ID: 1022342301

View in Genome Browser
Species Human (GRCh38)
Location 7:29479975-29479997
Sequence TGCCGGAGGCTGCTGCAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 195}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022342296_1022342301 8 Left 1022342296 7:29479944-29479966 CCATCACTCAAACTGGGCCTTTC 0: 1
1: 0
2: 0
3: 10
4: 170
Right 1022342301 7:29479975-29479997 TGCCGGAGGCTGCTGCAGACAGG 0: 1
1: 0
2: 1
3: 17
4: 195
1022342295_1022342301 11 Left 1022342295 7:29479941-29479963 CCTCCATCACTCAAACTGGGCCT 0: 1
1: 0
2: 1
3: 13
4: 154
Right 1022342301 7:29479975-29479997 TGCCGGAGGCTGCTGCAGACAGG 0: 1
1: 0
2: 1
3: 17
4: 195
1022342291_1022342301 14 Left 1022342291 7:29479938-29479960 CCCCCTCCATCACTCAAACTGGG 0: 1
1: 0
2: 0
3: 16
4: 214
Right 1022342301 7:29479975-29479997 TGCCGGAGGCTGCTGCAGACAGG 0: 1
1: 0
2: 1
3: 17
4: 195
1022342293_1022342301 13 Left 1022342293 7:29479939-29479961 CCCCTCCATCACTCAAACTGGGC 0: 1
1: 0
2: 0
3: 8
4: 133
Right 1022342301 7:29479975-29479997 TGCCGGAGGCTGCTGCAGACAGG 0: 1
1: 0
2: 1
3: 17
4: 195
1022342299_1022342301 -9 Left 1022342299 7:29479961-29479983 CCTTTCAGGTCACATGCCGGAGG 0: 1
1: 0
2: 0
3: 11
4: 68
Right 1022342301 7:29479975-29479997 TGCCGGAGGCTGCTGCAGACAGG 0: 1
1: 0
2: 1
3: 17
4: 195
1022342289_1022342301 19 Left 1022342289 7:29479933-29479955 CCGGGCCCCCTCCATCACTCAAA 0: 1
1: 0
2: 0
3: 20
4: 247
Right 1022342301 7:29479975-29479997 TGCCGGAGGCTGCTGCAGACAGG 0: 1
1: 0
2: 1
3: 17
4: 195
1022342294_1022342301 12 Left 1022342294 7:29479940-29479962 CCCTCCATCACTCAAACTGGGCC 0: 1
1: 0
2: 0
3: 8
4: 128
Right 1022342301 7:29479975-29479997 TGCCGGAGGCTGCTGCAGACAGG 0: 1
1: 0
2: 1
3: 17
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022342301 Original CRISPR TGCCGGAGGCTGCTGCAGAC AGG Intronic
900358935 1:2278734-2278756 TGCTGGAGGCTGCCCCAGGCTGG + Intronic
900415598 1:2533070-2533092 GGCTGGAGGCTGCTCCAGGCTGG + Intergenic
902542569 1:17165311-17165333 TCCCAGAGGTTCCTGCAGACAGG - Intergenic
903768101 1:25747552-25747574 TGCCAGGTCCTGCTGCAGACAGG + Intronic
904286863 1:29458669-29458691 AGCCGGAAGGTGCTGAAGACAGG + Intergenic
909723519 1:78806115-78806137 TGCCAGAGGCTGGTGGAGAGAGG - Intergenic
911026006 1:93435679-93435701 TGCCTGAGGCCACTCCAGACAGG + Intergenic
917652821 1:177095831-177095853 TGCCTGGGGCTGTTCCAGACTGG - Intronic
918181411 1:182088182-182088204 TGCAGGAGGCGGCTGCAAAGAGG + Intergenic
920738757 1:208560175-208560197 TCCTGGAGGCAGCTGCAGAAAGG + Intergenic
923455734 1:234163574-234163596 TGCCTGAGGGAACTGCAGACTGG + Intronic
1063157809 10:3396293-3396315 AACCTGAGCCTGCTGCAGACAGG + Intergenic
1063522059 10:6750095-6750117 TGCCTTGGGCTGCTGTAGACAGG - Intergenic
1067756830 10:49011807-49011829 TTCCAGATGCTGCTGAAGACAGG + Intergenic
