ID: 1022363375

View in Genome Browser
Species Human (GRCh38)
Location 7:29685054-29685076
Sequence GGGCCGGAGGCCGCCGCCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 423
Summary {0: 1, 1: 0, 2: 7, 3: 42, 4: 373}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022363375_1022363386 2 Left 1022363375 7:29685054-29685076 CCCGCGGCGGCGGCCTCCGGCCC 0: 1
1: 0
2: 7
3: 42
4: 373
Right 1022363386 7:29685079-29685101 GGCTCTGGTCCCGGTCCCATTGG 0: 1
1: 0
2: 1
3: 10
4: 103
1022363375_1022363391 20 Left 1022363375 7:29685054-29685076 CCCGCGGCGGCGGCCTCCGGCCC 0: 1
1: 0
2: 7
3: 42
4: 373
Right 1022363391 7:29685097-29685119 ATTGGCCACTCCGCTGCTACTGG No data
1022363375_1022363392 24 Left 1022363375 7:29685054-29685076 CCCGCGGCGGCGGCCTCCGGCCC 0: 1
1: 0
2: 7
3: 42
4: 373
Right 1022363392 7:29685101-29685123 GCCACTCCGCTGCTACTGGAAGG No data
1022363375_1022363381 -7 Left 1022363375 7:29685054-29685076 CCCGCGGCGGCGGCCTCCGGCCC 0: 1
1: 0
2: 7
3: 42
4: 373
Right 1022363381 7:29685070-29685092 CCGGCCCCCGGCTCTGGTCCCGG 0: 1
1: 0
2: 3
3: 31
4: 366

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022363375 Original CRISPR GGGCCGGAGGCCGCCGCCGC GGG (reversed) Intergenic
900199773 1:1399239-1399261 GGGGCGCCGGCCGCTGCCGCGGG + Exonic
900589850 1:3454699-3454721 GGGCCGGACCGCGCTGCCGCAGG + Exonic
900591148 1:3460563-3460585 GGGCCGTAGACCGCCTACGCTGG + Intronic
900786955 1:4655324-4655346 GAGCCGGAGACCGGCGCCGCGGG + Exonic
901050734 1:6424752-6424774 GGGCCGGAGCCCGCGGACGCCGG - Intergenic
901209925 1:7518939-7518961 GGGCCGGGGGCCCCCTCCCCTGG - Intronic
901833422 1:11907845-11907867 GCGCCTGAGGCCACCACCGCGGG - Intergenic
902053665 1:13583335-13583357 GGGCCAGAGGCGGCCCGCGCTGG - Intergenic
902089585 1:13892878-13892900 GGGCTGGGGGCCGCTGCAGCAGG + Intergenic
902350134 1:15848035-15848057 GTGCCGGCGACCGCCGCTGCTGG - Exonic
902840253 1:19069847-19069869 GGCCCTGAGGCTGCCTCCGCTGG + Intergenic
902917205 1:19645885-19645907 GGGTCGGAGGCTGCCGGAGCGGG + Intronic
903652272 1:24929548-24929570 GGGCGGGAGGGCGCCGGCCCTGG - Intronic
903855637 1:26336451-26336473 GGGGCCGAGGGCGCGGCCGCGGG - Intronic
904252932 1:29237668-29237690 GGCCCCGCGGCCGCCGCCTCGGG + Intronic
904701623 1:32361673-32361695 GGGACGGAGGGCGGGGCCGCGGG + Intronic
904822901 1:33256689-33256711 GGGCAGGCGCCCGCCGCCGCTGG - Intronic
904840143 1:33367373-33367395 GGGCCCGAGGCTGCTGCCGCTGG + Exonic
905416502 1:37808047-37808069 GCGCCGGGGGCCGCCGGAGCGGG + Exonic
906117987 1:43368087-43368109 GGGCCGGAGGCCGGCAGCGCAGG + Intergenic
906295296 1:44645742-44645764 CGGGCGAAGGCCGCCGCAGCAGG - Intronic
906325521 1:44843158-44843180 GGGCCGTGGGCCGCGGCGGCTGG + Intergenic
907501837 1:54886836-54886858 GGGCCGGAGGCGGCGTGCGCGGG - Intronic
908355782 1:63323842-63323864 GCGGCGGCGGCCGGCGCCGCGGG + Exonic
909490244 1:76218319-76218341 GGGCAGGAGGCTGCCTCCTCTGG - Intronic
