronic
1079343404 11:19631587-19631609 TAGATGAGAAAGTAGAGGCCAGG - Intronic
1080847490 11:36038897-36038919 AAGTTTAGACAGTAGAGGGAAGG + Intronic
1081981997 11:47272967-47272989 CAGATTAGGCAATTGGGGCATGG + Intronic
1083279057 11:61614167-61614189 GAGAGAAGACAGTAGGGTCAGGG + Intergenic
1087937235 11:104049214-104049236 TAGTTTAGACAACAGGGTCAGGG + Intronic
1090146007 11:124323442-124323464 TAATTTAGAGAGTAGGGGCGTGG - Intergenic
1096185569 12:49578345-49578367 TGTATTAGGCAGCAGGGGCACGG - Intronic
1096796617 12:54081941-54081963 TAGAGAAGACAGTGGGGGGAGGG + Intergenic
1098996780 12:77129702-77129724 TACCTTAGACTTTAGGGGCAGGG - Intergenic
1102614243 12:114139169-114139191 TAGGCTAGACTGTGGGGGCAAGG + Intergenic
1108024149 13:46161230-46161252 GAGATAAGATAGCAGGGGCAGGG - Intronic
1112101646 13:96196423-96196445 TAAATCAGACAGGAGGGGAAAGG + Intronic
1112349002 13:98617309-98617331 TAGATAAGACAGTAGCTCCAAGG + Intergenic
1112837996 13:103539581-103539603 TAGGTTAGACAGAAAGGGGAGGG + Intergenic
1114847485 14:26340799-26340821 TAGATTGCACTGTAAGGGCAAGG + Intergenic
1115426725 14:33269317-33269339 TAGATGAGAAAGCAGAGGCATGG + Intronic
1115795468 14:36930594-36930616 TAGATGATACAGCAGGGGCTGGG - Intronic
1118267451 14:64308307-64308329 TATATTAGAAAATAGGGGCCCGG - Intronic
1118865703 14:69701976-69701998 TAGATTGGAAAGAAGAGGCATGG + Intronic
1118895488 14:69942210-69942232 TAGATCAGCTTGTAGGGGCAGGG + Intronic
1123873838 15:24603759-24603781 AAAAGTAGACAGTAGGGGAAGGG + Intergenic
1124515832 15:30366894-30366916 TAGATTAGACAGCAGTGCCACGG + Intronic
1124727088 15:32163837-32163859 TAGATTAGACAGCAGTGCCACGG - Intronic
1129361714 15:75028649-75028671 TAGATTAGATAGTACAGACAGGG + Intronic
1130111793 15:80971473-80971495 TTGATTAGATATCAGGGGCAGGG - Intronic
1131436366 15:92425852-92425874 TAAATGAGACAGTAGGGGTGTGG + Intronic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1133664932 16:7957724-7957746 TAGATCAAAAAGTAGGGTCAAGG - Intergenic
1134433930 16:14237579-14237601 TTGATTAGACTGTAGGGTCAAGG + Intronic
1138335682 16:56251011-56251033 TAGATTAGACATTTGTGGCTTGG - Intronic
1138359536 16:56415874-56415896 TATATTTTTCAGTAGGGGCAAGG - Intronic
1138745444 16:59357891-59357913 CAGATTTAACAGTAGGGGGAAGG + Intergenic
1138750488 16:59413909-59413931 TAGTTGAGAAAGTAGTGGCAGGG - Intergenic
1140404388 16:74698795-74698817 TAAATTATACAGTGGTGGCATGG + Intronic
1142999511 17:3783437-3783459 AAGATTTGACAGTGGGGGCTAGG - Intronic
1143072794 17:4311605-4311627 TAGATTAGACAATGAGGGAAGGG + Intronic
1148060984 17:44836332-44836354 AAGATTAGAAATTAGGGGCCAGG + Intergenic
1148844978 17:50524546-50524568 CAGATTAGGAAGAAGGGGCAGGG - Intronic
1149702900 17:58670086-58670108 TAGATTTGTCAGGAGAGGCAGGG - Intronic
1155954176 18:31943166-31943188 TAAAGGAGACGGTAGGGGCAAGG + Intronic
1156944290 18:42809239-42809261 CAGATTAAAAAATAGGGGCACGG + Intronic
1157510472 18:48268457-48268479 TTGATTAGACATCAAGGGCAGGG + Intronic
1158432532 18:57402274-57402296 TAGATTAGAAAACAGGGTCATGG - Intergenic
1158990031 18:62858756-62858778 TAGATAATAAAGTAGGGGCAAGG - Intronic
1160511309 18:79455068-79455090 GAGATGAGACAGAAGGCGCAAGG + Intronic
1160788460 19:912399-912421 AAGACCAGAGAGTAGGGGCACGG + Intronic
1165305138 19:34999085-34999107 GAGAACAGACAGTAGGGGCAGGG + Intronic