1070823115 10:79374845-79374867 TGGTGGAGGCTGCTTCAAACTGG - Intergenic
1073072283 10:100802309-100802331 TGGCAGAGGCTGCTTAAGACTGG - Intronic
1073977516 10:109117907-109117929 TGCCGGTGTCTGCTGCTGTCTGG - Intergenic
1074065361 10:110008224-110008246 ATCCGGCGGCTGCTGCAGCCCGG + Exonic
1075950124 10:126469903-126469925 AGCGAGAGGCTGCTGCAGAGGGG + Intronic
1076864838 10:133161452-133161474 GGCCCGCGGCTGCTGCAGCCGGG - Intronic
1077198928 11:1295849-1295871 TGCCGGGGGCAGCTGCTGTCGGG - Intronic
1077287484 11:1774056-1774078 TGCCGGCGGCTGCTGCACACTGG + Intergenic
1080858031 11:36129299-36129321 TGGCAGAGGCTGCTGCAAGCAGG + Intronic
1083920300 11:65778733-65778755 TGCCGGGCGCTGCTGCGGGCAGG - Exonic
1083968051 11:66055116-66055138 TGGCGGAGGAGGCTGCAGAGGGG - Exonic
1084212254 11:67629667-67629689 TGCCGGAGGCTACAGGAGCCCGG - Intronic
1084500369 11:69531482-69531504 TGCCCCAGGCAGGTGCAGACAGG - Intergenic
1084652952 11:70499753-70499775 AGCCCGGGGCTGCTGCAGAGAGG + Intronic
1089065632 11:115659888-115659910 TGCAGGAAGCTGGTGCAGAGAGG + Intergenic
1089362539 11:117900676-117900698 CGCTGGCGGCTGCTGCAGACAGG + Intronic
1089680663 11:120117286-120117308 TGCCCGGGGCTCCTGCAGGCTGG + Intronic
1090186044 11:124739868-124739890 TGCCGGAGGCTGCTCCTGATTGG + Exonic
1091680713 12:2524732-2524754 TGCTGGAGGCTTCAGCAGCCAGG + Intronic
1094395188 12:29998116-29998138 TGCCAGAGGTTGCTGCTGGCAGG + Intergenic
1099854106 12:88142232-88142254 TGCCTGAGGCTTCTGCATGCTGG + Intergenic
1101916307 12:108898760-108898782 TTGGGAAGGCTGCTGCAGACTGG + Exonic
1104050298 12:125190081-125190103 TGCCGGGGGCTGCTGAAGGAGGG - Intronic
1105812551 13:24008039-24008061 TGAGTGGGGCTGCTGCAGACAGG - Intronic
1106411438 13:29514163-29514185 TGCCTGAGGCTGCGGCAGCTCGG + Exonic
1106479670 13:30127708-30127730 TGTCAGATGCTGCTGCAGGCTGG + Intergenic
1106737345 13:32601057-32601079 TGCCCTATGCTGCTGCAAACTGG + Intronic
1114313981 14:21492998-21493020 TGGAGGAGGCTGCTGCAGAATGG - Exonic
1118429827 14:65706363-65706385 TGCTGGAGGCTGGAGCAGAGAGG - Intronic
1122724734 14:103742744-103742766 TGCAGGTGGCCGGTGCAGACTGG - Exonic
1123505663 15:20940065-20940087 TGCTGGAGGCTGCAGCCTACCGG - Intergenic
1123562898 15:21513772-21513794 TGCTGGAGGCTGCAGCCTACCGG - Intergenic
1123599144 15:21951055-21951077 TGCTGGAGGCTGCAGCCTACCGG - Intergenic
1124003315 15:25777337-25777359 TGCTGGACGCTGCTGGAGCCAGG - Intronic
1124139846 15:27067574-27067596 AGCTGGAGGCAGCTGCAGCCTGG - Intronic
1124406855 15:29400850-29400872 GGTCGGAGGCTCCTGCAGAGTGG + Intronic
1125535678 15:40440440-40440462 CGCCGGAGGCTGCTGCCCCCAGG - Intronic
1126170717 15:45693214-45693236 TGCCCGAGACTGCTGCCGCCTGG + Intergenic
1126895789 15:53255926-53255948 TGCCTGAGACAGCTGCAGAGTGG + Intergenic
1127770386 15:62225830-62225852 TGAGGGAGACTGCTGCGGACAGG + Intergenic
