ID: 1022335087

View in Genome Browser
Species Human (GRCh38)
Location 7:29414668-29414690
Sequence ACGTGTGCATGCGTGTGTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 505
Summary {0: 1, 1: 0, 2: 4, 3: 69, 4: 431}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022335087_1022335093 21 Left 1022335087 7:29414668-29414690 CCCCAACACACGCATGCACACGT 0: 1
1: 0
2: 4
3: 69
4: 431
Right 1022335093 7:29414712-29414734 TCTCCCTAGCTGTGTCCAAGAGG 0: 1
1: 0
2: 1
3: 9
4: 168
1022335087_1022335096 25 Left 1022335087 7:29414668-29414690 CCCCAACACACGCATGCACACGT 0: 1
1: 0
2: 4
3: 69
4: 431
Right 1022335096 7:29414716-29414738 CCTAGCTGTGTCCAAGAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022335087 Original CRISPR ACGTGTGCATGCGTGTGTTG GGG (reversed) Intronic
900187884 1:1341044-1341066 AGGTGTGCATGTGTGTGCAGGGG - Intronic
900215585 1:1479875-1479897 GCGTGTGCATGCCCGTGTGGGGG - Intronic
900295258 1:1945927-1945949 ATGTGTGCACGTGTGTGTGGGGG + Intronic
900563698 1:3321790-3321812 AAGTGTGCGTGCGTGTGTGTAGG + Intronic
900581096 1:3409881-3409903 TTGTGTGCATGTGTGTGGTGTGG + Intronic
900952983 1:5868529-5868551 ATGAGTGCATGCGTGTGTGTGGG - Intronic
901777716 1:11571713-11571735 AGGTGTGCATGCGTTTGTATGGG - Intergenic
901777718 1:11571733-11571755 AAGTGTGCATGTGTGTGTGCAGG - Intergenic
901897367 1:12325593-12325615 ATGTGTGCATGTGTGTGTGTTGG - Intronic
902074955 1:13777067-13777089 CTGTGTGCATGTGCGTGTTGTGG - Intronic
902987565 1:20164420-20164442 GCGTGTGCATGTGTGTGTTTAGG + Intronic
903283929 1:22265614-22265636 AAGTGTGCATGTGTGTGCAGGGG - Intergenic
906757315 1:48330647-48330669 ACGTTTGCCTGAATGTGTTGAGG + Intronic
906786441 1:48619994-48620016 ATGTGTGCATGTGTGTTTTGGGG - Intronic
906875715 1:49536376-49536398 TCATGTGCATGTGTGTGTTGGGG + Intronic
908432107 1:64069542-64069564 ACGTGTTCATGTGTGTGATTGGG + Intronic
909436828 1:75651832-75651854 ACGTGTGCGTGTGTGTGTGTGGG - Intergenic
910227227 1:84948119-84948141 AGGTGTGCATGGTTGTGGTGGGG - Intronic
910703415 1:90101445-90101467 ATGCGTGCATGTGTGTGTGGTGG + Intergenic
911102400 1:94104942-94104964 GTGTGTGTGTGCGTGTGTTGGGG - Intronic
912494230 1:110081114-110081136 ACATGTGTTTGTGTGTGTTGGGG + Intergenic
915589774 1:156864147-156864169 ACATGTGCATGTGTGACTTGAGG + Intronic
915609790 1:156982520-156982542 CTGTGTGCATGTGTGTGTTGGGG - Intronic
916096977 1:161360111-161360133 ATGTGTGTATGTGTGTGTTAAGG + Intronic
916561884 1:165940678-165940700 ATGTGTCCATGTGTGTGATGGGG - Intergenic
916945493 1:169722147-169722169 GTGTGTGCGTGTGTGTGTTGGGG + Intronic
917081564 1:171261306-171261328 GTGTGTGCCTGTGTGTGTTGGGG - Intronic
917201258 1:172517887-172517909 ACGTACGCATGTGTGTGTTTTGG + Intergenic
917257190 1:173128424-173128446 ATGTGTGTGTGTGTGTGTTGTGG - Intergenic
918048346 1:180954407-180954429 ACGCGTGCGCGCGTGTGCTGGGG - Intergenic
918272842 1:182919965-182919987 AAGTGTGCATGCATGTGTGCTGG - Intronic
919163200 1:193858620-193858642 ACGTTTGCAGGCCTTTGTTGGGG - Intergenic
919780143 1:201216231-201216253 CTGGGTGCATGTGTGTGTTGGGG + Intronic
920668118 1:207981525-207981547 GTGTGTGCATGTGTGTGTAGAGG + Intergenic
920669458 1:207991948-207991970 ACGTGTGTGTGTGTGTGTTGGGG - Intergenic
920841237 1:209555724-209555746 ATGTGTGGATGTGTGTGTTTTGG + Intergenic
921939264 1:220823271-220823293 GTGTGTGCATGCATGTGTGGGGG + Intergenic
922746406 1:228046746-228046768 ATGTGTGCTTGTGTGTGGTGGGG + Intronic
923377949 1:233384711-233384733 GTGTTTGCATGTGTGTGTTGGGG + Exonic
924168141 1:241306718-241306740 ACGTGTGCATAAGTGTGTGAGGG - Intronic
924598055 1:245464455-245464477 ATGTGTGCGTGCGCGTGTGGGGG + Intronic
1062794861 10:337095-337117 GTGTGTGCGTGTGTGTGTTGTGG + Intronic
1063033374 10:2258943-2258965 ATGTGTGCCTGTGTGTGTTGGGG - Intergenic
1063057423 10:2521064-2521086 AGGTGTGGATGTGGGTGTTGGGG - Intergenic
1063067148 10:2621682-2621704 ACGTGTGAGTGTGTGTGTTTGGG - Intergenic
1064087378 10:12355486-12355508 GCGTGTGTATGTGTGTGTGGTGG + Intronic
1065121698 10:22536963-22536985 ATGTGTGTGTGTGTGTGTTGGGG - Exonic
1065681543 10:28238935-28238957 TGTTCTGCATGCGTGTGTTGAGG + Intronic
1065816975 10:29491342-29491364 ACGTGTGCATGGGCGTGGTAGGG - Intronic
1066467846 10:35669178-35669200 GCGTGTGCGTGCGTGTGTGTAGG + Intergenic
1066478447 10:35771321-35771343 GCGTGTGTGTGTGTGTGTTGGGG + Intergenic
1066628102 10:37430381-37430403 GTGTGTGCATGCGTGTGTGCAGG + Intergenic
1067185098 10:44020708-44020730 GCCTGTGGATGCCTGTGTTGAGG - Intergenic
1068461758 10:57338534-57338556 ACGTGTGTGTGTGTGTGTTGTGG + Intergenic
