ID: 1022338905

View in Genome Browser
Species Human (GRCh38)
Location 7:29450235-29450257
Sequence GTTTTTAAGGATTTTGTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022338900_1022338905 30 Left 1022338900 7:29450182-29450204 CCAAGCAGACGAAGCTCAAATTA 0: 1
1: 0
2: 0
3: 4
4: 76
Right 1022338905 7:29450235-29450257 GTTTTTAAGGATTTTGTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022338905 Original CRISPR GTTTTTAAGGATTTTGTGGT AGG Intronic
No off target data available for this crispr