ID: 1022339637

View in Genome Browser
Species Human (GRCh38)
Location 7:29456192-29456214
Sequence CGTTCAGAGGAGCAGATGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 244}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022339637_1022339641 3 Left 1022339637 7:29456192-29456214 CCTCCCATCTGCTCCTCTGAACG 0: 1
1: 0
2: 1
3: 25
4: 244
Right 1022339641 7:29456218-29456240 TGCTTCTTTCACCCTGCCCCTGG 0: 1
1: 0
2: 0
3: 29
4: 326

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022339637 Original CRISPR CGTTCAGAGGAGCAGATGGG AGG (reversed) Intronic
900378246 1:2370153-2370175 AGATCAGTGGAGCAGACGGGGGG + Intronic
901171324 1:7259862-7259884 CGTTCAGAGGAGCTAAAGGATGG - Intronic
902664131 1:17925762-17925784 CCTTCAGAGGAGCAAGTGTGGGG + Intergenic
902968459 1:20029449-20029471 CGTCAAGAGGAGCAGATCAGCGG - Intronic
905774144 1:40657500-40657522 CTTTCAGAGGCCAAGATGGGAGG + Intronic
906147711 1:43569772-43569794 CGTTCAGGTGAGCAGAGGGCAGG + Exonic
907328180 1:53654360-53654382 CGGTGAGAGGAGCAGGTCGGGGG + Intronic
908908703 1:69047323-69047345 CGTCGAGAGAAGCAGAGGGGTGG + Intergenic
909263546 1:73526886-73526908 CGTTGAGAGGAGCACATCAGTGG + Intergenic
910908006 1:92202220-92202242 CGTTCTGAGGAGTGCATGGGTGG + Intergenic
911058589 1:93728769-93728791 TGTTGAGAGAAGCAGATCGGTGG - Intronic
911785381 1:101939748-101939770 CCTTCAGAGGAGCAAAGTGGTGG + Intronic
911900522 1:103497594-103497616 GTTGCAGAGGAGCAGATTGGGGG - Intergenic
912343277 1:108938954-108938976 CATTTAGAGGGGCAGAGGGGAGG + Intronic
912837543 1:113009705-113009727 CTTTCAGAGGCCGAGATGGGTGG - Intergenic
913117620 1:115711397-115711419 CTTTCAGAGGAGGAGATGAAAGG - Intronic
914676196 1:149909176-149909198 CATTCAGGTGAGGAGATGGGTGG - Exonic
919408656 1:197216072-197216094 CATTCAGAAGGCCAGATGGGAGG - Intergenic
919768873 1:201144514-201144536 CCTGCAGAGGGGCTGATGGGAGG - Intronic
922299784 1:224287926-224287948 CTCTCAGAGGAGCAGATGCAAGG - Exonic
923523734 1:234756693-234756715 GGTTGAGGGGAGCAGAGGGGAGG - Intergenic
924160563 1:241227487-241227509 CTTTGAGAGGCTCAGATGGGAGG + Intronic
924484862 1:244472202-244472224 CTTTCAGAGGCTGAGATGGGAGG - Intronic
924778661 1:247128514-247128536 CTCTCAGAGGAGCAGCTGGATGG + Intronic
924782993 1:247169905-247169927 CTCTCAGAGGAGCAGCTGGATGG - Intronic
1063224701 10:4004844-4004866 CGTTTGGAGGAGCAGAGGCGTGG - Intergenic
1063617996 10:7619037-7619059 CCTTCAGATGAGCAGATCTGTGG - Intronic
1064340654 10:14482509-14482531 CTTTGAGAGGACGAGATGGGTGG - Intergenic
1064852291 10:19722344-19722366 CGTTCAGAGGCTGAGGTGGGAGG + Intronic
1065778262 10:29142779-29142801 CGTAGAGAGGAGCACATTGGCGG + Intergenic
1068738812 10:60446009-60446031 TGTTCAGAGGAGCAAAAGGAAGG + Intronic
1069011697 10:63381260-63381282 CTTTGGGAGGAGGAGATGGGAGG + Intronic