1069128816 10:64672805-64672827 ATGTGTGTATGTGTGTGTTTGGG - Intergenic
1069953318 10:72034478-72034500 ACACGTGCATGTGTGTGTGGAGG - Intergenic
1070312024 10:75280914-75280936 ATGTGTGCATGAGGGTGATGTGG + Intergenic
1070676174 10:78413146-78413168 GCGTGCACATGTGTGTGTTGGGG + Intergenic
1071239305 10:83686742-83686764 ATGTGTGTATGTGTGTGTGGGGG + Intergenic
1071802705 10:89082124-89082146 ATGTGTACATGCATTTGTTGGGG - Intergenic
1071849541 10:89554646-89554668 ACATATGTATGTGTGTGTTGTGG + Intronic
1072775177 10:98184057-98184079 ACGTGTGTGTGTGTGTGTGGTGG + Intronic
1073352032 10:102826846-102826868 AAGAGTGCATATGTGTGTTGGGG - Intergenic
1073403781 10:103278865-103278887 TCGTGTGTGTGTGTGTGTTGGGG - Intronic
1073488413 10:103836639-103836661 GTGTGTGCACTCGTGTGTTGGGG - Intronic
1073793003 10:106958695-106958717 ACGTGAGCATGTGTGAGGTGCGG + Intronic
1073947475 10:108767630-108767652 AAGTCTGTGTGCGTGTGTTGGGG + Intergenic
1074163838 10:110857789-110857811 ACGTGTGCGTGTGTGTGTTCAGG - Intergenic
1074227484 10:111499936-111499958 ATGTGTGCATGTGTGTGTGGGGG + Intergenic
1074509087 10:114096900-114096922 ATGTGTGTGTGCATGTGTTGGGG + Intergenic
1074869177 10:117563735-117563757 AGGTGTGTGTGTGTGTGTTGGGG + Intergenic
1075098657 10:119490377-119490399 TCGTGTGCATGTGTGTGCGGGGG + Intergenic
1075654860 10:124154498-124154520 GAGTGTGCATGTGTGTGTGGGGG - Intergenic
1075654870 10:124154554-124154576 GTGTGGGCATGCGTGTGTGGGGG - Intergenic
1075654938 10:124155074-124155096 GAGTGTGCATGCATGTGTGGGGG - Intergenic
1077694656 11:4383439-4383461 ACGTGTCTGTGTGTGTGTTGGGG + Intergenic
1077806873 11:5599307-5599329 AAGTGTGCATGTGTTTGTTGGGG + Intronic
1078918586 11:15804947-15804969 GTATGTGCATGTGTGTGTTGGGG - Intergenic
1081913070 11:46712974-46712996 ACGTGTTCAGGAGTGGGTTGGGG + Intergenic
1082223693 11:49674942-49674964 GTGTGTGCATGAGTGTGTTTGGG - Intergenic
1083013948 11:59432127-59432149 ATGTGTGTGTGTGTGTGTTGGGG - Intergenic
1083185231 11:61013796-61013818 ACATGTGCCTGCAAGTGTTGGGG + Intronic
1084343541 11:68526588-68526610 ACGTGTGCATGCTGGAGGTGAGG - Intronic
1084445529 11:69201483-69201505 ATGTGTGCATACGTGTTTGGCGG + Intergenic
1084477935 11:69399388-69399410 ATGTGTGCATGTGTGTGTAGGGG + Intergenic
1085273843 11:75285759-75285781 CAGGGTGCCTGCGTGTGTTGGGG + Intronic
1085926178 11:81024662-81024684 TTGTGTGCATGCGTGTGGTGGGG + Intergenic
1085954489 11:81375046-81375068 ATGTGTGCTTGCGTGTGTGTGGG + Intergenic
1086625361 11:88944320-88944342 GTGTGTGCATGAGTGTGTTTGGG + Intronic
1086806316 11:91247249-91247271 ACGTTTGCATGTGTGTGTGGAGG + Intergenic
1087383665 11:97441265-97441287 ATGTGTGCATGTGTGTGTAAGGG - Intergenic
1088021111 11:105120672-105120694 GTGTGTGTATGTGTGTGTTGGGG - Intergenic
1088683089 11:112261163-112261185 ACTTCTGCATGTGTGTTTTGGGG - Intronic
1089481078 11:118805686-118805708 TAGTGTGTATGTGTGTGTTGGGG + Intergenic
1090165391 11:124541447-124541469 ACGTGTGTGTGTGTGTGTGGTGG - Intergenic
1090857627 11:130624091-130624113 ATGTGTGTATGTGTGCGTTGAGG + Intergenic
1091186141 11:133649569-133649591 ACGTGTGCTTGCCTGTGCTGCGG - Intergenic
1091215943 11:133901963-133901985 TGGTGTGCATGTGTGTGATGCGG - Intergenic
1091516720 12:1191292-1191314 ATGTGTACATGTGTGTGTTGTGG - Intronic
1091710856 12:2739274-2739296 ATGTGTGTATGCGTGTGTGCAGG + Intergenic
1091713775 12:2761535-2761557 GTGTGTGCATGTGTGTGTTGGGG - Intergenic
1092120117 12:6037886-6037908 ATGTGAGCATGTGTGTGTTGGGG + Intronic
1092937076 12:13374092-13374114 GTGTGTGCATGTGTGTGTTGGGG + Intronic
1093342204 12:17991835-17991857 ATGTTTACATGCGTGTGTTGGGG + Intergenic
1093765902 12:22962287-22962309 ATGTTTGCATGTGAGTGTTGGGG + Intergenic
1094123864 12:27002041-27002063 ACGTGTGTGCGTGTGTGTTGTGG - Intronic
1094139183 12:27163151-27163173 ACTTGTGAATGGGAGTGTTGTGG + Intergenic
1094226578 12:28052981-28053003 ATGTGTGTTTGCGTGTGTAGGGG + Intergenic
1096422033 12:51466969-51466991 ATGTGTGTATGTGTGTGTAGGGG + Intronic
1097053733 12:56238307-56238329 CTGTGTGCAGGTGTGTGTTGGGG - Exonic
1097179272 12:57162023-57162045 ATGTGTGCGTGTGTGTGTTTGGG + Intronic
1097420410 12:59371639-59371661 ACGTGTGTGTGTGTGTGTGGCGG + Intergenic
1097720409 12:63013790-63013812 ATGTGTGCATGTGTGTGTGTTGG - Intergenic
1097996199 12:65890607-65890629 ACGTGTGCATGGGGGTTGTGAGG - Intronic
1098768566 12:74522061-74522083 ATGTGTGTGTGCGTGTGTGGGGG + Intergenic
1101231874 12:102749619-102749641 ATGTGTGTGTGTGTGTGTTGTGG - Intergenic
1101726387 12:107391845-107391867 GCGTGTGTATGTGTGTGATGGGG + Intronic
