ID: 1022361729 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:29666303-29666325 |
| Sequence | TAGGAAATACATAATGGGCA CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1022361729_1022361737 | 11 | Left | 1022361729 | 7:29666303-29666325 | CCGTGCCCATTATGTATTTCCTA | No data | ||
| Right | 1022361737 | 7:29666337-29666359 | GGTGCCTACTTCCTGGAATATGG | No data | ||||
| 1022361729_1022361732 | -10 | Left | 1022361729 | 7:29666303-29666325 | CCGTGCCCATTATGTATTTCCTA | No data | ||
| Right | 1022361732 | 7:29666316-29666338 | GTATTTCCTAGCTGTATCCCAGG | No data | ||||
| 1022361729_1022361734 | 4 | Left | 1022361729 | 7:29666303-29666325 | CCGTGCCCATTATGTATTTCCTA | No data | ||
| Right | 1022361734 | 7:29666330-29666352 | TATCCCAGGTGCCTACTTCCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1022361729 | Original CRISPR | TAGGAAATACATAATGGGCA CGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||