1165819851 19:38667617-38667639 TAAGTTAGACACTAGGTGCACGG + Intronic
1166614954 19:44235402-44235424 TAGATGCGACAGTTGCGGCAAGG + Exonic
1167392516 19:49205272-49205294 TAGACGTGACAGGAGGGGCATGG - Intronic
926842961 2:17103834-17103856 CAGCTGAGACAGTAGGTGCATGG - Intergenic
929225440 2:39507429-39507451 TAGATGAGAAAATTGGGGCATGG + Intergenic
930993943 2:57693635-57693657 GAGATCAGACAGTAGAGCCAGGG + Intergenic
932160916 2:69458816-69458838 TAGGTTAGACTTTGGGGGCAGGG - Intronic
935550709 2:104450713-104450735 CAGATAAGACGGGAGGGGCAGGG - Intergenic
936586364 2:113761893-113761915 TAGATTAGAAAGTATTGGCTGGG + Intergenic
939010712 2:136842955-136842977 TACATTATTCAGAAGGGGCAAGG - Intronic
939330249 2:140750182-140750204 TAGATGAGGCATTAGGGTCAAGG - Intronic
946226607 2:218267217-218267239 TAGAGTGGACAGAAGGGGGAAGG - Intronic
947677103 2:231992205-231992227 TAGGTGAGACAGTAGGGGAGAGG + Intronic
1171848078 20:30289956-30289978 TAGAGAAGACAGTGGGGGGAGGG + Intergenic
1174213574 20:48899085-48899107 GAGAATAGACTGTCGGGGCAGGG - Intergenic
1175402938 20:58710970-58710992 TGGATCAGAAATTAGGGGCAGGG + Intronic
1178070802 21:28964117-28964139 TAGATGATACAGCAGTGGCAGGG + Intronic
1184487056 22:44786103-44786125 TAGAGTACACAGTGGGTGCATGG + Intronic
949607476 3:5670163-5670185 TAGAACAGACAGTAGAGGCTTGG + Intergenic
949727099 3:7061915-7061937 TAGATAAGAAGTTAGGGGCAGGG - Intronic
953432619 3:42852194-42852216 TAGAATAGACAGAATAGGCAGGG - Intronic
953799249 3:46009274-46009296 GAGAATAGACTGTAGGGGCAAGG + Intergenic
957835882 3:85588822-85588844 TAGATTAGACAGTAGAAGCAAGG + Intronic
958055095 3:88400086-88400108 TAGATTACATATTAGTGGCAAGG + Intergenic
959925421 3:111915846-111915868 TAGGGAAGAAAGTAGGGGCAGGG + Intronic
962827924 3:139113600-139113622 TAGATTGGACAGTGTGGACATGG + Intronic
964317311 3:155458039-155458061 TAGATTAGAAAGTGTGGGTAAGG + Intronic
966677302 3:182603179-182603201 TAGAATAAACATTAGGGACATGG - Intergenic
968891387 4:3371066-3371088 TAGTTTAGAGATGAGGGGCATGG + Intronic
970844575 4:20521371-20521393 GAGATTAGAGAGAAGAGGCAGGG + Intronic
971568107 4:28171277-28171299 GAGATTAAAAAGTAGGAGCAAGG + Intergenic
971844500 4:31901227-31901249 TAGATTTGAAAGTAGAGGTATGG + Intergenic
973896131 4:55414998-55415020 CAGATTAGATAGTAGTTGCAAGG - Intronic
975644906 4:76536584-76536606 CAGATAAGACAACAGGGGCATGG - Intronic
977964480 4:103128053-103128075 TAGATTAGAAAGTAAAGGGATGG + Intronic
981264773 4:142769489-142769511 TAGAGTAGACATTAGGACCATGG + Intronic
981399634 4:144298594-144298616 TAAATTAGAGAGCAGGGGAAAGG + Intergenic
985175382 4:187194806-187194828 TAGAATTGACAGCAGAGGCAAGG + Intergenic
986668325 5:10122042-10122064 AAGATTTGCCAGTAAGGGCAAGG + Intergenic
988223691 5:28383819-28383841 TAGAATAGAAAGGCGGGGCATGG + Intergenic
988773176 5:34451919-34451941 TAGATTGGTCAGAATGGGCAGGG - Intergenic
988782558 5:34536182-34536204 TAATTTAGTCAGTAGGGGAAAGG + Intergenic
989630922 5:43482136-43482158 AACAGTAGACAGTAGGGGCCAGG - Intronic
991513045 5:67401165-67401187 TAGATGAGGCAGTTGAGGCATGG + Intergenic
992452386 5:76885816-76885838 GAGAAAAGACAGTAGAGGCACGG + Intronic
992691634 5:79246437-79246459 TAGATTAGACAGTAAGAGGTAGG + Intronic
995182938 5:109245661-109245683 TAGATGACACAGTGGGGCCAGGG + Intergenic