1101769885 12:107739601-107739623 ATGTGTGCCTGTGTGTCTTGGGG - Intronic
1101845984 12:108363376-108363398 ATGTGTGCATATGTGTGGTGTGG + Intergenic
1102044079 12:109818795-109818817 GTGTGTGCATGTGTGTTTTGGGG - Intronic
1102520284 12:113473800-113473822 ATTTGTGGATGCCTGTGTTGGGG + Intergenic
1103425607 12:120830607-120830629 AGGTGTACATGCATATGTTGGGG + Intronic
1104045570 12:125160286-125160308 CCGTGTGTGTGTGTGTGTTGGGG + Intergenic
1104086083 12:125475154-125475176 AAGTGTGTGTGTGTGTGTTGGGG + Intronic
1104090802 12:125515967-125515989 ATGTGTGCATGTGTGTGTGTCGG - Intronic
1104557883 12:129818415-129818437 AAGTGTGTATGTGTGTGGTGGGG + Intronic
1104916545 12:132268264-132268286 GTGTGTGCGTGCGTGTGTAGGGG - Intronic
1106245944 13:27950278-27950300 ACGTGTGTATTTGTGTTTTGGGG + Intergenic
1106498054 13:30299976-30299998 ATGTGTGTGTGTGTGTGTTGTGG - Intronic
1107216628 13:37928362-37928384 ACATGTGGATGCGTGTACTGGGG + Intergenic
1108476367 13:50822023-50822045 ACATGTGCATGAGTGTGTGTAGG - Intronic
1110205543 13:72908691-72908713 AGTTGTGCATGTGTGTGTGGGGG - Intronic
1110749880 13:79100878-79100900 ACTTGTGTATCTGTGTGTTGAGG - Intergenic
1112280310 13:98057032-98057054 AGGTGTGCATGTGTGTGTGCAGG + Intergenic
1113800204 13:113082555-113082577 ACGGGTGCGTGCCTGTGTCGGGG - Intronic
1113993251 14:16045469-16045491 CAGTGTGTATGCGTGGGTTGCGG - Intergenic
1116805832 14:49493310-49493332 ACTTGTGTCTGTGTGTGTTGGGG - Intergenic
1119756339 14:77122633-77122655 TAGTGTGCTTGGGTGTGTTGGGG - Intronic
1120653819 14:87165780-87165802 GTGTGTGTATGTGTGTGTTGGGG - Intergenic
1122792408 14:104189828-104189850 CCGTGTGCATGCGTGTGTGCGGG - Intergenic
1124174155 15:27406513-27406535 ACATGTGCATGAGTGTTTTAGGG - Intronic
1126284071 15:46991223-46991245 ATGTGTGCATGTGTGTTTAGAGG + Intergenic
1126419531 15:48456866-48456888 GTGTGTGCGTGCATGTGTTGGGG + Intronic
1126469323 15:48990832-48990854 ATGTGTGCATGTGTGTGAGGGGG + Exonic
1127488350 15:59439390-59439412 ATGTGTGTGTGTGTGTGTTGGGG + Intronic
1127526399 15:59796438-59796460 GTGTGTGCATGTGTGTGTTGGGG - Intergenic
1127629102 15:60809619-60809641 AAATGTGCATGTGTGTGGTGGGG - Intronic
1127742488 15:61925190-61925212 CTATTTGCATGCGTGTGTTGTGG - Intronic
1128078474 15:64842442-64842464 GTGTGTGTATGTGTGTGTTGGGG + Intronic
1128078483 15:64842501-64842523 GTGTGTGTATGTGTGTGTTGGGG + Intronic
1128582294 15:68818615-68818637 ACGAGTGTGTGTGTGTGTTGGGG - Intronic
1128602536 15:69009960-69009982 ATGCGTGCATGTGTGTGTGGAGG + Intronic
1130979994 15:88805827-88805849 AGGTGTGCCTGGGTGTGTGGAGG - Intronic
1130995955 15:88904338-88904360 ACGTGTGCATGTGTGTGGGTGGG - Intronic
1131053104 15:89360808-89360830 ATGTGTGCGTGTGTGTGTTGTGG - Intergenic
1131126042 15:89857917-89857939 ACCTGGGCATGTGTGTGTTCCGG - Intronic
1131600991 15:93848596-93848618 ATGTGTATATGTGTGTGTTGGGG + Intergenic
1132851719 16:2027730-2027752 ACGTGTGCCTGTGTGTGTGCAGG + Intronic
1135031935 16:19045468-19045490 GTGTGTGCATGTGTGTGGTGGGG - Intronic
1136653485 16:31693741-31693763 GTGTGTGCATGTGTGTGCTGTGG - Intergenic
1138959693 16:62014199-62014221 AGGTGAGCATGTGTGTGTTTAGG + Intronic
1140477916 16:75248261-75248283 GCGGGTGCATGTGTGCGTTGGGG - Intronic
1140790126 16:78383651-78383673 ATGTGTTTATGTGTGTGTTGGGG - Intronic
1141492504 16:84383743-84383765 GTGTGTGTATGTGTGTGTTGGGG + Intronic
1141928870 16:87187164-87187186 ATGTGTGCATGTGTGTGGAGGGG + Intronic
1141983434 16:87564046-87564068 ATTTGTGTGTGCGTGTGTTGGGG + Intergenic
1141983444 16:87564208-87564230 CTGTGTGCGTGCTTGTGTTGGGG + Intergenic
1142483584 17:233143-233165 ACGTGTGCGTGTGTGTGCAGAGG + Intronic
1142518402 17:489061-489083 AGGTGTGTGTGTGTGTGTTGGGG + Intergenic
1142591562 17:1008436-1008458 CCGTGTGCGCGCGTGTGGTGAGG - Intronic
1143167404 17:4903789-4903811 ATGTGTGCACGTGTGTGTTTAGG - Intergenic
1143476015 17:7204404-7204426 GCGTGTGCGTGTGTGTGATGTGG - Intronic
1143835267 17:9686951-9686973 GCATGTGCATGCGTGTGTGTGGG + Intronic
1144126693 17:12209461-12209483 ACGTGGGCAAGCGGGTGGTGAGG + Intergenic
1144321189 17:14121926-14121948 ACATGTGCATGTGTGTGGTGTGG + Intronic
1146272290 17:31492347-31492369 ACGTGTGTTTGCGTGTCATGCGG + Intronic
1146274900 17:31510356-31510378 AGGTGTGCATGTGTGCGGTGGGG - Intronic
1146604716 17:34248247-34248269 ATGTGTGTATGTGTCTGTTGGGG - Intergenic
1146624196 17:34423642-34423664 ACGTGTGCATGTGTCTGTTGTGG + Intergenic
1147276548 17:39322221-39322243 ATGTGTGCATATGTGTTTTGTGG + Intronic
1147585525 17:41652134-41652156 GTGTGTGCATGCGTGTGTGTTGG - Intergenic
1148550256 17:48545987-48546009 GTGTGTGCATGAGTGTGGTGGGG + Intergenic