1069352904 10:67551230-67551252 CGTCGAGAGGAGGAGATCGGTGG + Intronic
1069877555 10:71572431-71572453 CCTTCAGGGGAGCAGAGGTGGGG - Intronic
1071028101 10:81139798-81139820 CATCGAGAGGAGCAGATTGGTGG + Intergenic
1071151871 10:82645428-82645450 TGTTGAGAGGACCATATGGGTGG - Intronic
1073879837 10:107967970-107967992 CGATCAGAGTAGCTGAGGGGAGG + Intergenic
1075294538 10:121262767-121262789 TGTTCACAGGAGGTGATGGGGGG - Intergenic
1075689595 10:124386426-124386448 CCTTCAGGTGAGCAGAGGGGCGG - Intergenic
1076217111 10:128703894-128703916 CATTCAGAGGAGCAACTGGCTGG + Intergenic
1076771411 10:132667721-132667743 TGTTCAGTGGAGCAGATGATGGG + Intronic
1079139270 11:17796942-17796964 AGGTGAGAGGAGTAGATGGGGGG + Intronic
1081688460 11:45058901-45058923 TTTTCAGAGGACCAGAAGGGTGG + Intergenic
1083213644 11:61204825-61204847 CGGTCCGAGGAGCCGAGGGGTGG + Intronic
1083396413 11:62395675-62395697 ACTTCAGAGGAGCAGGTGGGGGG - Intergenic
1083544320 11:63537735-63537757 CATACAGAGGAGGAGCTGGGAGG + Intronic
1083791663 11:64989812-64989834 GCTGCAGAGAAGCAGATGGGCGG + Exonic
1083808670 11:65089976-65089998 CTTTCAGAGGCCCAGGTGGGAGG + Intronic
1086090458 11:82999784-82999806 AGGTCAGAGGAGCAGACTGGAGG - Intronic
1092217535 12:6693737-6693759 CGTAGAGAGGAGGAGAGGGGTGG - Intergenic
1093734117 12:22600058-22600080 CTTTCAGAGGCCGAGATGGGTGG - Intergenic
1094461042 12:30696716-30696738 CGTCCAGAGGAGCATAAGGGTGG + Intergenic
1094681488 12:32671322-32671344 CTTTCAGAGGCCAAGATGGGCGG + Intergenic
1095898653 12:47305664-47305686 CGTCCACAGGAGCACATGGGCGG - Intergenic
1096492300 12:52019424-52019446 CTTTGAGAGGAGCAGAAGGCTGG - Intergenic
1097131162 12:56811579-56811601 TGTTGAGAGGAGCAGATCGGTGG - Intergenic
1098547943 12:71731814-71731836 CGTGGAGAGGAGCAGATCTGTGG + Intergenic
1100359799 12:93865647-93865669 CTTTCAGAGGCCCAGATGGGAGG - Intronic
1101057016 12:100928135-100928157 ATTTCAGAGGAGCAGATGGCAGG + Intronic
1102526885 12:113519050-113519072 CTTTGAGAGGCCCAGATGGGAGG - Intergenic
1104320149 12:127743063-127743085 GGGTCACAGGAGCAGTTGGGAGG + Intergenic
1104326928 12:127808012-127808034 CCTTGCGAGGAGCAGATGGAAGG - Intergenic
1104928267 12:132324935-132324957 TGTTCAGAGCAGCAGCTGAGGGG - Intronic
1105806042 13:23952078-23952100 CCTTCGGAGGAGCGGATGGAAGG - Intergenic
1107112663 13:36714787-36714809 CCTTGAGAGGAGGAGATGGAAGG + Intergenic
1109589738 13:64462749-64462771 AGGGCAGAGGAGCAGAAGGGTGG + Intergenic
1109724667 13:66324264-66324286 CGTGAAGGGGAGCAGATGGCAGG - Intronic
1110270159 13:73580231-73580253 CCTTAAGAGGAGCAGAAGAGAGG + Intergenic
1110574455 13:77039839-77039861 CGGTCAGAGAAGGAGATGTGAGG - Intergenic
1110847275 13:80204288-80204310 CTTTCAGAGGCGGAGGTGGGTGG + Intergenic
1114262754 14:21050359-21050381 GGTCCGGAGTAGCAGATGGGAGG - Intronic
