ID: 1022340199

View in Genome Browser
Species Human (GRCh38)
Location 7:29460422-29460444
Sequence CCAGCAGGGAGCTTCTAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 174}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022340192_1022340199 2 Left 1022340192 7:29460397-29460419 CCTCCCTATGTATTATCTGGCTT 0: 1
1: 0
2: 1
3: 6
4: 133
Right 1022340199 7:29460422-29460444 CCAGCAGGGAGCTTCTAAGAGGG 0: 1
1: 0
2: 1
3: 11
4: 174
1022340189_1022340199 15 Left 1022340189 7:29460384-29460406 CCCTGGATTCGTGCCTCCCTATG 0: 1
1: 0
2: 0
3: 8
4: 78
Right 1022340199 7:29460422-29460444 CCAGCAGGGAGCTTCTAAGAGGG 0: 1
1: 0
2: 1
3: 11
4: 174
1022340193_1022340199 -1 Left 1022340193 7:29460400-29460422 CCCTATGTATTATCTGGCTTAGC 0: 1
1: 0
2: 0
3: 5
4: 100
Right 1022340199 7:29460422-29460444 CCAGCAGGGAGCTTCTAAGAGGG 0: 1
1: 0
2: 1
3: 11
4: 174
1022340188_1022340199 20 Left 1022340188 7:29460379-29460401 CCATGCCCTGGATTCGTGCCTCC 0: 1
1: 0
2: 1
3: 13
4: 172
Right 1022340199 7:29460422-29460444 CCAGCAGGGAGCTTCTAAGAGGG 0: 1
1: 0
2: 1
3: 11
4: 174
1022340190_1022340199 14 Left 1022340190 7:29460385-29460407 CCTGGATTCGTGCCTCCCTATGT 0: 1
1: 0
2: 0
3: 8
4: 90
Right 1022340199 7:29460422-29460444 CCAGCAGGGAGCTTCTAAGAGGG 0: 1
1: 0
2: 1
3: 11
4: 174
1022340194_1022340199 -2 Left 1022340194 7:29460401-29460423 CCTATGTATTATCTGGCTTAGCC 0: 1
1: 0
2: 0
3: 6
4: 74
Right 1022340199 7:29460422-29460444 CCAGCAGGGAGCTTCTAAGAGGG 0: 1
1: 0
2: 1
3: 11
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022340199 Original CRISPR CCAGCAGGGAGCTTCTAAGA GGG Intronic
901014138 1:6218064-6218086 CCAGCACGCAGCTTCCATGATGG + Intronic
901948386 1:12721829-12721851 CCAGCCTGGAGCCTCAAAGAGGG + Intronic
902228820 1:15014350-15014372 CTTGCAGGGTGCTTCTAAGATGG + Intronic
904171641 1:28595447-28595469 CCAGGAGGCAGATTCTGAGATGG - Intronic
907917821 1:58886904-58886926 CCAGCAGGCAGCTGGAAAGAGGG - Intergenic
911880002 1:103225031-103225053 CAAGCAGAGAGCTTCTAGTAGGG + Intergenic
912507346 1:110165368-110165390 CCAGCAGAGAGCTTCTTATAGGG + Intronic
914814340 1:151052499-151052521 CCAGCAGGGAGGTTGGCAGAGGG + Exonic
914869956 1:151464804-151464826 CCACCTGGGAGCTGCTCAGATGG - Intergenic
915081367 1:153354819-153354841 CCTGCAGTGGCCTTCTAAGATGG + Intergenic
915648704 1:157292293-157292315 GCAGGAGGCAGCTTCTAACATGG + Intergenic
918390649 1:184056945-184056967 GTAGCAGGCAGCTTCTAAGATGG + Intronic
920645287 1:207798837-207798859 CCACAAGGGTCCTTCTAAGAGGG + Intergenic
1066650910 10:37654320-37654342 ACAGCAAGGGGCTTCTAATAGGG + Intergenic
1067034466 10:42902806-42902828 ACAGCAAGGGGCTTCTAATAGGG + Intergenic
1067536520 10:47114500-47114522 CCGGCAGGGAGCTACAGAGAGGG + Intergenic
1068191713 10:53660433-53660455 GCAGCAGGCCGCTTCCAAGATGG - Intergenic
1068552666 10:58423833-58423855 ACAGAAGGGAGGTTCCAAGATGG - Intergenic
1068596622 10:58909004-58909026 CCAGCAGGGAACTCTGAAGATGG - Intergenic