1148784453 17:50139212-50139234 GTGCGTGCATGTGTGTGTTGAGG - Intronic
1149001875 17:51765729-51765751 GTGTGTGCATGCATGTGTTTAGG + Intronic
1149051895 17:52314887-52314909 GAGTGTGTATGTGTGTGTTGAGG - Intergenic
1149297901 17:55277289-55277311 ACGTGGGCATGCGTGCATTTGGG + Intronic
1149405350 17:56344389-56344411 AGCTCTGCATGTGTGTGTTGGGG + Intronic
1151227005 17:72655212-72655234 GCGTGTGCACGGGTGTGTGGAGG - Intronic
1151388493 17:73770119-73770141 CCCTGTGCCTGCGTGTGCTGGGG - Intergenic
1152089428 17:78238616-78238638 GCATGTGCATGTGTGTGCTGGGG + Intronic
1152245726 17:79183717-79183739 GCGTGTGCGCGCGTGTGTAGCGG + Intronic
1152747342 17:82047433-82047455 ACTTGTGCGTGGGTGTGTGGAGG - Intergenic
1153769054 18:8400876-8400898 ATGTGTGTGTGCATGTGTTGGGG + Intronic
1154059734 18:11047962-11047984 ACCTGAGCATGCGTGTGTGCAGG - Intronic
1154350797 18:13581901-13581923 ATGTGTGCATGTGTGTGGTAAGG + Intronic
1155116571 18:22774150-22774172 GCGTGTGCGTGTGTGTGTGGGGG + Intergenic
1155517028 18:26634409-26634431 ATATATGCATGTGTGTGTTGTGG + Intronic
1155743624 18:29322438-29322460 ATGTGTGCATGTGTGTGTTTAGG + Intergenic
1157421669 18:47552991-47553013 GTGTGTGCATGTGTGTATTGAGG + Intergenic
1158120006 18:54038436-54038458 GCGTGTGCATGTGTGTGTGTGGG - Intergenic
1159274002 18:66192157-66192179 ATGTGTGCATGCGTGTGGAGAGG - Intergenic
1160170058 18:76545340-76545362 ACGGGTGCAAGTGTGTGTAGGGG + Intergenic
1160404551 18:78636675-78636697 GAGTGTGCATGGGTGTGTAGAGG + Intergenic
1160429123 18:78799421-78799443 GCGTGTGCTTGCATGTGTAGTGG - Intergenic
1160557728 18:79736793-79736815 ACGTGCACAGGCGTGTGGTGGGG + Intronic
1161094424 19:2381362-2381384 GCGTGTGTGTGTGTGTGTTGGGG + Intergenic
1161306036 19:3568795-3568817 ACGTGTGTAGGCATGTGCTGTGG + Intronic
1161422672 19:4184437-4184459 ACGAGTGCATGTGTGTGTCAGGG - Intronic
1161890190 19:7030344-7030366 ACGTGTGTATGTGTGTGTGGCGG - Intergenic
1161891259 19:7040390-7040412 ACGTGTGTATGTGTGTGTGGCGG + Intergenic
1161893344 19:7058851-7058873 ACGTGTGTATGTGTGTGTGGCGG + Intergenic
1161967683 19:7557325-7557347 GCGTGTGCGTGTGTGTGGTGCGG - Intronic
1162753441 19:12842945-12842967 ACGTGTGGGTGTCTGTGTTGAGG + Intronic
1163126600 19:15247564-15247586 GCGCGTGCGTGCGTGTGTCGGGG + Intronic
1163578049 19:18122107-18122129 ACCTGTCCATGCGTGGGATGTGG - Intronic
1164716498 19:30394464-30394486 ACCTGGGTATGTGTGTGTTGTGG - Intronic
1165153743 19:33775310-33775332 GCGTCTGCATGTGTGTGTCGGGG + Intergenic
1165159237 19:33806104-33806126 GTGTGTGTATGCCTGTGTTGTGG + Intronic
1165411545 19:35665501-35665523 TCTGGTCCATGCGTGTGTTGGGG + Intergenic
1165898679 19:39158247-39158269 GTGTGAGCATGCATGTGTTGCGG + Intronic
1165984614 19:39757197-39757219 GTGTGTGCCTGTGTGTGTTGGGG + Intergenic
1167033512 19:46979001-46979023 ACGTGTGTGTGTGTGTGGTGGGG + Intronic
1167103465 19:47417920-47417942 GTGTGTGCATGTGTGTGTGGGGG - Intronic
1168311447 19:55463035-55463057 CTGTGTGCATGTGTGTGTTTTGG - Intergenic
1168353976 19:55691035-55691057 ATGTGTGCATGAGTATGTTGGGG + Intronic
924991806 2:318921-318943 ACGTGTGCAGGCGTGCGTGCAGG + Intergenic
925319678 2:2952454-2952476 GTGTGTGCATGTGCGTGTTGGGG - Intergenic
925337741 2:3110317-3110339 ATGTGTGCATGCATGTCATGTGG + Intergenic
925406954 2:3612243-3612265 ATGTGTGCATGCGTGTGCGTGGG - Intronic
925462033 2:4072006-4072028 AAGTGTGCATGTGTGTGTGGTGG + Intergenic
925465888 2:4107070-4107092 GCGCGTGCATGTGTGTGTAGGGG + Intergenic
925571215 2:5314740-5314762 TCGTGTGCATATGTGTGGTGGGG + Intergenic
925724788 2:6862461-6862483 ATGTGTGGATGCTTGTGTTGAGG + Intronic
925753349 2:7109695-7109717 ATGTGTGTGTGTGTGTGTTGGGG + Intergenic
925817554 2:7768447-7768469 TGGTGTGCATGGGTGTGGTGTGG - Intergenic
925974343 2:9130775-9130797 ATGTGTGCATGCGTGTGTGTGGG + Intergenic
926084681 2:10013024-10013046 ACGTGGGCAGGCGTGCGTTTGGG + Intergenic
926152659 2:10433557-10433579 ATGTGTACATGTGTGTGTTGTGG + Intergenic
926589985 2:14730265-14730287 ACATGTGCATGTGTGTGTGTTGG + Intergenic
926642593 2:15253381-15253403 ATGTGTGTATGCGTGTGCTTAGG + Intronic
927472564 2:23386425-23386447 AAGTGTGCGTGTGTGTGTCGGGG - Intronic
927477424 2:23424278-23424300 ACGTGTGCATGTGTGTGCGTGGG + Intronic
928613161 2:33010362-33010384 AAGAGTGCATGGGTGTGTGGGGG + Intronic
929678930 2:43968869-43968891 CTGTGTGCATGAGTGTGGTGAGG - Intronic
930351787 2:50265758-50265780 AAGTGTGAATGAGTGTGGTGAGG - Intronic
931457807 2:62425880-62425902 ATATGTGCATGTGTGTGGTGAGG - Intergenic
931963666 2:67509062-67509084 ATGTCTCCATGTGTGTGTTGTGG + Intergenic