910788000 1:91021665-91021687 TGAGCGGCGGCCGCCGCCGCGGG - Intronic
912305170 1:108560013-108560035 GCGCTGCAGGCCGCGGCCGCTGG + Intergenic
914428482 1:147599833-147599855 GGGCGGGAGGAGGCCGCGGCGGG + Intronic
915359512 1:155277675-155277697 GGACCTGAGGCCGCGGTCGCAGG - Exonic
918388766 1:184037060-184037082 GGGCCCCGGGCCGCCGCGGCGGG - Intronic
919916998 1:202144853-202144875 GGGCCAGGGGCCGCACCCGCAGG + Intergenic
921909080 1:220528284-220528306 GGATCGGGCGCCGCCGCCGCTGG + Intronic
923141465 1:231163747-231163769 GGCCCGGAGGCTGCCTCGGCGGG - Exonic
923181979 1:231528608-231528630 GGAGGGGAGGCCGTCGCCGCTGG - Intergenic
923496711 1:234531740-234531762 GGCCAGGAGGCCGTCGCCGTGGG + Intergenic
923505219 1:234599980-234600002 GGGCCCGAGTGCGCCGCCGCCGG - Intergenic
924527354 1:244864063-244864085 GAGCAGGAGGCCGCGGCCGGCGG - Exonic
1064354391 10:14604290-14604312 GGGCCGCTGGGCGCCGCCGCGGG - Intronic
1064553116 10:16521722-16521744 GTGCCCGCCGCCGCCGCCGCTGG - Exonic
1065023084 10:21516867-21516889 GCGGCGGCGGCGGCCGCCGCGGG - Exonic
1067087633 10:43251242-43251264 GGGCCCCAGGCGGCTGCCGCTGG - Intronic
1067472954 10:46549422-46549444 GGGCCGGAGGGGGCCACTGCGGG - Exonic
1069913492 10:71773482-71773504 GGGCGGGACGCGGCCGGCGCGGG + Exonic
1070327595 10:75398819-75398841 GTGCCGGTGCCCGCCGCCACCGG - Exonic
1071643882 10:87342426-87342448 GGGGCGGAGGCGGCGGCGGCCGG + Intergenic
1071695459 10:87864173-87864195 GCTCCGGAGGCCGCCGGCGGAGG + Exonic
1071835733 10:89415228-89415250 GGGTCCGCGGCCGCCGCCTCCGG + Intronic
1071966593 10:90858109-90858131 CGGCCGGAGGCGGCGGCGGCGGG - Intergenic
1071997655 10:91163262-91163284 GGGCCGGTGGGCGGCGCGGCCGG + Intronic
1072151787 10:92690005-92690027 GGGCCGGCGGCGGGCGCCGTGGG + Exonic
1072625041 10:97105878-97105900 GGTCCGGAGGCCTCCGCCAAGGG + Intronic
1072701006 10:97641187-97641209 GGGGTGGGGACCGCCGCCGCGGG + Intronic
1074546380 10:114404660-114404682 GGGCCGGAGTTCTCCGGCGCTGG - Intronic
1075430237 10:122374539-122374561 CGCGCCGAGGCCGCCGCCGCTGG + Intergenic
1075629408 10:123991961-123991983 GTTCCCGAGGCCGCCGTCGCCGG - Intergenic
1075698030 10:124449957-124449979 GGGCCGGCGGTCGGCGGCGCGGG + Exonic
1076595430 10:131622232-131622254 GGGTCGGAGGTGGCCGCTGCTGG + Intergenic
1077090761 11:777281-777303 GCGCCGGAGGCCGAGGCCGCTGG - Intronic
1077253756 11:1571814-1571836 GGGGCGGAGGGCGCCGCGTCGGG - Intronic
1077253919 11:1572281-1572303 GGGGCGGAGGGCGGGGCCGCCGG + Intergenic
1081538574 11:44013891-44013913 GGGCAGGAGGGCGCCTCTGCAGG - Intergenic
1081700054 11:45147032-45147054 GGTCCGGACGGCGCCGGCGCGGG + Intronic
1083448511 11:62726998-62727020 GGGCCCGGCCCCGCCGCCGCCGG + Exonic
1083617622 11:64034549-64034571 TAGCCTGAGGCCGCCGCCTCTGG - Intronic
1085514793 11:77105883-77105905 GGGCAGGAGGCCGCCTCCTCTGG - Intronic
1088868983 11:113875534-113875556 GGGCCGGCGGCGGCTGCGGCGGG - Exonic
1089525594 11:119094735-119094757 GGGCCCGAGGCCGACGCGGCAGG + Exonic