1128064847 15:64758228-64758250 TGCTGGATGCTTCTGCAGAAGGG - Intronic
1129161756 15:73751730-73751752 TGCCGGCTGGTGCTGCAGCCTGG - Intronic
1129198480 15:73984789-73984811 CGCCAGAGGCTGCTTCGGACTGG + Exonic
1130011105 15:80153434-80153456 TACCGGAAGCTGCAGCACACAGG + Intronic
1131188096 15:90292545-90292567 GGCCAGAGGCAGCTGCAGCCTGG + Intronic
1131261414 15:90889974-90889996 CCCAGGAGGCTGCTGCAGGCAGG - Intronic
1131649446 15:94382810-94382832 TGCCGGCGTCTGCAGCACACTGG - Intronic
1132316979 15:100897517-100897539 AGACTGAGGCTGCCGCAGACAGG - Intronic
1202971249 15_KI270727v1_random:240906-240928 TGCTGGAGGCTGCAGCCTACCGG - Intergenic
1132586195 16:706610-706632 CGGCGGCGGCTGCTGCAGCCCGG + Intronic
1132638782 16:967471-967493 TGCCGGTGCCTCCTGCAGTCAGG - Intronic
1132881043 16:2161816-2161838 TGCCGGGAGCTGCTGGAGACGGG + Intronic
1132905029 16:2278106-2278128 TGCCAAAGGCTTGTGCAGACAGG + Intronic
1134094577 16:11411116-11411138 CACCGGAGCCTGCTGCAGGCTGG + Intronic
1134472624 16:14540707-14540729 TGCTGGAGGCTGAGGCAGGCAGG + Intronic
1135473176 16:22750522-22750544 TGGTGGAGGCTGCAGCAAACAGG + Intergenic
1135597915 16:23757268-23757290 TGCAGGAGGCTGATGAAGATGGG + Exonic
1140202490 16:72905899-72905921 TGCCAGGGACTGCTGCTGACTGG + Intronic
1140795680 16:78435316-78435338 CGGCAGAGGCTGCTGCACACTGG - Intronic
1141664319 16:85458121-85458143 TGCCGGCTGGTGCTGCAGAGGGG - Intergenic
1143383201 17:6509050-6509072 TGCCAGAAACTCCTGCAGACAGG + Intronic
1143388262 17:6544980-6545002 TGGCCGAGGCTCCTGCGGACAGG + Intronic
1143978062 17:10844899-10844921 TGTGTGAGGCTGCAGCAGACAGG - Intergenic
1147652207 17:42069120-42069142 GGGCTGAGGCTGCTGCAGAGAGG + Intergenic
1148549802 17:48543713-48543735 TGCCGGAGGCTGGTGGCGGCGGG - Exonic
1148690651 17:49525005-49525027 TGCAGGAGGCTGGTGCCGCCAGG + Intergenic
1148796465 17:50199640-50199662 TGCTGGAGGCCTCTGCCGACGGG - Intronic
1151895876 17:76980674-76980696 TGGCGGAGCCTGTGGCAGACTGG - Intergenic
1152133300 17:78490223-78490245 AGGCGGAGGCTGCTCCTGACGGG - Intronic
1152135254 17:78499816-78499838 TGCAAGAGGCTGCTGCAGCCTGG + Intronic
1152295986 17:79467169-79467191 TGGCACGGGCTGCTGCAGACGGG + Intronic
1152639426 17:81443500-81443522 TGCCGTAGGCTGCCTCAGACCGG - Exonic
1159582651 18:70250392-70250414 GGACGGAGGTTGCTGCAGACCGG - Intergenic
1160420378 18:78739971-78739993 GCCGGGAGGGTGCTGCAGACAGG - Intergenic
1160826867 19:1084317-1084339 TGCAGGAGGCGGCGGCGGACGGG + Exonic
1161196246 19:2988080-2988102 TCCAGGAGGCTCCTGCAGGCGGG - Exonic
1161222381 19:3123589-3123611 GGCCGGGGGCTGCTGCCGCCCGG - Exonic
1161303639 19:3555533-3555555 TACCTGAGGCGGCGGCAGACAGG - Intronic
1165078366 19:33293536-33293558 TCCAGGAGGCTACTTCAGACGGG + Intergenic
1166039251 19:40191991-40192013 TGCGGGAGGCCGCTTCACACAGG - Exonic
