ID: 1022356294

View in Genome Browser
Species Human (GRCh38)
Location 7:29617734-29617756
Sequence AGGGGAATTGAGTTTGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022356294_1022356303 11 Left 1022356294 7:29617734-29617756 CCATCCTCAAACTCAATTCCCCT No data
Right 1022356303 7:29617768-29617790 GGTAACATCTTCACGGGTCTTGG No data
1022356294_1022356301 4 Left 1022356294 7:29617734-29617756 CCATCCTCAAACTCAATTCCCCT No data
Right 1022356301 7:29617761-29617783 CATGTAAGGTAACATCTTCACGG No data
1022356294_1022356296 -10 Left 1022356294 7:29617734-29617756 CCATCCTCAAACTCAATTCCCCT No data
Right 1022356296 7:29617747-29617769 CAATTCCCCTTTGCCATGTAAGG No data
1022356294_1022356302 5 Left 1022356294 7:29617734-29617756 CCATCCTCAAACTCAATTCCCCT No data
Right 1022356302 7:29617762-29617784 ATGTAAGGTAACATCTTCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022356294 Original CRISPR AGGGGAATTGAGTTTGAGGA TGG (reversed) Intergenic
No off target data available for this crispr