1089814196 11:121158004-121158026 GGTGCGGAAGACGCCGCCGCCGG - Exonic
1091169153 11:133505275-133505297 GGGCCGGAGGCCTCCTGGGCAGG + Intronic
1093958661 12:25250500-25250522 AGGCTGGAGGCGGTCGCCGCTGG - Intronic
1095581577 12:43806286-43806308 GGGCCGCCGGCCGGGGCCGCTGG - Intronic
1096024680 12:48350751-48350773 GGGCCGGAGGGAGCTGCGGCTGG - Exonic
1096157080 12:49346727-49346749 TGGGCGGCGGCGGCCGCCGCTGG - Intergenic
1096241285 12:49961665-49961687 GGGCCGGCGGCTGCCCCGGCCGG + Intergenic
1097057479 12:56258471-56258493 GGGGCGGAGGGCGCTGCGGCCGG - Intergenic
1100830940 12:98516099-98516121 GGCTCTGGGGCCGCCGCCGCGGG + Exonic
1101605809 12:106247318-106247340 GGTCCGGAGGCCGCAGTCGATGG + Intronic
1102853861 12:116277232-116277254 GGCCGGGCCGCCGCCGCCGCCGG + Exonic
1103563522 12:121804425-121804447 GGGCCGGAGTCCGCGTCCTCCGG + Intronic
1103595504 12:122022423-122022445 GGCCCGGAGGCGGCGGGCGCCGG + Intronic
1104891902 12:132144220-132144242 GGGCCGGAGGGCGCGGAGGCCGG - Exonic
1105064023 12:133181396-133181418 TGGCCGGAGCCCTCCGGCGCGGG + Intronic
1105492613 13:20902945-20902967 GGGGCGGGGGCGGCCGCAGCCGG + Intronic
1106712838 13:32356754-32356776 GGGCCAGAGGCTGCCACTGCAGG - Intronic
1111951278 13:94711391-94711413 GCAGCGGCGGCCGCCGCCGCCGG - Exonic
1113906690 13:113822546-113822568 GGCTGGGAGGCCGCCACCGCAGG - Intronic
1114452761 14:22837631-22837653 GGGCCTGAAGGCGCCGACGCGGG - Intronic
1116886951 14:50231371-50231393 GGGCGGGAGGCGGCGGCCGCCGG - Exonic
1117141150 14:52791796-52791818 GGTCCGGCGGCCACCGCCCCAGG - Intergenic
1117424496 14:55580457-55580479 GGGCGGGGGGGCGCGGCCGCGGG + Intronic
1118186595 14:63543373-63543395 GCGCCGGAGGCGGGCGCTGCTGG - Exonic
1121111473 14:91316038-91316060 CCGCCTGAGGCCGCCACCGCTGG + Intronic
1121461331 14:94080992-94081014 GGGCCGGCGGCCGCCCTCTCTGG + Intronic
1121546959 14:94769803-94769825 GGCCGGGAGGCCCGCGCCGCCGG + Exonic
1122523540 14:102363400-102363422 GGGCCGGGGGCCGAGGGCGCGGG - Intronic
1122602703 14:102929489-102929511 GGGCCGGAGGGCGCTGTGGCAGG - Exonic
1122889048 14:104724218-104724240 GGCCAGGAGCCCGCCGCCGCCGG - Intronic
1122904501 14:104795581-104795603 GGGCTGGAGGCCGCGGCGGGCGG + Intronic
1123216491 14:106813398-106813420 GCGCCTGAGGCCGCAGCCCCCGG - Intergenic
1123783130 15:23646067-23646089 GGGCCAGCGGGCGGCGCCGCGGG + Exonic
1124109272 15:26772305-26772327 GGGCCGGAGGCCTCTTCGGCCGG - Intronic
1124340388 15:28886310-28886332 CGGCCCCAGGCTGCCGCCGCCGG - Intronic
1125301035 15:38253092-38253114 GGGCAGGAGGCAGCGGCGGCCGG - Exonic
1125685132 15:41559360-41559382 CTCCCGGAGTCCGCCGCCGCAGG + Exonic
1125717455 15:41827429-41827451 GGGCCCGCCCCCGCCGCCGCGGG - Exonic
1127753483 15:62068140-62068162 GCGCAGGAGGCGGCAGCCGCGGG - Exonic
1127995566 15:64151683-64151705 GGGGCGGAGCCGGCCGCCCCGGG + Intergenic
1128160986 15:65422830-65422852 GGGACGCCGGCCGCGGCCGCGGG - Exonic
1128455185 15:67827963-67827985 GGGGCGGGGGCTGCCGCCGTCGG - Intronic