1166045024 19:40224878-40224900 TGGAGGAGGCTGCTGCATCCAGG - Intronic
1166098175 19:40554612-40554634 TGCCGGGCGCTGCTGGAGATGGG + Exonic
1166331630 19:42081134-42081156 TGCCTGATGCTGCTGCTGATGGG - Exonic
1167405188 19:49302052-49302074 TGCAGGGGCCTGCTGCAGTCTGG - Intronic
1168455725 19:56506940-56506962 GGCTGGTGTCTGCTGCAGACAGG + Intergenic
925043612 2:753334-753356 TGCAGGAGGCGGCTGGAGAGGGG + Intergenic
926506821 2:13726363-13726385 AGTTGGAGGCTGCTGCAGACAGG - Intergenic
928206465 2:29288135-29288157 TGCAGGAGTGTGCTGCAGAGGGG - Intronic
928314460 2:30234915-30234937 TGTCGGGGGCTTCTGCAGAAGGG + Intronic
929195481 2:39180362-39180384 TGCCTGAGGCTGCCCCAGCCGGG + Intronic
929607544 2:43244953-43244975 TGACGGAGGCTTCCACAGACTGG + Intronic
929824790 2:45301824-45301846 TGTGGGAGCCTGCTGCAGACTGG + Intergenic
932515119 2:72338788-72338810 TACCCAAGGCTGCTACAGACAGG + Intronic
932619786 2:73258720-73258742 TGCCAGAGGCTACTCCAGCCGGG + Exonic
933905214 2:86885268-86885290 TGGTGGAGGCTGCAGCAGTCAGG - Intergenic
935205812 2:100895734-100895756 TACCTGTGGCTGCTGCAAACAGG - Intronic
935766043 2:106368405-106368427 TGGTGGAGGCTGCAGCAGTCAGG - Intergenic
938073960 2:128322331-128322353 TGGAGGAGGCGGCTGCGGACGGG - Intergenic
940928309 2:159393857-159393879 TGGGGGAAGCTGCTGCAGAGAGG - Intronic
945179636 2:207078641-207078663 TGCTGGAGGCTGCTACATAAAGG + Exonic
945212158 2:207394772-207394794 TGCCAGAGGCTGCTACAAGCTGG + Intergenic
946419692 2:219557856-219557878 CTCCGGGGGCTGCTCCAGACTGG + Exonic
947749134 2:232523758-232523780 TGGAGGAGGCTGCTGCGGGCGGG - Exonic
947820905 2:233068842-233068864 TGACGGAGGCTGCTGGGGACAGG + Intronic
1169143688 20:3239349-3239371 CGCGGGAGGCTGCTCCAGCCGGG + Intergenic
1170663413 20:18364166-18364188 TGCAGGATGATGCTGCAGAGAGG + Intergenic
1170810142 20:19667868-19667890 TGCCCGAGGCTGCAGCAGAAGGG + Intronic
1172126413 20:32627471-32627493 TGCAGGCTGCTGCAGCAGACAGG + Intergenic
1175083053 20:56437339-56437361 TCACGGAGGTCGCTGCAGACAGG + Exonic
1175437683 20:58965767-58965789 TGCTGGTGGCTGCAGCAGAGAGG + Intergenic
1175668385 20:60879877-60879899 AGCCGGAGGCTGCTGAATCCAGG - Intergenic
1175929179 20:62485566-62485588 CGCCAGAGGCAGCCGCAGACCGG + Intergenic
1179407240 21:41136291-41136313 TCCCAGTGGCTGCTCCAGACAGG - Intergenic
1181169833 22:21001872-21001894 CGCCGCCGGCTGCTGCACACGGG - Exonic
1181464862 22:23105448-23105470 AGCCTGAGCCTGCTGCAGAGGGG + Intronic
1183380111 22:37486393-37486415 TCCCGGAGGCTGCGGCAGGCCGG - Exonic
1183400955 22:37604114-37604136 TTCCAGATGCTGCTGCTGACTGG - Intergenic
1184744045 22:46445909-46445931 TGCAGGGGGCTGCTGGAGGCAGG - Intronic
1185195795 22:49468676-49468698 TAACAGAGGCTGCTGCAGGCTGG + Intronic
1185343161 22:50300442-50300464 TGCGGGAGGCTGCTCCGGGCAGG - Intronic
