ID: 1022346239

View in Genome Browser
Species Human (GRCh38)
Location 7:29517176-29517198
Sequence TAGCCACAGCTCCAAAAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022346239_1022346240 -6 Left 1022346239 7:29517176-29517198 CCTGTCTTTTGGAGCTGTGGCTA No data
Right 1022346240 7:29517193-29517215 TGGCTAACATCTGAACTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022346239 Original CRISPR TAGCCACAGCTCCAAAAGAC AGG (reversed) Intergenic
No off target data available for this crispr