1069082794 10:64106018-64106040 GCAGCAGAGGGCCTCTAAGAGGG - Intergenic
1070580301 10:77713936-77713958 CCAGCAGGGTGCTTCTGGAAAGG + Intergenic
1071344956 10:84683990-84684012 CCTGCAGGGAGCTCTGAAGATGG + Intergenic
1075313110 10:121431087-121431109 ACAGCAAGGGGCTTCTAAGATGG - Intergenic
1075488300 10:122845826-122845848 CCAAAATGGAGCTTGTAAGAAGG - Exonic
1077176995 11:1195539-1195561 CCAGCAGAGAGCCTCAGAGACGG - Intronic
1079368608 11:19831158-19831180 CAAGCAGAGACCTTCTAAGGAGG - Intronic
1080835828 11:35940063-35940085 CCACCAGGCAGCTTCTCAGTAGG + Intergenic
1082029205 11:47592744-47592766 ACAGCAGGGACCTGCTGAGAAGG + Intronic
1082851212 11:57766645-57766667 CTGGCAGGGAGATTGTAAGAAGG + Intronic
1083133424 11:60648346-60648368 TCAGTAGGGAGCCTCTAAAATGG + Intergenic
1083298975 11:61730372-61730394 GCTGCAGGGAGCTTCTGACAGGG + Intronic
1084573038 11:69970947-69970969 CCAGGGGGCAGCTTCCAAGAAGG - Intergenic
1085046009 11:73354121-73354143 TCAGCAAGGACATTCTAAGATGG - Intronic
1085234817 11:75006254-75006276 CCAGCAGGCAGCCTCCAAGGGGG - Exonic
1089500252 11:118927840-118927862 CCAACAGGGTGCTTCTTAGAGGG + Intronic
1092571564 12:9729708-9729730 CCAGCAGGTAGCTCCTTAGATGG + Intronic
1094469273 12:30788401-30788423 GCAGCAGAGAGCATCTGAGAGGG + Intergenic
1095644756 12:44530459-44530481 GCAGTAGGTAGCTTCTGAGATGG + Intronic
1099051167 12:77783265-77783287 CCAGCAAGGAGCCTCCCAGATGG + Intergenic
1099424908 12:82511454-82511476 CCAGCAGGGAGCTTCTGCTGGGG - Intergenic
1103191312 12:119004479-119004501 ACAGCAGAGAGCTTCTGAGGAGG + Intronic
1104490289 12:129188247-129188269 CCAGCTGGGACCTGCTAACAAGG - Intronic
1104964784 12:132503997-132504019 CCCCCAGGGATCTTCTCAGATGG - Intronic
1105732776 13:23235536-23235558 CCTCCATGGAGCTTATAAGAAGG + Intronic
1107097301 13:36550353-36550375 CCACCAGGGAGCTTCAGCGATGG + Intergenic
1107821057 13:44286088-44286110 CCAGCCTGGAGCTTCTGGGAAGG - Intergenic
1109383729 13:61599939-61599961 TCAAAAGTGAGCTTCTAAGAGGG - Intergenic
1110257196 13:73445205-73445227 TCAGCAGGAAGCTGTTAAGATGG + Intergenic
1111690670 13:91559404-91559426 GAACCAGGGAGCTTCTATGATGG + Intronic
1114587600 14:23828266-23828288 CAAGGAGGGAGCCTCTAAAAAGG + Intergenic
1117797502 14:59409445-59409467 CCGGAAGGGAGGTTCCAAGATGG + Intergenic
1119103865 14:71906030-71906052 CCAGCAGGGAGCTACTATTTTGG - Intergenic
1120885632 14:89449813-89449835 CCATCAGGCAGCCTCTAGGAAGG + Intronic
1121521456 14:94588819-94588841 CCAGCAAGGATATACTAAGAAGG - Intronic
1121679661 14:95782856-95782878 GCAGTAGGCAGCTTTTAAGATGG + Intergenic
1121794868 14:96726403-96726425 CCATGAGGGTCCTTCTAAGAAGG + Intergenic
1122806880 14:104264317-104264339 CTAGCAGGAACCTTCTGAGAGGG + Intergenic
1128555792 15:68630956-68630978 CCACTAGGGGGCTTCTGAGAAGG - Intronic
1128997162 15:72305769-72305791 CCAGCAGGCAGCTGGTAACATGG - Intronic
1129852351 15:78800614-78800636 CCAGAAGGGAGCGGCCAAGAGGG + Intronic
1129962911 15:79704647-79704669 CCAGCAGTCATCTTATAAGACGG + Intergenic