950088471 3:10278220-10278242 AGCTGGGGGCTGCTGCAGAGGGG + Intronic
953187380 3:40651517-40651539 TGCCAGAGGCTGCTTAAGGCAGG + Intergenic
962069926 3:132022863-132022885 TGACGGGGGCTGCTGCAGTAAGG - Intronic
962432715 3:135334955-135334977 TAGAGGAGGCTGCTTCAGACAGG - Intergenic
964687800 3:159416849-159416871 TACCTGAGGCTGCATCAGACAGG + Intronic
965652711 3:170950277-170950299 TGCTGGAGGCTGCTACATAAAGG + Intergenic
968441287 4:625750-625772 TCCCGGAGGCTGTCGCAGTCCGG - Exonic
969262639 4:6043508-6043530 TGCAGGAGGCAGCGGCACACAGG - Intronic
969943098 4:10754457-10754479 TGAAGGAGGCTGCTGGAGCCAGG + Intergenic
976097948 4:81528660-81528682 TGGCAGTGGCTGCTCCAGACAGG + Intronic
978771130 4:112457305-112457327 TGGAGGAGGCTGCTGCAGAATGG - Intergenic
979877056 4:125905977-125905999 TGCCCTTGGGTGCTGCAGACTGG - Intergenic
981516828 4:145619186-145619208 TTCCGCAGCCTGCTGCAGGCCGG + Exonic
987090168 5:14503289-14503311 TGCCAGAGGGTGCTGCTGGCTGG - Intronic
991544896 5:67770771-67770793 GCCCGGAGGTTGCTGCAGCCAGG - Intergenic
995437845 5:112158016-112158038 TTCAGGAGGCTGAAGCAGACAGG + Intronic
995736121 5:115301203-115301225 TGATGGTGGCTGCTGAAGACTGG - Intergenic
997646365 5:135484759-135484781 TGGAGGAGCCTGCTCCAGACTGG + Intergenic
998480664 5:142459856-142459878 TGGCAGTGGCTGCTCCAGACAGG + Intergenic
999694135 5:154173236-154173258 TCCCGGACGCTGCTGCTGTCAGG + Intronic
1002340730 5:178515246-178515268 GGCTGGAGGCTGCTGCAGATGGG - Intronic
1003646282 6:7915262-7915284 AGAGGGAGGCTGCTGCAGAGAGG - Intronic
1005728716 6:28674672-28674694 TGCCCGCGGCTGCTGCAGGGGGG - Intergenic
1006911363 6:37565775-37565797 TCCCTGAGGCTGCTGCTGCCGGG + Intergenic
1009320850 6:62286336-62286358 GGCAGGAGGCAGCTGCAGAGGGG + Intergenic
1018091508 6:160349559-160349581 AGGCGGAGGCTGCTGCCGGCGGG + Intronic
1019425797 7:975953-975975 TGCCTGCGGCTGCTGGAGCCAGG + Intergenic
1022342301 7:29479975-29479997 TGCCGGAGGCTGCTGCAGACAGG + Intronic
1022582845 7:31574095-31574117 TTGCTGAGGATGCTGCAGACTGG + Intronic
1023581641 7:41690245-41690267 CGCTGGATGCTGCTGGAGACAGG + Exonic
1024095308 7:45978148-45978170 TGTCAGAGCCTGCTGCAGCCAGG + Intergenic
1024289001 7:47786804-47786826 AGCCGGGGGCTGCTGCTGATTGG - Intronic
1025227953 7:57180117-57180139 TGCAGGAGGAGGCTGCGGACAGG + Intergenic
1025929513 7:65982591-65982613 TGCAAGAGGCTGCATCAGACAGG - Intergenic
1026392167 7:69912463-69912485 TGGCAGCGGCTGCTCCAGACAGG + Intronic
1026947431 7:74325397-74325419 ACCTGGAGGCTGGTGCAGACAGG + Intronic
1028640650 7:93039296-93039318 TGGCAGTGGCTGCTCCAGACAGG - Intergenic
1028757920 7:94459317-94459339 TTCGGGAGGCTGAGGCAGACAGG + Intergenic
1029011980 7:97271789-97271811 AGCCAGAGGCTGCTTCAGAAGGG - Intergenic
1029306507 7:99623836-99623858 AGTGGGAGGCTGCTGCAGAGTGG + Intronic