932099191 2:68881039-68881061 GTGTGTGCCTGTGTGTGTTGGGG - Intergenic
932111729 2:69008083-69008105 GCGTGAGTATGTGTGTGTTGTGG - Intergenic
932507704 2:72252291-72252313 ACGTGTGTGTGTGTGTGTTTGGG + Intronic
932953965 2:76329612-76329634 ACGTGTGGATGTTTGAGTTGTGG + Intergenic
934032525 2:88061161-88061183 GTGTGTGTATGTGTGTGTTGGGG + Intergenic
934032531 2:88061199-88061221 GTGTGTGTATGTGTGTGTTGGGG + Intergenic
934987919 2:98900611-98900633 GCGTGTGCATGCGTGCGTGCAGG + Intronic
935842978 2:107133628-107133650 GTGTGTACATGTGTGTGTTGGGG + Intergenic
936075672 2:109400199-109400221 ATGTGTGCAAGTGTGTGTAGGGG - Intronic
937034867 2:118772632-118772654 ACATGTGCCTGTGTGTTTTGAGG + Intergenic
937087776 2:119182608-119182630 GCGTGTGTAAGTGTGTGTTGGGG - Intergenic
937601974 2:123748473-123748495 AAGAGTGCATGTGTGAGTTGGGG + Intergenic
938119648 2:128624585-128624607 ATATGTGCATGCGTGTGGTGTGG - Intergenic
942022169 2:171876678-171876700 AAGTGTGTATGTGTGTGTGGGGG - Intronic
942374065 2:175317941-175317963 GCATGTGCATGTGTGTGCTGAGG + Intergenic
942865439 2:180668011-180668033 GTGTGTGCATGTGTGTGTTATGG + Intergenic
943804678 2:192109753-192109775 ATGTGTGCATGCCTGTGTGTAGG + Intronic
946865900 2:224040280-224040302 GAGTGTGCACGTGTGTGTTGGGG + Intergenic
947000693 2:225452780-225452802 ACGTGTGCATGTGTGTGGTGGGG - Intronic
947099019 2:226598979-226599001 GCATGTGCATGTGTGTGTAGAGG + Intergenic
947693133 2:232158329-232158351 GTGTGTGCATGTGTGTGTTCGGG + Intronic
948304739 2:236938265-236938287 GTGTGTGCATGTGTGTGGTGTGG + Intergenic
948563954 2:238871676-238871698 TCGTGTGTGTGTGTGTGTTGGGG - Intronic
948810029 2:240469935-240469957 ACATGTGCATGCATGTGTATGGG - Intergenic
1168742678 20:206688-206710 AGGTGTGTATGTGTGTGTTCAGG + Intergenic
1169466150 20:5841378-5841400 TTGTGTGCATGGGTGTTTTGGGG + Intronic
1171109985 20:22471910-22471932 ATGTGTGCACGGGTGTGCTGTGG - Intergenic
1171428992 20:25067432-25067454 ATGTGTGAATGTGTGTGGTGTGG - Intergenic
1172739352 20:37153481-37153503 TTTTGTGCATGAGTGTGTTGGGG - Intronic
1173159730 20:40643486-40643508 ACATATGTATGTGTGTGTTGGGG - Intergenic
1173585918 20:44183010-44183032 GCGTGTGTATGTGTGTGTTTTGG - Intronic
1173969379 20:47139853-47139875 AAGTTTGCATGTGTGTGTTGGGG - Intronic
1173969605 20:47141975-47141997 ACGTTTGCATATGTGTGATGGGG - Intronic
1174106201 20:48164107-48164129 ACGTGTGTGTGCTTGTGTAGGGG - Intergenic
1174742222 20:53026114-53026136 ACGTGTGTATGTGTGTGTGTTGG - Intronic
1175002390 20:55643243-55643265 ATGTGTGAATGTGTGAGTTGGGG - Intergenic
1175720462 20:61283379-61283401 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720463 20:61283418-61283440 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720464 20:61283457-61283479 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175876018 20:62230398-62230420 GTGTGTGTATGGGTGTGTTGAGG - Intergenic
1175995902 20:62812248-62812270 ACTTGAGGATGCGTGTGATGCGG - Exonic
1176064191 20:63186392-63186414 ACCTGTGCATTTGTGTGTGGGGG + Intergenic
1177098715 21:16872497-16872519 ATGTGTGCATGTTTGTGTTTGGG - Intergenic
1179409411 21:41150880-41150902 ATGTGTGCTTGTGTGTGTGGAGG + Intergenic
1180281800 22:10705252-10705274 ACGTGTGTGTGTGTGTTTTGGGG + Intergenic
1180314017 22:11262044-11262066 CAGTGTGTATGCGTGGGTTGCGG + Intergenic
1181393894 22:22604430-22604452 AGGAGTGTATGCATGTGTTGGGG + Intergenic
1181746312 22:24957179-24957201 GTGTGTGCCTGTGTGTGTTGGGG + Intronic
1181911262 22:26240041-26240063 ATGTGTGTATGTGTGTGTTGAGG - Intronic
1182006956 22:26968944-26968966 ACTTGGGCATGCCTGTGTTGTGG + Intergenic
1182790603 22:32949541-32949563 ACGCATGCATGCGTGTGTGTGGG - Intronic
1182880628 22:33730002-33730024 ATGCGTGCGTGTGTGTGTTGAGG + Intronic
1182966899 22:34530562-34530584 GTGTGTGCATGTGTGTGTTTGGG + Intergenic
1183062168 22:35342903-35342925 ACGTGTGGAGGTGTGTGTGGTGG - Intronic
1183343673 22:37295363-37295385 GTGTGTGCATGTGTGTGGTGGGG - Intronic
1183700952 22:39450670-39450692 ACGTGCACATGCGTGTTTTGGGG - Intergenic
1184265676 22:43344493-43344515 GTGTGTGCGTGTGTGTGTTGGGG - Intergenic
1184288469 22:43485661-43485683 TAGTGTGCACACGTGTGTTGAGG - Intronic
1184523533 22:45009015-45009037 GCGTGCGCGTGTGTGTGTTGGGG - Intronic
1184914546 22:47560306-47560328 ATGTGTGCATGTGTGTGTATGGG + Intergenic
1184924686 22:47629105-47629127 GCATGTGCATGTGTGTGATGTGG + Intergenic
951218185 3:20043351-20043373 GTGTGTGTATGCATGTGTTGGGG + Intronic
951229214 3:20157517-20157539 AAGTATGCTTGGGTGTGTTGAGG - Intergenic
953229473 3:41051875-41051897 ACGTGCACATGTGTGTGTTGGGG + Intergenic
