ID: 1022350833

View in Genome Browser
Species Human (GRCh38)
Location 7:29565070-29565092
Sequence GCGAATCCTGCCGTTGCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 52}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022350829_1022350833 0 Left 1022350829 7:29565047-29565069 CCTGGAAGTGAGCCGCGGCGCAG 0: 1
1: 0
2: 1
3: 3
4: 84
Right 1022350833 7:29565070-29565092 GCGAATCCTGCCGTTGCTGGTGG 0: 1
1: 0
2: 0
3: 1
4: 52
1022350827_1022350833 11 Left 1022350827 7:29565036-29565058 CCGAGCGGAAACCTGGAAGTGAG 0: 1
1: 0
2: 1
3: 6
4: 116
Right 1022350833 7:29565070-29565092 GCGAATCCTGCCGTTGCTGGTGG 0: 1
1: 0
2: 0
3: 1
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022350833 Original CRISPR GCGAATCCTGCCGTTGCTGG TGG Intronic
904808421 1:33147614-33147636 GCGAGTCCTGCAGTGGCTGTGGG + Exonic
905500052 1:38429084-38429106 GCATAGCCTGCCTTTGCTGGTGG - Intergenic
905887088 1:41497201-41497223 GCCAGTCCTCCCGTGGCTGGGGG - Intergenic
907878615 1:58520978-58521000 GTGGATCCTGCCATTGCGGGTGG - Intronic
911272206 1:95815797-95815819 ATGGATCCTGCCATTGCTGGAGG + Intergenic
1063126629 10:3141935-3141957 GCCATCCCTGCCGGTGCTGGTGG - Intronic
1063167336 10:3475483-3475505 GCGATTCCAGCCCTTTCTGGAGG + Intergenic
1064787925 10:18918720-18918742 GCTGATGCTGACGTTGCTGGGGG + Intergenic
1072357752 10:94628354-94628376 GAGAATACTGCCTTAGCTGGAGG - Intergenic
1078345918 11:10548372-10548394 GAGAATTCTGTGGTTGCTGGAGG + Intergenic
1083339440 11:61949636-61949658 GAGAAGCCTGCCGGGGCTGGTGG - Intergenic
1084277239 11:68059847-68059869 GTGCACCCTGCAGTTGCTGGGGG + Intronic
1088920457 11:114257061-114257083 GCGACTCCTGGTGATGCTGGAGG - Intergenic
1089490628 11:118881522-118881544 GAGAATCTTGCATTTGCTGGGGG + Intergenic
1092052442 12:5481179-5481201 CCGGTTCCTGCCCTTGCTGGAGG + Intronic
1096033540 12:48442812-48442834 GGGAAACCTGCTGCTGCTGGTGG - Intergenic
1112921263 13:104615471-104615493 GCAAATCCTGCTGTCACTGGTGG - Intergenic
1113874614 13:113586189-113586211 GCGAATCCTGCATTTCTTGGGGG + Intronic
1122610284 14:102977695-102977717 GCTAACCCTGCCAATGCTGGCGG + Intronic
1126304222 15:47236630-47236652 ATGAATCCTGCTGTTGCTAGAGG + Intronic
1134441681 16:14302570-14302592 GCGATCCCTGCCTTGGCTGGCGG - Intergenic
1140475048 16:75235591-75235613 GCGTGTGCTGCCGGTGCTGGAGG + Exonic
1141139251 16:81486723-81486745 GCGAATCCAGCTGTGCCTGGTGG + Intronic
1141603530 16:85140257-85140279 GAGATTCCTGCAGTTGCTGGTGG + Intergenic
1142291878 16:89196995-89197017 GAGAATTCTGCCATTTCTGGAGG + Intronic
1151715310 17:75828060-75828082 CCCAATCCTGCAGCTGCTGGAGG - Exonic
1151967520 17:77439234-77439256 GCCAATGCTGCTGTTGCTCGGGG - Intronic
1153290578 18:3498540-3498562 GCGAAATCTGCAGGTGCTGGGGG - Exonic
1164605340 19:29593913-29593935 GCTGAGCCTGCCGGTGCTGGAGG - Intergenic
934474521 2:94585586-94585608 AGGAATCCTGCAGTTGCTGAGGG - Intergenic
935734794 2:106097906-106097928 TGGAATCCTCCCGTTGCTCGTGG - Intronic
1175003570 20:55657269-55657291 CTGAATCCTGCCGATGCTGCTGG - Intergenic
1175591274 20:60193893-60193915 AGGTATCCTGCCATTGCTGGTGG - Intergenic
1185265526 22:49900680-49900702 GAGGATGCTGCTGTTGCTGGGGG + Exonic
961312073 3:126008839-126008861 TCGAGTCCTGCTCTTGCTGGTGG - Exonic
963271879 3:143292908-143292930 GTTAATGCTGCCGCTGCTGGGGG + Intronic
982535710 4:156604298-156604320 GCATAACCTGCCTTTGCTGGTGG - Intergenic
1000190270 5:158903621-158903643 GCTAATCCAGCCATTGGTGGTGG + Intronic
1017122158 6:151034358-151034380 AGGAATCCTGCAGTTGCTGAGGG + Intronic
1022350833 7:29565070-29565092 GCGAATCCTGCCGTTGCTGGTGG + Intronic
1025753600 7:64313773-64313795 GCGAGTCCTCCCTGTGCTGGGGG - Intronic
1033125430 7:138702943-138702965 GTGATTACTGCCCTTGCTGGGGG + Intergenic
1035133538 7:156677463-156677485 GTGAATCCTGTCACTGCTGGTGG + Intronic
1046148203 8:110189527-110189549 GTGAATACTGCAGATGCTGGTGG + Intergenic
1049198767 8:141329734-141329756 TCGCCTCCTGCCGCTGCTGGGGG - Intergenic
1053683545 9:40500516-40500538 AGGAATCCTGCAGTTGCTGAGGG + Intergenic
1053933527 9:43128834-43128856 AGGAATCCTGCAGTTGCTGAGGG + Intergenic
1054280168 9:63124405-63124427 AGGAATCCTGCAGTTGCTGAGGG - Intergenic
1054296649 9:63336013-63336035 AGGAATCCTGCAGTTGCTGAGGG + Intergenic
1054394666 9:64640519-64640541 AGGAATCCTGCAGTTGCTGAGGG + Intergenic
1054429314 9:65145719-65145741 AGGAATCCTGCAGTTGCTGAGGG + Intergenic
1054501067 9:65875812-65875834 AGGAATCCTGCAGTTGCTGAGGG - Intergenic
1187676665 X:21723147-21723169 GGGAATGCTGCTGCTGCTGGTGG - Intronic
1200879951 Y:8202368-8202390 ACTAATCCTGCTGTTCCTGGAGG + Intergenic