1131215817 15:90534358-90534380 CCAGCAGGCAGCTGTTTAGATGG + Intronic
1133442046 16:5829164-5829186 GTGGCAGGCAGCTTCTAAGATGG - Intergenic
1136377862 16:29876240-29876262 CCAGCACGGGGCTTCAATGATGG + Intronic
1137636869 16:49994427-49994449 CCAGCATGGAGAATTTAAGATGG - Intergenic
1138073662 16:54019185-54019207 TCAGTTGGGAGCTTCTAGGAAGG - Intronic
1141119275 16:81338901-81338923 CCAGCATGATGCTACTAAGATGG + Intronic
1141404007 16:83775542-83775564 CCAGAAGGGAGCTGCAAAGAGGG + Intronic
1141467773 16:84218168-84218190 CGAGCAGGGAGTTTCCACGAGGG - Intergenic
1141593788 16:85085574-85085596 TCTGCAGGTAGCTTCTCAGATGG + Intronic
1142968915 17:3598172-3598194 CCCGCAGGCAGCTGCTAGGATGG - Intergenic
1143158067 17:4851468-4851490 CGAGCAGGAAGGCTCTAAGATGG - Intronic
1144019437 17:11227053-11227075 ACAGAAGGGAACTTCTAAGTGGG - Intergenic
1148232769 17:45947265-45947287 CCAACTTTGAGCTTCTAAGAAGG - Intronic
1148575006 17:48704331-48704353 CCAGCCGGAAGATGCTAAGAAGG - Intergenic
1150361029 17:64534304-64534326 CCACCAGGAAGCTGCTAACAAGG - Intronic
1152168847 17:78729822-78729844 CACACAGGGAGCTTCTGAGAAGG + Intronic
1153402110 18:4692327-4692349 GCAGCAGGCCGCTTCCAAGATGG - Intergenic
1153917943 18:9762238-9762260 GCAGTAGGCAGCTTCTAAAATGG - Intronic
1154394453 18:13974416-13974438 TCAACAGGGAGCAACTAAGACGG + Intergenic
1155425462 18:25702052-25702074 CCAGGAAGGACATTCTAAGAGGG + Intergenic
1157616539 18:48990815-48990837 CCCTCAGTGAGCTTCCAAGAGGG + Intergenic
1161107955 19:2453898-2453920 CCAGCAGGCGGCCTCTAAGTTGG + Intronic
1162893697 19:13751790-13751812 CCAGTAGGCAGCTCCCAAGATGG + Exonic
1165331249 19:35142276-35142298 CTGGCAGGGGGCTTCTAAGCTGG - Intronic
1165684962 19:37812075-37812097 GCAGCAGGGAAGTTCTCAGAAGG + Intronic
1166146684 19:40842740-40842762 CCGTAAGGGAGCTTCTAAGGGGG + Intronic
1166150842 19:40874623-40874645 CCGTAAGGGAGCTTCTAAGGGGG + Intronic
926438451 2:12861497-12861519 TCTGCAGGCAGCCTCTAAGATGG + Intergenic
926918836 2:17919121-17919143 CAAGCAGAGAGCTGCTCAGAAGG - Intronic
927140980 2:20130610-20130632 TCACCAGGGCCCTTCTAAGAGGG - Intergenic
927218679 2:20686159-20686181 CCTGCAGGGAGCTTATAACCTGG + Exonic
927276263 2:21264989-21265011 ACAGCCGGGAGCGTCTCAGAAGG + Intergenic
927789060 2:25995731-25995753 CCTGCAGGGGGCTTCTAGGATGG - Intergenic
929239722 2:39641774-39641796 CCAGCAGGGAAGTTTTGAGAAGG - Intergenic
929655298 2:43725085-43725107 CGAGGAGGGAGCTTGTAAGGAGG + Intronic
932445384 2:71777771-71777793 CCAGCATGGAGCTGCATAGAGGG + Intergenic
932861443 2:75297017-75297039 CCAGCAGGGTCCTCATAAGAGGG - Intergenic
936449284 2:112621395-112621417 GCAGCAGGCAGCTTCACAGAAGG - Intergenic
936747768 2:115600190-115600212 CAAGCAGGGAGTTTCTAAAGGGG - Intronic
940249561 2:151659640-151659662 ACAGCAGGGAGGATGTAAGATGG + Intronic
940453639 2:153871516-153871538 GCACCAGGGAGCCTCTTAGAGGG - Intergenic
948063923 2:235062521-235062543 CCAGAAGGGTCCTTCTAAAATGG + Intergenic
