ID: 1022361729

View in Genome Browser
Species Human (GRCh38)
Location 7:29666303-29666325
Sequence TAGGAAATACATAATGGGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022361729_1022361737 11 Left 1022361729 7:29666303-29666325 CCGTGCCCATTATGTATTTCCTA No data
Right 1022361737 7:29666337-29666359 GGTGCCTACTTCCTGGAATATGG No data
1022361729_1022361732 -10 Left 1022361729 7:29666303-29666325 CCGTGCCCATTATGTATTTCCTA No data
Right 1022361732 7:29666316-29666338 GTATTTCCTAGCTGTATCCCAGG No data
1022361729_1022361734 4 Left 1022361729 7:29666303-29666325 CCGTGCCCATTATGTATTTCCTA No data
Right 1022361734 7:29666330-29666352 TATCCCAGGTGCCTACTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022361729 Original CRISPR TAGGAAATACATAATGGGCA CGG (reversed) Intergenic
No off target data available for this crispr