953412904 3:42700288-42700310 ATGTGTGTGTGTGTGTGTTGGGG + Intronic
953743181 3:45554348-45554370 ACGTGTGCATGTGTGTGGTGTGG - Intergenic
954682272 3:52352140-52352162 AACTGTGCGTGCGTGTGGTGGGG - Intronic
955404890 3:58619853-58619875 ATGTGTGTATGTGTGTGTGGTGG + Intronic
956369196 3:68539704-68539726 GTGTGTGCATGTGTGTGGTGGGG + Intronic
956454111 3:69403821-69403843 ACCTGTGTGTGTGTGTGTTGAGG - Intronic
957172185 3:76751972-76751994 ACGTGTGCATGTGTCTTTTTGGG - Intronic
957363875 3:79196353-79196375 GCGTGTGCATGTGTGTGTGATGG - Intronic
957468366 3:80625190-80625212 AAGTGTGCGTGTGTGTGTCGGGG - Intergenic
959513169 3:107236429-107236451 GCGTGTGTGTGTGTGTGTTGGGG - Intergenic
959837061 3:110931611-110931633 ATGTGTGTATGTGTGTGTTGGGG - Intergenic
959908457 3:111736122-111736144 ATGTGTGCATGTGTGTTTTGTGG - Intronic
960354975 3:116640438-116640460 ATGTGTGCATGTGTGTGTTTGGG - Intronic
961519389 3:127457919-127457941 GCACGTGCATGTGTGTGTTGGGG - Intergenic
962269577 3:133967986-133968008 AAGTGTGTGTGCATGTGTTGGGG - Intronic
962386035 3:134933434-134933456 CCGTGTCCATTCCTGTGTTGTGG + Intronic
962444946 3:135455802-135455824 ACGTGTGTATACATGTGTTGGGG + Intergenic
962851559 3:139312127-139312149 ATGTGTGTGTGAGTGTGTTGGGG + Intronic
963660508 3:148121520-148121542 ATGTGTGAATACATGTGTTGTGG + Intergenic
963970805 3:151427402-151427424 ATGTATGCGTGTGTGTGTTGGGG - Intronic
964642401 3:158923794-158923816 ACGCGTGCATGCGTGTGGGCTGG + Intergenic
965132474 3:164719047-164719069 GTGTGTGCATGCATCTGTTGTGG + Intergenic
965370476 3:167855943-167855965 GCGTGTGTGTGTGTGTGTTGGGG - Intergenic
965545689 3:169914184-169914206 AGCTGTGCATGTGTGTGTTGGGG + Intronic
966985539 3:185176789-185176811 ACTTGTGCATGGGTGGGATGCGG - Intergenic
967253131 3:187563475-187563497 ATGTGTGCATGTCTGTGTAGGGG - Intergenic
967330464 3:188284643-188284665 ATGTGTGCATGAGTGTGTATTGG + Intronic
967449534 3:189608165-189608187 GTGTGTGCATGTATGTGTTGGGG + Intergenic
967700146 3:192582893-192582915 CAGTGTGCATGTTTGTGTTGAGG - Intronic
967748724 3:193088932-193088954 GTGTGTGCATGTGTGTGTGGGGG - Intergenic
968264878 3:197355216-197355238 ATGTGGGCATGCGAGTGGTGAGG - Intergenic
968637754 4:1690803-1690825 GTGTGTGCATGTGTGTGGTGGGG - Intergenic
968950049 4:3685956-3685978 ATGTGTGCACACGTGTGTGGGGG - Intergenic
969184213 4:5463517-5463539 ACGTGTGCATATGTGTGTGGGGG - Intronic
969431895 4:7160196-7160218 ACGTGTGTCTGTGTGTGTGGGGG + Intergenic
971598159 4:28558251-28558273 ACGTGTGTGTGTGTGTGTGGGGG - Intergenic
973947837 4:55978022-55978044 GCATGTGCATGTGTGTGTTTAGG + Intronic
974413740 4:61577194-61577216 GTGTGTGCATGTGTGTGTTAGGG + Intronic
974566408 4:63582248-63582270 AGCTGTGCGTGTGTGTGTTGGGG + Intergenic
975601784 4:76107943-76107965 GTGTGTGCATGTGTGTGTTGGGG + Intronic
976134726 4:81923367-81923389 CTGTGTGCATGTGTGTGTTTTGG - Intronic
978050078 4:104188027-104188049 ATGTGTGTGTGTGTGTGTTGTGG + Intergenic
981597734 4:146446159-146446181 AGGTGTGTGTGCGTGTGTTGGGG - Intronic
982375179 4:154682204-154682226 TGGTGTGTATACGTGTGTTGGGG - Intronic
982493833 4:156065172-156065194 GTGTGTGTATGTGTGTGTTGGGG + Intergenic
982582265 4:157194097-157194119 AAGTGGGCATGTGTGTGTTCAGG - Intergenic
982998761 4:162384905-162384927 ATGTGTGCTTGGGGGTGTTGGGG + Intergenic
984450061 4:179888424-179888446 ACATGTGCATGCTTGTTGTGTGG - Intergenic
984642909 4:182189729-182189751 GCGTGTGGGTGTGTGTGTTGGGG + Intronic
984698433 4:182801823-182801845 ACGCGTGCATGCATGTGTGCAGG - Exonic
985515998 5:344900-344922 GCGTGTGCAGGTGTGTGTGGAGG + Intronic
985795728 5:1960717-1960739 GTGTGTGCATGTGTGTTTTGGGG - Intergenic
985859542 5:2460025-2460047 GCCTGTGCATGCCTGTGTGGAGG + Intergenic
986012412 5:3728026-3728048 ATGTGTGCATGTGAGTGTAGGGG - Intergenic
986108632 5:4687553-4687575 ATGTGTGCATGTGTGTGTGTGGG - Intergenic
986366277 5:7035401-7035423 ACGTGTGCATGCGTCTTTATAGG + Intergenic
987165404 5:15193144-15193166 ACGTGTGTGTGTGTGTGTAGTGG + Intergenic
987576983 5:19742379-19742401 GCGTGTGCATTTGTGTGTTTTGG - Intronic
987794535 5:22609054-22609076 TTGTGTGCATGCATGTGTTGAGG + Intronic
987995036 5:25265267-25265289 ATGTGTGCGTGTATGTGTTGGGG - Intergenic
989106214 5:37865510-37865532 ACGTGTGCACACGTGTGCAGAGG - Intergenic
989131353 5:38110260-38110282 GTGTGTGCGTGTGTGTGTTGAGG - Intergenic
991295680 5:65077798-65077820 ATGTGTGCGTGTGTGTGTGGGGG - Intergenic
991321606 5:65379762-65379784 ACATGTGTGTGCGTGTGTTTAGG - Intronic
991471316 5:66971748-66971770 GCATGTGTATGTGTGTGTTGGGG + Intronic