1171490462 20:25513067-25513089 CCAGCAGGTACCCTCTGAGAAGG + Intronic
1173216168 20:41086506-41086528 ACAGCAGGGAGCTCCTGATAAGG - Intronic
1173361537 20:42349123-42349145 CCAGAAGGGGGCTTTTGAGATGG - Intronic
1174507515 20:51026073-51026095 TCAGCAGGGAACTCCTCAGAAGG - Intergenic
1177340791 21:19796997-19797019 CCACCAGGAACCCTCTAAGATGG + Intergenic
1179824259 21:43955168-43955190 CCAGCGCGGTGCTTCTGAGACGG - Intronic
1183590160 22:38775365-38775387 CCCGCAGAGAGCTTCAAAGCTGG + Intronic
1184058009 22:42065640-42065662 CCGGCAGTGAGCCTCCAAGAAGG + Intronic
1185234502 22:49704331-49704353 CCAGCAGGGCCCTTTTGAGAAGG - Intergenic
952803729 3:37324265-37324287 CCAGCAGGCATCTGCTAAGCTGG + Exonic
953978660 3:47401931-47401953 CCAGCAGGGATGCTCTCAGATGG - Intronic
954599395 3:51856170-51856192 CCAGCAGGAAGCTGCTAGAATGG + Intergenic
957031458 3:75246884-75246906 CCAACAGGTAGTTCCTAAGAAGG - Intergenic
960619948 3:119627907-119627929 CTAGCAGGGTGCTTCCAAAAGGG - Intronic
961617362 3:128193344-128193366 CCAGCAGGGTGCATCTGAGAGGG + Intronic
963239409 3:142988228-142988250 GTGGCAGGCAGCTTCTAAGATGG - Intronic
965267704 3:166566999-166567021 CAAGCAGGAATCTTCTCAGAAGG - Intergenic
965443788 3:168749405-168749427 CCAGCAAGGAGATCCTGAGAAGG - Intergenic
965700008 3:171451036-171451058 TTAGTAGGGAGCCTCTAAGAGGG + Intronic
966692046 3:182751960-182751982 GCAGCAGCCAGCTTCCAAGATGG + Intergenic
966937726 3:184724618-184724640 CCAGCAGTGAGCTGCAAAGCTGG - Intergenic
968896110 4:3404572-3404594 CCAGCAGGGAGTTACAGAGATGG + Intronic
969439980 4:7211301-7211323 CCAGGAGGGAGCGTCCACGACGG + Intronic
974868783 4:67612829-67612851 GCAGCAGGGAGCTGATAAGTTGG + Exonic
974889915 4:67869138-67869160 CCAGCAGTCAGCTGTTAAGATGG + Intronic
976656812 4:87497330-87497352 CCAGCAGGGGGCATCATAGAAGG + Intronic
976821502 4:89212441-89212463 CCAGGAAGGAGATTCTGAGATGG + Intergenic
976963560 4:91008797-91008819 GCAGCAGGCTGCTTCCAAGATGG + Intronic
978905711 4:114003169-114003191 GTAGCAGGCAGCCTCTAAGATGG - Intergenic
982006089 4:151064129-151064151 GAAGCAGGCAGCATCTAAGATGG - Intergenic
984196654 4:176665478-176665500 GTGGCAGGCAGCTTCTAAGATGG - Intergenic
984681505 4:182615855-182615877 CCAGCAGTGACTTTCTAAGCAGG + Intronic
987428347 5:17799527-17799549 CAAGCAGGGTGATTCTAACAGGG + Intergenic
990032656 5:51280699-51280721 CCAACAGTGAGCTTTTAAGCAGG + Intergenic
991201651 5:64001183-64001205 CCAGTAAGCAGATTCTAAGATGG - Intergenic
992031660 5:72727628-72727650 CCAGCAGGGAGGTTCCAAGATGG + Intergenic
992339017 5:75802972-75802994 ACAGCAGGAAGCATCTAACATGG - Intergenic
999390237 5:151184267-151184289 CCAGCTGGGAGAGTCTTAGAGGG - Intronic
1002078737 5:176725462-176725484 CCAGCAGGGAGCTGGAGAGAGGG + Intergenic
1003751795 6:9066810-9066832 CCAGCAAGGAGTTTCTAGCAGGG + Intergenic
1004553075 6:16668546-16668568 CTAGCATGGAGCTTCTCAGTGGG - Intronic
1007668570 6:43532436-43532458 CCAGCCTGAAGCTTCTGAGATGG + Intronic