1115478838 14:33841963-33841985 AGTTCAGAGGAGGAGGTGAGTGG + Intergenic
1118470867 14:66074272-66074294 TGGTCAGAGCAGCAGATGTGGGG + Intergenic
1120904942 14:89612024-89612046 CAGTCAGAGGAGCAGTTGTGAGG + Intronic
1121447587 14:93988412-93988434 AGATGGGAGGAGCAGATGGGAGG + Intergenic
1122091886 14:99346349-99346371 AGCTGAGAGGAGCAGATGTGGGG + Intergenic
1122278778 14:100609456-100609478 CGTTCAGCGGGGCAGATGAGTGG + Intergenic
1122540138 14:102493479-102493501 GGTTCAGAGGTGCAGATTTGGGG - Intronic
1122816879 14:104318384-104318406 GGTGCAGAGGGACAGATGGGCGG - Intergenic
1123467832 15:20529370-20529392 GGGTCAGGGGAGCGGATGGGAGG - Intergenic
1123650280 15:22471672-22471694 GGGTCAGGGGAGCGGATGGGAGG + Intergenic
1123728145 15:23124579-23124601 GGGTCAGGGGAGCGGATGGGAGG - Intergenic
1123740688 15:23280514-23280536 GGGTCAGGGGAGCGGATGGGAGG + Intergenic
1123746310 15:23322044-23322066 GGGTCAGGGGAGCGGATGGGAGG - Intergenic
1123893356 15:24803242-24803264 AGTTCAGAGCTGCAGCTGGGTGG + Intergenic
1124278577 15:28345361-28345383 GGGTCAGGGGAGCGGATGGGAGG - Intergenic
1124304123 15:28566247-28566269 GGGTCAGGGGAGCGGATGGGAGG + Intergenic
1124533004 15:30522717-30522739 GGGTCAGGGGAGCGGATGGGAGG + Intergenic
1124765653 15:32484927-32484949 GGGTCAGGGGAGCGGATGGGAGG - Intergenic
1125340836 15:38673730-38673752 CGTTAAGAGGCCAAGATGGGCGG + Intergenic
1125632645 15:41160023-41160045 CTTTCAGAGGCCAAGATGGGTGG + Intergenic
1128240512 15:66098123-66098145 TGTTCAGAGGTACAGATGGAAGG + Intronic
1128773654 15:70302422-70302444 AGTGCAGATGAGTAGATGGGTGG + Intergenic
1128804940 15:70523678-70523700 CATTCAGAGGAGCTGATGATTGG + Intergenic
1129050839 15:72780549-72780571 CTTTCAGAGGCCAAGATGGGAGG + Intronic
1129126072 15:73442609-73442631 CCGAAAGAGGAGCAGATGGGTGG - Intergenic
1129267107 15:74399651-74399673 GCCTCTGAGGAGCAGATGGGAGG + Intergenic
1129687965 15:77697044-77697066 AGGTCAGAGGAGCAGAGAGGAGG + Intronic
1131557779 15:93414405-93414427 CGTTGAGAGGAGCAAATGACAGG - Intergenic
1133383739 16:5352189-5352211 CGTTCGGAGGAGCACATGAGAGG - Intergenic
1136343814 16:29662923-29662945 GGTGCAGAGGAGGAGGTGGGAGG - Intergenic
1136552618 16:30989681-30989703 CCTGCAGAGGACAAGATGGGTGG - Exonic
1137586302 16:49665703-49665725 CCTCCAGAGGTGCTGATGGGGGG - Intronic
1139421637 16:66852875-66852897 CTCTCAGAGGACCAGATGGAGGG + Intronic
1139443128 16:66979112-66979134 CGTGCAGAAGTGGAGATGGGGGG - Intergenic
1139531798 16:67546092-67546114 GGCTCAGGGGAGCAGATGGGAGG - Intronic
1139946455 16:70645533-70645555 AGTCCAGAGGGGCAGATGGGAGG + Intronic
1141379878 16:83566640-83566662 CGGGCAGAGCATCAGATGGGAGG + Intronic
1141726638 16:85793616-85793638 CGTGCAGAGGAGCAGAGGACAGG + Intronic
1141872950 16:86801445-86801467 CAAACAGAGGAGCAGATGTGCGG + Intergenic
1142300990 16:89257659-89257681 CGTGGAGAGGAGCAGATCAGTGG - Intergenic