997024067 5:130037223-130037245 GAAATTAGACAGAAGGAGCATGG + Intronic
999152881 5:149438157-149438179 AAGATTTGACAGAAGGGGCCAGG - Intergenic
1008825935 6:55693935-55693957 TAGATTAGACTGTAAAGGCTGGG - Intergenic
1009518467 6:64651404-64651426 TAGATTAGAGAGTAGATTCATGG + Intronic
1010743590 6:79536744-79536766 AAGACTAGAGAGGAGGGGCAGGG - Intronic
1011749770 6:90443324-90443346 TAGATAAGAAACTAGAGGCAAGG + Intergenic
1016878817 6:148889876-148889898 AAGACCAGACTGTAGGGGCAGGG - Intronic
1017964930 6:159255977-159255999 GTGATTAGACAGTGAGGGCAAGG + Intronic
1019174621 6:170153884-170153906 TAGACAAGCCAGTAGGGGCCAGG + Intergenic
1020816107 7:12908032-12908054 AAGATTAGAAAGGAGGGCCAGGG + Intergenic
1021401921 7:20219398-20219420 TAGATTAGATAATAGGAGAAGGG - Intergenic
1021466541 7:20950502-20950524 TAGATGAGACAGTCTAGGCAGGG + Intergenic
1022332618 7:29394661-29394683 TAGATTAGACAGTAGGGGCATGG - Intronic
1027266290 7:76496874-76496896 CAGATCAGCCAGGAGGGGCATGG + Intronic
1027317670 7:76994992-76995014 CAGATCAGCCAGGAGGGGCATGG + Intergenic
1027809310 7:82873501-82873523 TGCATTACACAGTAGGCGCAAGG - Intronic
1030913120 7:115277560-115277582 TAAGTTAGACAGGAGGGGAAGGG + Intergenic
1033299072 7:140170350-140170372 TAGGTGAGACAGTTGAGGCAGGG - Intronic
1037722993 8:21460359-21460381 GAGATTTGGCAGAAGGGGCAGGG - Intergenic
1037915797 8:22772729-22772751 TAGAGGAGACAGTAGGGCCTGGG - Intronic
1038394272 8:27235551-27235573 TAGATTAGAAAATACGAGCAAGG - Exonic
1041967190 8:63692614-63692636 GAAATAAGACAGTAGGGGTAGGG - Intergenic
1042461013 8:69068667-69068689 TAGATATCACAGCAGGGGCATGG - Intergenic
1044762250 8:95533271-95533293 TAGATTAAAGAGGAGGGGCACGG + Intergenic
1046257197 8:111716459-111716481 AACATGAGACAGTAGGGGAATGG + Intergenic
1048198378 8:132351420-132351442 GAAATTAGAGAGTTGGGGCAGGG - Intronic
1048340952 8:133538005-133538027 CACATGAGACAATAGGGGCAGGG + Intronic
1052487897 9:29126662-29126684 TAGCTTAGACAATATGGGAAAGG + Intergenic
1053543578 9:38999390-38999412 TAGACTAGACAGGAGAGACAGGG - Intergenic
1053808010 9:41822895-41822917 TAGACTAGACAGGAGAGACAGGG - Intergenic
1054622582 9:67364533-67364555 TAGACTAGACAGGAGAGACAGGG + Intergenic
1058272996 9:102998585-102998607 TTGCATAGTCAGTAGGGGCAAGG + Intronic
1058874151 9:109227873-109227895 AAAATTAGACAATAGGGGCCAGG - Intronic
1059073671 9:111166534-111166556 AAGCTTAGACTGTGGGGGCAGGG - Intergenic
1059949988 9:119452470-119452492 GAGAATAGACTGCAGGGGCAAGG + Intergenic
1060783901 9:126433868-126433890 GAGTTAAGACAGTAGTGGCAGGG + Intronic
1185682625 X:1900881-1900903 TAAATAAGCCAATAGGGGCAGGG - Intergenic
1187330904 X:18338615-18338637 TAGGTTAGACAGGAGGGGCTGGG + Intronic
1188638466 X:32466414-32466436 TAAATTAAACAGTATGGGAAAGG - Intronic
1193046358 X:77059091-77059113 TAGTTAAGACAATAGGGGAAAGG + Intergenic
1193654602 X:84184324-84184346 TAGTTCAGACTTTAGGGGCATGG + Intronic
1195732419 X:107980729-107980751 AAGATTGGACAGTAGGGGGGCGG - Intergenic
1199904266 X:152208435-152208457 GACAGTAGACAGTAGGGGCAGGG + Intronic
1201104552 Y:10753763-10753785 TAGAATAGACTGTAGAGGAATGG - Intergenic
1202297023 Y:23369795-23369817 TAGAGTAGACAGTAGGATAAGGG + Intergenic
1202573784 Y:26300802-26300824 TAGAGTAGACAGTAGGATAAGGG - Intergenic