991695769 5:69269677-69269699 ATGTGTGCATGTGTGTGTAATGG - Intronic
992773683 5:80071641-80071663 GTGTGTGTATGTGTGTGTTGGGG - Intronic
994143842 5:96370947-96370969 AAGTGTGAATGAGTGTATTGTGG - Intergenic
995022822 5:107385070-107385092 GTGTGTGCATACGTGTGCTGGGG - Intronic
996163660 5:120197994-120198016 ACGTGTGCATGTGTGTGTTTTGG - Intergenic
996300268 5:121973598-121973620 GTGTGTGCATGTGTGTGTGGGGG + Intronic
997626480 5:135334609-135334631 CCGTTTGTAAGCGTGTGTTGTGG - Exonic
997827172 5:137116761-137116783 CAGTGTGCATGTGTGTGTTGGGG - Intronic
998385177 5:141753360-141753382 ACGTGTGTGTGTGTGTGTTCTGG + Intergenic
998406546 5:141877809-141877831 AAGTGTGTATGTATGTGTTGTGG + Intronic
998502328 5:142644427-142644449 ACGTGTGTATGTGTGTGGTGGGG - Intronic
999250004 5:150176884-150176906 CTGTTTGCATGTGTGTGTTGGGG + Intronic
1000895230 5:166847275-166847297 GTGTGTGCACGTGTGTGTTGGGG + Intergenic
1000907386 5:166979061-166979083 GGGTGTGCGTGCGTGTGTTATGG + Intergenic
1003004638 6:2369458-2369480 ATGTGTGTCTGTGTGTGTTGGGG + Intergenic
1003038342 6:2664455-2664477 CAGTGTGCATGCGTGTGCTGGGG - Exonic
1003397571 6:5766234-5766256 GAGTGTGCCTGCGTGAGTTGGGG + Intronic
1003917928 6:10805052-10805074 GTGTGTGCATGTGTGTGTCGGGG + Intronic
1004135596 6:12962973-12962995 GTGTGTGCATGCATGTGCTGAGG - Intronic
1005199254 6:23324705-23324727 GTGTGTGTATGTGTGTGTTGGGG - Intergenic
1005430445 6:25751120-25751142 GGGTGTGCATGGGTGTGTAGGGG + Intergenic
1006723240 6:36174256-36174278 ATGTGTATATGCGTGTGGTGGGG + Intergenic
1006923088 6:37638943-37638965 GTGTGTGCATGTGTGTGTTTGGG - Intronic
1007540806 6:42642303-42642325 ATGTGTGCATGTGTGTGATGTGG - Intronic
1007740365 6:44006053-44006075 ATGTGTGCATTCGTGTGTCATGG - Intergenic
1008333613 6:50273113-50273135 AAGTGTGAATGCTTGTGTTTGGG - Intergenic
1010318808 6:74482941-74482963 GGGAGTGCATGCGTGTGTTGCGG - Intergenic
1010564110 6:77387715-77387737 AAGTGTGTCTGTGTGTGTTGGGG + Intergenic
1014237349 6:118973247-118973269 GCGTCTGTATGTGTGTGTTGTGG + Intronic
1014432960 6:121390767-121390789 CTGTGTGCAGGCCTGTGTTGGGG - Intergenic
1015395237 6:132726725-132726747 TCATGTGCATGCTGGTGTTGTGG + Exonic
1015594904 6:134857190-134857212 ATTTGTGCATGCATGTGTTGAGG - Intergenic
1019048697 6:169167302-169167324 ACCTGTGCACGCGAGTGTGGGGG + Intergenic
1019285917 7:222936-222958 ACGTGTGCATGTGTGTGTGAGGG + Intronic
1019309035 7:350327-350349 ACGTGTGTGTGCGTGAGTTTTGG - Intergenic
1019408617 7:897136-897158 ACGTGTCCACGTGTGTGCTGAGG - Intergenic
1019872384 7:3776976-3776998 ACGTGAGCAAGTGTGTGTGGGGG - Intronic
1019934990 7:4249004-4249026 ATGTGTGCATGTGTGTATTTAGG - Intronic
1020033019 7:4946194-4946216 GTGTGTGCATGCGTGTGTGTGGG - Intronic
1020953908 7:14715517-14715539 ATGTGTGCCTGTGTGTGTTGGGG - Intronic
1021446696 7:20741775-20741797 GTGTGTGCATGTGTGTGTGGTGG - Intronic
1022335087 7:29414668-29414690 ACGTGTGCATGCGTGTGTTGGGG - Intronic
1022795652 7:33729621-33729643 ACCTGTGTATGTTTGTGTTGTGG + Intergenic
1023082058 7:36535180-36535202 CTGTGTGCCTGTGTGTGTTGTGG + Intronic
1025069197 7:55884251-55884273 GCGTGTGTGTGAGTGTGTTGGGG - Intergenic
1025208287 7:57006056-57006078 ACGTGTGCAAGAGTGCGTTTGGG - Intergenic
1025663664 7:63570822-63570844 ACGTGTGCAAGAGTGCGTTTGGG + Intergenic
1026447268 7:70496021-70496043 ACGTGTGCATGTGTGTGGGGGGG - Intronic
1028493374 7:91438904-91438926 AAGAGTGCATGTGTGTGTTGTGG - Intergenic
1028582695 7:92423623-92423645 AGGTGTACATGTGTGTGGTGTGG + Intergenic
1029043614 7:97603659-97603681 GTGTGTGCATGTGTGTATTGTGG + Intergenic
1029930265 7:104363478-104363500 ACGTGCGCATGCAGGTGATGAGG + Intronic
1030170540 7:106598387-106598409 ATGTGTGCGTGTGTGTGTGGTGG - Intergenic
1030987469 7:116259386-116259408 ACATGTGCATGTGTGTGTGGTGG - Intergenic
1031555145 7:123166098-123166120 ATCTGTGCATGCCTTTGTTGTGG + Intronic
1031801532 7:126252840-126252862 ATGTGTGTATGTGTGTTTTGAGG + Intergenic
1032172119 7:129593519-129593541 ATGTGTGCATGTGTGTGTGATGG - Intergenic
1032854911 7:135825957-135825979 ATGTGTGCATGTGTGTGTGTTGG + Intergenic
1033506337 7:142005746-142005768 ATGTGTGTATGTGTTTGTTGCGG + Intronic
1033601318 7:142890921-142890943 TGGTGTGCATGTGTGTGTGGTGG - Intergenic
1033639330 7:143246051-143246073 GCGTGTGTGTGTGTGTGTTGAGG - Intronic
1034869547 7:154671849-154671871 GTGTGTGCATGTGTGTGTTGGGG - Intronic
1035083556 7:156237096-156237118 ATGTGTGTGTGTGTGTGTTGGGG - Intergenic
1035243102 7:157544920-157544942 AGGTGTGCATGGGTGTGTACAGG + Intronic
1035360760 7:158312670-158312692 AGGTGTGCATGCATGTGTGCAGG - Intronic