1143290277 17:5822987-5823009 CGTTGAGAGGAGCACATGGGTGG - Intronic
1143778215 17:9213093-9213115 CGGTCAGGGGAGCAGGTGGGAGG + Intronic
1144700156 17:17332324-17332346 AGATCAGAGGGGCAGATGGCTGG - Intronic
1146557950 17:33842781-33842803 CATTCAGAGGAGAAGAAGGATGG + Intronic
1147885249 17:43679860-43679882 CCTTCAGAGAAGCAAATGGCTGG + Intergenic
1148137108 17:45300618-45300640 TGTACAGTGGAGCTGATGGGAGG - Intronic
1150436386 17:65157477-65157499 CCTTGAGGGGAGCAGGTGGGTGG + Intronic
1151687820 17:75659595-75659617 CTTTGGGAGGACCAGATGGGAGG - Intronic
1151706390 17:75770796-75770818 CTTTCAGAGGCTGAGATGGGCGG + Intergenic
1152096947 17:78278143-78278165 CCTCCAGGGGAGCAGGTGGGAGG - Intergenic
1152875950 17:82786301-82786323 AGGTCAGGGGAGCAAATGGGAGG + Intronic
1153172043 18:2327620-2327642 CTTTGGGAGGAGGAGATGGGTGG - Intergenic
1156379112 18:36541333-36541355 CTTTCAGAGGCCAAGATGGGAGG + Intronic
1157831368 18:50859779-50859801 CCTGCAGAGGAGGAGATGGAAGG - Intergenic
1158015258 18:52775723-52775745 CGTCAAGAGGAGCACATCGGCGG - Intronic
1158369528 18:56784139-56784161 CTTTCAGAGGAGTAAATGGGAGG + Intronic
1159056499 18:63470922-63470944 GGTACAGAGGAGGAGAAGGGAGG + Intergenic
1159427678 18:68310632-68310654 GTTTCAGTGGAGCAGATTGGGGG - Intergenic
1161578054 19:5065761-5065783 CGTGCAGAGGAGGGGATGGATGG - Intronic
1162157848 19:8691869-8691891 CTTTCAGAGGCTGAGATGGGCGG - Intergenic
1162179728 19:8859952-8859974 CTTTCAGAGGCTGAGATGGGTGG - Intronic
1162616015 19:11800777-11800799 CTTTCAGAGGCCCAGGTGGGAGG + Intronic
1163581459 19:18141797-18141819 CTTTCAGAGGCCCAGCTGGGAGG - Intronic
1163996544 19:21053635-21053657 CTTTCAGAGGCCAAGATGGGCGG - Intronic
1164054819 19:21613831-21613853 CTCTCAGAGGAGCAGCTGGATGG - Intergenic
1164208436 19:23076615-23076637 CTCTCAGAGGAGCAACTGGGTGG + Intronic
1166343055 19:42150231-42150253 CCTGCAGAGGAGCAGAAAGGTGG - Intronic
1166799637 19:45448602-45448624 CTTTGAGAGGCGGAGATGGGAGG + Intronic
1168290962 19:55357386-55357408 CGGTCAGAGGTGCAGCAGGGGGG - Intronic
925281189 2:2686464-2686486 GATGCAGAGGAGCAGCTGGGAGG + Intergenic
927952161 2:27178775-27178797 CTTTGAGAGGTGGAGATGGGTGG - Intergenic
927964726 2:27262074-27262096 CGCTCAGAGGGGCAGGTGGACGG + Intronic
930763619 2:55061956-55061978 CGTTGAGAGAAGCACATTGGCGG + Intronic
930791145 2:55330252-55330274 CTTTCAGAGGACAAGGTGGGTGG + Intronic
935302144 2:101702321-101702343 CTTTGAGAGGCGCAGGTGGGCGG + Intronic
935664034 2:105494731-105494753 CGTTGAGAGGAGCGGATCGGTGG - Intergenic
937199508 2:120189918-120189940 GGTTCCCAGGAGCAGAAGGGTGG + Intergenic
937344394 2:121115567-121115589 CTTTGGGAAGAGCAGATGGGAGG + Intergenic
942484236 2:176422545-176422567 CCTTCAAAGAAGCAGAGGGGTGG + Intergenic
943701257 2:190990237-190990259 CGTTCAGTGGAGCAGGTGGATGG + Intronic