1011768318 6:90648598-90648620 CCTGCAGAGAGCTTCAGAGAAGG - Intergenic
1012436705 6:99222613-99222635 CTAGCAGGGATGTTGTAAGAGGG - Intergenic
1013307549 6:108863450-108863472 GCAGCTGGGAGCTGCTAAGAAGG - Intronic
1013308816 6:108874289-108874311 CCATCATGGAGCTTCTAGAAGGG - Intronic
1014396769 6:120933047-120933069 CAAGCAGGGAGGTACTGAGAAGG - Intergenic
1019852975 7:3577796-3577818 CCCTCAGGAAGCTTCTAACATGG - Intronic
1020093340 7:5353658-5353680 CCAGCAGGGAGTTGCTGAGCTGG - Intronic
1020370970 7:7431659-7431681 CCACCAGGGTGTTTCTAGGAAGG + Intronic
1022340199 7:29460422-29460444 CCAGCAGGGAGCTTCTAAGAGGG + Intronic
1023479522 7:40618569-40618591 CCATCAAGGATCTTCGAAGAGGG - Intronic
1023830281 7:44035131-44035153 CGAGCAGGGACCTTGTAGGAGGG - Intergenic
1024645626 7:51368270-51368292 CCCACAGAGAGCTTCTATGAGGG - Intergenic
1026944170 7:74305813-74305835 CCAGCTGGGGGCTGCTGAGATGG - Intronic
1028452866 7:91005229-91005251 CCAGCAGGGAACTGCTGACAAGG + Intronic
1029740599 7:102489418-102489440 CGAGCAGGGACCTTGTAGGAGGG - Intronic
1029758596 7:102588590-102588612 CGAGCAGGGACCTTGTAGGAGGG - Intronic
1029776534 7:102687669-102687691 CGAGCAGGGACCTTGTAGGAGGG - Intergenic
1034270708 7:149802318-149802340 CCAGCCGGGAGGCTCTCAGATGG - Intergenic
1034591528 7:152144073-152144095 TCAGCAAGGAGCTTGTAGGATGG + Intronic
1040005743 8:42619254-42619276 CCACCAGGGAGCTCCTGAGCTGG - Intergenic
1040303559 8:46200581-46200603 ACACCTGGGAGCTTCTAGGATGG - Intergenic
1041944727 8:63428117-63428139 CCAGCAGCTAGTTTCTAGGAGGG + Intergenic
1046342657 8:112879218-112879240 CCAGGAGGAAGCCTCTAAAATGG + Intronic
1048039808 8:130716145-130716167 GCAGCAGGGATCTTCTTTGATGG + Intergenic
1050264571 9:3876522-3876544 TCAGTAGGGATCTCCTAAGAAGG - Intronic
1051660661 9:19423337-19423359 GCAGCAGGGAGCCTCTTAAATGG + Intronic
1053269157 9:36738463-36738485 CCAACAGCAAGCTCCTAAGACGG - Intergenic
1055127656 9:72737665-72737687 CCAGCAGGCACTTTCTAAAATGG - Intronic
1055455461 9:76467567-76467589 CCACCAGGGAGCTTTCAAAAAGG - Intronic
1058708180 9:107654895-107654917 CCAGCAGGGAGCTCATAATATGG - Intergenic
1185752269 X:2622319-2622341 CCACCAGGGAGGCCCTAAGAGGG - Intergenic
1186542887 X:10419026-10419048 CTAGCAGATAGTTTCTAAGATGG + Intergenic
1189532018 X:41894707-41894729 TCAATAGGGAGCTTCAAAGAGGG + Intronic
1192150350 X:68708530-68708552 CCTGGAGGGAGCATCAAAGAAGG - Intronic
1193386634 X:80880461-80880483 ATAGTAGGCAGCTTCTAAGAAGG - Intergenic
1196258104 X:113546816-113546838 GCAGCAGGCAGCTCCCAAGATGG + Intergenic
1198235161 X:134730299-134730321 CCAGCATTGAGTTTCTGAGAAGG + Intronic
1198320247 X:135513036-135513058 GCAGAAGGGAGCCACTAAGAAGG + Intergenic
1200925313 Y:8649095-8649117 ACACCAGGGAGCTTCTACCATGG + Intergenic
1202254026 Y:22902094-22902116 CCAGGGAGGAGCTTCCAAGATGG - Intergenic
1202407016 Y:24535843-24535865 CCAGGGAGGAGCTTCCAAGATGG - Intergenic
1202463765 Y:25134238-25134260 CCAGGGAGGAGCTTCCAAGATGG + Intergenic