ID: 1022355793

View in Genome Browser
Species Human (GRCh38)
Location 7:29613277-29613299
Sequence CACTGACCCATTCAGCTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022355793_1022355797 -6 Left 1022355793 7:29613277-29613299 CCAGGCAGCTGAATGGGTCAGTG No data
Right 1022355797 7:29613294-29613316 TCAGTGGAGCAATGACAATGGGG No data
1022355793_1022355796 -7 Left 1022355793 7:29613277-29613299 CCAGGCAGCTGAATGGGTCAGTG No data
Right 1022355796 7:29613293-29613315 GTCAGTGGAGCAATGACAATGGG No data
1022355793_1022355795 -8 Left 1022355793 7:29613277-29613299 CCAGGCAGCTGAATGGGTCAGTG No data
Right 1022355795 7:29613292-29613314 GGTCAGTGGAGCAATGACAATGG No data
1022355793_1022355800 28 Left 1022355793 7:29613277-29613299 CCAGGCAGCTGAATGGGTCAGTG No data
Right 1022355800 7:29613328-29613350 CAGAGACCACTTTCTGCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022355793 Original CRISPR CACTGACCCATTCAGCTGCC TGG (reversed) Intergenic
No off target data available for this crispr