1030305023 7:108008954-108008976 TGGTGGAGGCTGCTTGAGACTGG + Intergenic
1030983480 7:116212474-116212496 TCCGGGAGGCTGCTGGAGACAGG + Intronic
1031683948 7:124709344-124709366 GGGCAGAGGCTGCTGCAGTCAGG - Intergenic
1032858918 7:135859231-135859253 TGGCAGTGGCTGCTTCAGACAGG + Intergenic
1033656994 7:143381319-143381341 GGCTGGAGGCTGCTCCGGACCGG + Exonic
1033990157 7:147273127-147273149 TGCTGGGGGCTTCTGCAGGCTGG - Intronic
1034257263 7:149731451-149731473 TGCCGGAGCCCCCTGCATACAGG + Intronic
1034678810 7:152912101-152912123 GGCAGGAGGCCGCTGCAGAGGGG + Intergenic
1035248158 7:157578556-157578578 TTTCGGAGGCTGCTTCTGACAGG - Intronic
1035336192 7:158128594-158128616 AGTGCGAGGCTGCTGCAGACAGG + Intronic
1035569541 8:662983-663005 GGACGCAGGCTGCTCCAGACAGG - Intronic
1036105176 8:5830430-5830452 TTCCTGAGGCTGCTGCAGTGAGG + Intergenic
1036808446 8:11851096-11851118 TGCCGAAGAAGGCTGCAGACAGG + Intronic
1038780612 8:30566088-30566110 GACCAGAGGCTGCTGCAGAATGG - Intronic
1041389699 8:57337707-57337729 TGCGTGAGGATGCTGCAGACAGG - Intergenic
1047275558 8:123402378-123402400 TGCTGCAGCCTGCTGCAGCCTGG + Intronic
1048202794 8:132390642-132390664 TGCTGGAGAGTGCTGGAGACTGG - Intronic
1049032236 8:140046467-140046489 TGACAGAAGCTGCTGGAGACAGG - Intronic
1049453054 8:142672777-142672799 TGCTGGGGTCTGCTGCAGGCTGG - Intronic
1049651577 8:143772167-143772189 TGTCGGAGGCGGCCGCAGGCGGG + Intergenic
1049740574 8:144239095-144239117 TGCACGAGGCTCCTGCAGAGCGG - Exonic
1051735832 9:20198325-20198347 TGCCAGAGGCAGCTGCACACAGG + Intergenic
1053009260 9:34624090-34624112 TCCCTGGGGATGCTGCAGACAGG - Intronic
1053130098 9:35609711-35609733 TGCCCCAGGCAGCTGCAGGCTGG - Exonic
1055829266 9:80359945-80359967 TCCCGGAGGCTGCCGCACCCAGG - Intergenic
1055910417 9:81344406-81344428 GGCAGAAGGGTGCTGCAGACAGG + Intergenic
1057152781 9:92809229-92809251 TGCAGGGGGCTGCTGCAGCTCGG - Intergenic
1057211629 9:93203834-93203856 CGGGGGAGGCTGCTGCAGCCTGG + Intronic
1057945617 9:99325578-99325600 CTCCTGAGGCTGATGCAGACTGG - Intergenic
1059311558 9:113391883-113391905 TGGCAGAGGCTGTTGCAGAAGGG - Intronic
1061036637 9:128118030-128118052 TCCCCGGGGCTGCTGCAGATGGG - Intergenic
1061594600 9:131620816-131620838 TCTGGGAGGCAGCTGCAGACTGG - Intronic
1189626415 X:42902015-42902037 TGCAGGTGGCTGCTGGAGAGAGG - Intergenic
1190116606 X:47629627-47629649 TGCCGGAGGATTCTTCATACTGG + Exonic
1192036558 X:67568904-67568926 TGCCTGAAGCTGCTGGAGGCTGG + Intronic
1195364260 X:104112379-104112401 GGGCGGGGGCTGCGGCAGACAGG - Intronic
1195541600 X:106068669-106068691 TGCATGGGGCTGCTGCACACTGG - Intergenic
1198334423 X:135652835-135652857 TGCCTGGGGCTGGTGCAAACAGG - Intergenic
1200787728 Y:7274368-7274390 TGACGGAGGATGCCGCCGACTGG + Intergenic
1201406661 Y:13657020-13657042 AGCCGGTTGCTGCTGCTGACTGG + Intergenic