944728385 2:202495469-202495491 CGTAAAGAGGAGCACATCGGCGG - Intronic
946088985 2:217203788-217203810 CGTTCAGTGGGGGAGTTGGGTGG + Intergenic
946928609 2:224650349-224650371 CGTTCAGAGGAGCAGCTCAGAGG - Intergenic
946966364 2:225042008-225042030 CGCTCAGAGGAGCAGCTGCGTGG - Intronic
947432288 2:230041571-230041593 CTTTGAGAGGCGGAGATGGGCGG - Intronic
948569836 2:238910969-238910991 CGTTCAGAGAAGCAGGGAGGTGG - Intergenic
1169014398 20:2279884-2279906 CGTTGAGAGGAGAGGATGTGTGG + Intergenic
1169026546 20:2376304-2376326 GGTGCTGGGGAGCAGATGGGAGG + Intergenic
1169431368 20:5539280-5539302 CTTTCAGAGGGGAAGGTGGGTGG + Intergenic
1169673384 20:8129433-8129455 CGTTCACAGCAACAGCTGGGAGG + Intergenic
1170201936 20:13753606-13753628 CGTTCAGAGGATCATCTGTGTGG - Intronic
1176897803 21:14403346-14403368 TGTTGAGAGGATGAGATGGGAGG - Intergenic
1179137562 21:38693586-38693608 CTTTCAGTGGTCCAGATGGGAGG - Intergenic
1179613869 21:42569392-42569414 CCTTCGGAGGAGCAGCAGGGAGG - Intronic
1180240298 21:46498889-46498911 AGGACAGAGGAGCAGATGGAGGG + Intronic
1181023601 22:20115781-20115803 CTGTAAGAGGAGCAGATCGGTGG + Intronic
1181553396 22:23653752-23653774 CTTTCAGAGGCCGAGATGGGAGG - Intergenic
1182590570 22:31376404-31376426 CTTTCAGAGGCCCAGATGGGTGG - Intergenic
1183469308 22:37997191-37997213 CCTTCAGAGGAGGGGATGGAGGG - Intronic
1183539149 22:38419552-38419574 AGTTCAGAGGAAGAGAGGGGAGG - Intergenic
1185116714 22:48942089-48942111 CTCCCAGAGGAGCAGGTGGGAGG + Intergenic
1185134529 22:49062231-49062253 CCCTCAGGGGACCAGATGGGTGG + Intergenic
1185279742 22:49964954-49964976 TATTCGGAGGGGCAGATGGGAGG - Intergenic
950433677 3:12966443-12966465 CCTTCTGAGGAGCAGGGGGGTGG - Intronic
952791427 3:37203690-37203712 CTTTCAGAGGCCCAGGTGGGTGG - Intergenic
955578273 3:60389968-60389990 TTTTCAGAGGAGCAGATGAAAGG - Intronic
956194077 3:66634904-66634926 CGTTGAGAGGATCAGAAGAGTGG + Intergenic
959420016 3:106117379-106117401 CGTTGAGAGGAGTAGAGGAGTGG - Intergenic
961736525 3:129005201-129005223 CCTTCACAGGAACAGATGCGTGG + Intronic
962927043 3:140004480-140004502 CATTCACAGGAGCAGCAGGGAGG + Intronic
964703068 3:159590330-159590352 CTTTCAGAGGCGAAGGTGGGAGG + Intronic
965638844 3:170812112-170812134 CATTCAGAAGAGGAGAGGGGAGG - Intronic
968509212 4:987986-988008 CTTACAGAGGCACAGATGGGAGG + Exonic
968763531 4:2455974-2455996 AGTTCAGAGGAGGAGATGAAAGG - Intronic
972787344 4:42339377-42339399 CTTTTAGAGGTGCAGGTGGGAGG - Intergenic
974181262 4:58386933-58386955 GGAGCAGAGGAGCAGAGGGGAGG - Intergenic
974610143 4:64206268-64206290 AGAGCAGAGGAGCAGAAGGGCGG - Intergenic
981362752 4:143866404-143866426 AGATCAGAGGAGCAGAAGAGTGG + Intergenic
981373485 4:143987204-143987226 AGATCAGAGGAGCAGAAGAGTGG + Intergenic
981382588 4:144090475-144090497 AGATCAGAGGAGCAGAAGAGTGG + Intergenic