1035368733 7:158364966-158364988 GTGTGTGAATGTGTGTGTTGTGG - Intronic
1035705596 8:1672055-1672077 TTGTGTGCATGTGTGTGTTTGGG + Intronic
1035979062 8:4348591-4348613 GTGTGTGCGTGGGTGTGTTGGGG + Intronic
1036044942 8:5129345-5129367 GTGTGTGCATGCATGTGTTATGG + Intergenic
1037745903 8:21643830-21643852 GCGCGTGCATGTGTGTGTTTTGG - Intergenic
1037806180 8:22058955-22058977 TGCTGTGCATGCGTGTGATGTGG - Intronic
1039237025 8:35513044-35513066 AGGTGTGCATGGGAGTGTGGAGG - Intronic
1039466466 8:37788513-37788535 ATGCGTGCATGCACGTGTTGGGG - Intronic
1043193895 8:77265345-77265367 ACGTGTGCATGCATGTGTGTGGG + Intergenic
1044309031 8:90671327-90671349 ATGTGTGAGTGTGTGTGTTGGGG + Intronic
1046530768 8:115442585-115442607 GTGTGTGCATGTGTGTGTTTGGG + Intronic
1047224751 8:122946840-122946862 ACGTGTGAACATGTGTGTTGGGG - Intronic
1047635072 8:126752737-126752759 ATGTGTGTCTGTGTGTGTTGGGG + Intergenic
1048012644 8:130470493-130470515 ACACGTGCATGTGTGTGTTTAGG + Intergenic
1049254036 8:141604589-141604611 CCCTGTGCATGGGTGTGTGGGGG + Intergenic
1049291950 8:141808111-141808133 ATGTGTGTTTGTGTGTGTTGGGG + Intergenic
1049452367 8:142669194-142669216 GTGTGTGCGTGTGTGTGTTGGGG + Intronic
1049504744 8:142990176-142990198 AGGTGTGCATCTGTGTGGTGTGG + Intergenic
1049744079 8:144255758-144255780 GCGTGTGCACGCGCGTGGTGGGG + Intronic
1051576175 9:18618246-18618268 ATGTGTGCATGCATGTGTGTAGG - Intronic
1051868623 9:21711005-21711027 GTGTGTGCTTGCGTGTGTGGGGG + Intergenic
1053286893 9:36855546-36855568 TTGTGTGCATGCGTGAGGTGGGG + Intronic
1055589278 9:77793696-77793718 GCATGTGTATGTGTGTGTTGGGG - Intronic
1055715662 9:79115239-79115261 TTGTGTGTCTGCGTGTGTTGGGG - Intergenic
1055978733 9:81979186-81979208 ATGAGTGCATGCGTGTTTTTGGG + Intergenic
1056470876 9:86903523-86903545 ATGTGTGTGTGTGTGTGTTGGGG - Intergenic
1056565698 9:87770941-87770963 ACCATTGCATGCGTGTTTTGGGG + Intergenic
1056779666 9:89539730-89539752 ATGTGTGCCTGTGTCTGTTGGGG + Intergenic
1058902696 9:109456146-109456168 AGGTGTGCGTGTGTGTGTTGGGG + Intronic
1058983970 9:110195070-110195092 GTGTGTGCATGTGTGTGTGGAGG - Intronic
1060392872 9:123292794-123292816 ATGTGTGTTTGTGTGTGTTGTGG - Intergenic
1060816335 9:126637456-126637478 GCGTGTGCATTTGTGTGTGGGGG + Intronic
1060826870 9:126692814-126692836 GTGTGTGCATGCCTGTGCTGTGG + Intronic
1060887978 9:127168919-127168941 GCGTGTGCTTGTGTGTGCTGGGG - Intronic
1061498791 9:130990617-130990639 GCGTGTGTGTGCGTGTGTTGTGG - Intergenic
1061526124 9:131164221-131164243 ACGTGTGCATGTGTGAGCTAGGG + Intronic
1062106800 9:134759605-134759627 ATGTGTGCATATGTGTGTGGGGG - Intronic
1062195313 9:135269911-135269933 ATGTGGGCATGTGTGTGCTGTGG - Intergenic
1203791115 EBV:152089-152111 CCGTGTGCATGCCTTTGGTGGGG + Intergenic
1203362327 Un_KI270442v1:228163-228185 CAGTGTGTATGCGTGGGTTGCGG + Intergenic
1203655965 Un_KI270752v1:25062-25084 TCGTGTGTGTGTGTGTGTTGGGG - Intergenic
1185776515 X:2807211-2807233 ATGTGTGCATGCTTGTGCTTGGG + Intronic
1186257356 X:7736907-7736929 ACGTGTGTATGTGTGTGTAGGGG + Intergenic
1187308922 X:18122241-18122263 GTGTGTGTATGTGTGTGTTGAGG - Intergenic
1187731556 X:22260392-22260414 ACGTGTGCATGTGTCTTTTTAGG - Intergenic
1188454744 X:30351219-30351241 ACGTAGGTATACGTGTGTTGTGG + Intergenic
1190933294 X:54969327-54969349 GCCTGTGCATGCGAGTGTGGGGG - Intronic
1191951404 X:66597651-66597673 ATGTGTGTGTGTGTGTGTTGAGG + Exonic
1192168843 X:68842210-68842232 TTGTGTGCGTGCGTGTGTGGTGG + Intergenic
1192576420 X:72246610-72246632 TCGTGTGCATGTATGTGTAGGGG - Intronic
1194417770 X:93634921-93634943 ATGTGTGTGTGTGTGTGTTGAGG - Intergenic
1194598695 X:95892557-95892579 GTGTGTGTATGTGTGTGTTGGGG + Intergenic
1194866859 X:99079407-99079429 ACATGTGCATGTGTGTGTCGGGG - Intergenic
1195069570 X:101266345-101266367 ATGTGTGCATGTGTATGTTGGGG + Intergenic
1196117882 X:112016711-112016733 ATGTGTGCATGTGTGTGTAGAGG + Intronic
1196473701 X:116058463-116058485 ACGTGTTCATGCCAGTGGTGGGG + Intergenic
1196611781 X:117723434-117723456 CCATGTGCATGTGTGTATTGTGG + Intergenic
1197114821 X:122819114-122819136 ACGTTTGCATGGGTCTTTTGTGG - Intergenic
1197288318 X:124623342-124623364 GTGTGTGCATGAGTGTGTTTGGG + Intronic
1198016537 X:132616945-132616967 ATGTGTGCATGTGTGTGAGGGGG + Intergenic
1199942448 X:152638817-152638839 GCGCGTGCATGCATGTGTTGAGG + Intronic
1200085325 X:153601388-153601410 ACGTGTGCATGTGTGTATGTGGG - Intergenic
1200092809 X:153643741-153643763 ACGTGTGCTTGTGCGTGTCGGGG + Intronic
1201945363 Y:19504661-19504683 ATGTGTGCATGAGTGCGTTGAGG - Intergenic