982086676 4:151842726-151842748 CACTCAGAGAAGCAGATGGCAGG - Intergenic
983717646 4:170805114-170805136 CATCCAGAGGAGCAGAGGAGCGG + Intergenic
984289897 4:177781912-177781934 GGTTAAGAGAAGCAGATTGGTGG - Intronic
984704828 4:182840085-182840107 TGTTCAGAAAAGGAGATGGGAGG - Intergenic
985645940 5:1084818-1084840 CTTTTGGAGGAGCAGCTGGGAGG - Intronic
986313987 5:6573945-6573967 CCTTCAGAGGAGCAGCAAGGAGG - Intergenic
987493236 5:18608629-18608651 CGTGCAGAGGTTGAGATGGGAGG - Intergenic
988844919 5:35118003-35118025 CGGACAGTGGGGCAGATGGGTGG + Intronic
989204546 5:38797921-38797943 CGTTGAGAGGAGCACATCAGTGG - Intergenic
991351846 5:65727411-65727433 CTTTCAGAGGTTGAGATGGGAGG - Intronic
995822317 5:116250689-116250711 AGTGCAGAGGAGGAGATGGGAGG + Intronic
998010006 5:138687373-138687395 CTTTCAGAGGGCCAGGTGGGTGG + Intronic
998218512 5:140255899-140255921 AGGTCTGAGGAGCAGATAGGAGG - Intronic
998522949 5:142817194-142817216 CAGGCAGAGAAGCAGATGGGAGG + Intronic
998746717 5:145268487-145268509 AGTTCAGAGGAGGAGTGGGGAGG - Intergenic
999702874 5:154244321-154244343 CTTTCAGAGGCTCAGGTGGGAGG + Intronic
999927281 5:156392878-156392900 TGTTGGGAGGAGCACATGGGTGG - Intronic
1000658841 5:163915107-163915129 CTTGCAGATGAGCAGATGGTGGG + Intergenic
1003318187 6:5030238-5030260 CACTCAGGGGAGCAGACGGGAGG - Intergenic
1007909282 6:45497046-45497068 AGCTCAGAGAAGCAGTTGGGTGG + Intronic
1010361518 6:75000658-75000680 CTTTCAGAGGCCAAGATGGGAGG + Intergenic
1010504018 6:76633986-76634008 TGTTAAGAGGAACACATGGGCGG - Intergenic
1012343951 6:98164039-98164061 CTTTCAGAGGCTGAGATGGGCGG - Intergenic
1012414638 6:98999885-98999907 CATTCAGAGGTGCCGATGTGAGG + Intergenic
1014993658 6:128114372-128114394 CTTTCAGAGGCGGAGGTGGGCGG + Intronic
1016492672 6:144624567-144624589 AGTTCAGAAGATCAGAAGGGTGG + Intronic
1016964651 6:149707395-149707417 CTTTCAGAGGCCCAGGTGGGAGG + Intronic
1017541283 6:155405618-155405640 CTTTAAGAGGAGCAGCTGGTTGG - Intronic
1019423095 7:960404-960426 GGCACAGAGGAGCAGATGGCGGG + Intronic
1020121873 7:5508947-5508969 CATTCAGAGGCTGAGATGGGTGG + Intronic
1021441710 7:20684933-20684955 CTTTCCCAGGAGGAGATGGGAGG - Intronic
1021616342 7:22506599-22506621 AGGACAGAAGAGCAGATGGGTGG - Intronic
1022339637 7:29456192-29456214 CGTTCAGAGGAGCAGATGGGAGG - Intronic
1022926136 7:35057811-35057833 AGGACAGAAGAGCAGATGGGTGG - Intergenic
1023304184 7:38806286-38806308 CATTCAGAGGAACAGATGAAAGG + Intronic
1023837567 7:44077302-44077324 CGTGCAGAGGGGCAGAGGGGAGG + Intronic
1024122295 7:46257063-46257085 AGGTCAGATGGGCAGATGGGAGG - Intergenic
1025941926 7:66081334-66081356 CTTTCAGAGGCCAAGATGGGAGG + Intronic
1026284491 7:68951251-68951273 CGTGCGGAGGAGCAGCTAGGTGG - Intergenic
1028376117 7:90147738-90147760 AGGACAGAAGAGCAGATGGGTGG + Intergenic
1029604646 7:101591121-101591143 CATTTAGAGGAGGGGATGGGGGG - Intergenic
1029824146 7:103172498-103172520 AGGACAGAAGAGCAGATGGGTGG - Intergenic
1030794450 7:113770473-113770495 CGTGGAGAGGAGCATATAGGTGG - Intergenic
1034763565 7:153696310-153696332 CGTTGAGAGGAGCAGAGGAGTGG + Intergenic
1035162348 7:156960559-156960581 CGTTCAGATGATGAGATGTGTGG + Intronic
1035295697 7:157865841-157865863 CTGTCAGAGGAGCAGACGGGAGG + Intronic
1035626939 8:1077398-1077420 GGTTCTCAGGAGCAGAGGGGCGG + Intergenic
1036947721 8:13110392-13110414 TGTTCAGAGGAATAAATGGGGGG - Intronic
1040839684 8:51772005-51772027 GGTCCAGTGGAGCAGCTGGGAGG + Intronic
1040877928 8:52172289-52172311 TCATCAGAGGAGCAGAAGGGTGG + Exonic
1044629743 8:94266736-94266758 CATTCAGGGGAGGAGCTGGGTGG + Intergenic
1046277476 8:111982461-111982483 CGTCCAGAGGAGCACATTGGTGG - Intergenic
1046439183 8:114236459-114236481 CGTCGAGAGGAGCAGAGGAGTGG + Intergenic
1046943254 8:119951892-119951914 CTTTGAGAGGATGAGATGGGTGG + Intronic
1048295041 8:133207764-133207786 CATGCAGGGGAACAGATGGGCGG + Intronic
1049015414 8:139916503-139916525 CGTTCCGAGGAGTGGATGGAGGG - Intronic
1049124365 8:140773596-140773618 CGTGCTGAGGAGCAGCAGGGAGG + Intronic
1049703487 8:144025288-144025310 CGTTGAGAGGCTAAGATGGGAGG - Intronic
1049710843 8:144062672-144062694 CGTACAGGGCAGCAGATGGTGGG - Intronic
1049726948 8:144151315-144151337 CATAGAGAGGAGCAGATTGGCGG + Intronic
1049733815 8:144192743-144192765 AGCTCAGAGGAGCAGAGGAGAGG + Intronic
1052763121 9:32612889-32612911 CATTCCAAGGAGCAGATTGGAGG + Intergenic
1055644346 9:78348767-78348789 CGTTCCGTGGAGCAGCTGGGTGG - Intergenic
1059042643 9:110830765-110830787 CGTCCTGAGGAGCACATTGGAGG - Intergenic
1059365264 9:113781838-113781860 GCTTCAGAGCAGCAGATGGGAGG + Intergenic
1060717765 9:125949924-125949946 CTTTCAGTGTAGCTGATGGGAGG + Intronic
1061036203 9:128115632-128115654 CGTTCAGAGGAGCTGAGAGCAGG - Intergenic
1061649473 9:132035482-132035504 CGCACAGGGAAGCAGATGGGGGG + Intronic
1061809800 9:133155643-133155665 AGTTTGGAGGAGCAGATGAGAGG - Intronic
1062665608 9:137669794-137669816 CTTTGAGAGGCCCAGATGGGAGG - Intronic
1188114145 X:26223240-26223262 ACTTCAGAGCAGCAGAAGGGAGG + Intergenic
1188186991 X:27128305-27128327 CATGAAGAGGAGCAGATCGGTGG - Intergenic
1190161212 X:48032708-48032730 CCTTCAGTGGAGGACATGGGCGG - Intronic
1193905293 X:87236758-87236780 CTTGCAGAGGGGCTGATGGGTGG - Intergenic
1194463955 X:94208416-94208438 CGTTGAGAGGAGCAGATCAGCGG + Intergenic
1194606971 X:95992710-95992732 CTTTGAGAGGTGGAGATGGGAGG + Intergenic
1196968959 X:121087723-121087745 AATTCAGAGGAGAAGGTGGGAGG - Intergenic
1198074247 X:133179562-133179584 CATGCAGAGGACCATATGGGAGG - Intergenic
1201016418 Y:9607209-9607231 CTTTCAGAGGCTGAGATGGGTGG + Intergenic
1201161888 Y:11173070-11173092 CGTTCTGAGGAGGAGCGGGGCGG + Intergenic