1129440605 15:75578685-75578707 GGGCCCGAGGCCGCCGCGTTGGG - Intronic
1131096066 15:89655061-89655083 GGGCTGGAGGCGGCGGGCGCGGG + Intronic
1131399579 15:92113682-92113704 GGGCCGGAGGCTGCCCCATCTGG + Intronic
1132464817 16:72551-72573 GGGGAGGAGGCTGCCGCCGCTGG + Exonic
1132601648 16:775566-775588 GGGCCTGAGGCCTCCGCAGAGGG - Intronic
1132925968 16:2429314-2429336 GGGCCGGCGGCGGCCCCCCCGGG + Intergenic
1132926093 16:2429719-2429741 GGGCCGGAAAACGTCGCCGCGGG - Intronic
1133116846 16:3582368-3582390 GGGCAGGAGGCGGCAGCCTCGGG - Exonic
1133240522 16:4411766-4411788 GGGCCCGCGGCCGCTGCAGCTGG + Intronic
1135335780 16:21599857-21599879 GGGCCGGCGGCGGCCGCGGGCGG + Exonic
1136141617 16:28292462-28292484 GAGCCGGAGGGCGGAGCCGCGGG + Intergenic
1136550478 16:30979980-30980002 GGGGCGGAGGGCGGCGGCGCCGG - Exonic
1137412932 16:48244637-48244659 GCGCCGCCCGCCGCCGCCGCGGG - Intronic
1137426620 16:48385541-48385563 CGGCCGGCGGCGGCCTCCGCGGG + Intronic
1137614561 16:49838910-49838932 GGTCCCGGGGCCGCCCCCGCGGG + Intronic
1138023269 16:53503280-53503302 GGGGCGGAGCCCGCTGCCGAGGG - Intronic
1138619197 16:58198041-58198063 CGGCCGGTGGCTGCCGCTGCCGG - Intergenic
1139410008 16:66751521-66751543 TCGCCGGCGGCCGCCACCGCGGG + Exonic
1139534293 16:67562232-67562254 TGGGCGGAGGCCGCCGCCCCTGG - Intergenic
1139569251 16:67800381-67800403 TGTCAGGAGGCCTCCGCCGCTGG + Intronic
1140078466 16:71723405-71723427 GGCCCGGAGGCCGGCTCCGGAGG - Intronic
1140223267 16:73058755-73058777 GGGCGGGAGGCGGCCGCAGCCGG + Intronic
1141137019 16:81473102-81473124 GGGCAGGAGGCAGGGGCCGCAGG - Intronic
1141538526 16:84700156-84700178 GGGCGGGCGGACGCCGCGGCGGG + Intronic
1141697759 16:85628155-85628177 GGGGCGGGGGCCGCAGCAGCCGG - Intronic
1141840044 16:86568293-86568315 GGCCTGGAGGCCGGGGCCGCCGG + Exonic
1142246165 16:88971019-88971041 GTGCCGGAGGCCGACGCGGTGGG + Intronic
1142283040 16:89159472-89159494 TGGGCGGAGGGCGCTGCCGCAGG + Intergenic
1142513152 17:410511-410533 GAGCGGGAGGGCGGCGCCGCGGG + Exonic
1142598344 17:1040292-1040314 GGGCCGGAGCCCGCCAGGGCAGG - Intronic
1143117106 17:4587293-4587315 GGGCCTGAGGCAGCTGCCGCTGG + Intronic
1143390434 17:6556461-6556483 GGGCCGGAGGCGGTCGGGGCCGG - Exonic
1143697178 17:8629890-8629912 GGGTCGGACTCCGCCGGCGCCGG - Intronic
1146052885 17:29567051-29567073 GGGCCCTGGGCAGCCGCCGCCGG - Exonic
1146058604 17:29593234-29593256 GGCCCCGGGGACGCCGCCGCAGG - Intronic
1146256083 17:31392102-31392124 GGGAGGGAGGCCACCGCCTCGGG - Intronic
1146723907 17:35142218-35142240 GGGGCGGGGGGCGTCGCCGCGGG - Intronic
1147183614 17:38702241-38702263 GGGCCCTAGGCGGCTGCCGCCGG - Intergenic
1147602686 17:41755777-41755799 GGGCCTGAGGCCGTCGCTGTAGG + Exonic
1148558921 17:48594893-48594915 CGGCCAGAGACCGCCGCAGCTGG + Intronic
1148664119 17:49361963-49361985 CGGCTGCAGGCCCCCGCCGCAGG - Intronic
1148807887 17:50273360-50273382 GTGCTGGAGGCGGCGGCCGCAGG + Intronic
1149610581 17:57955497-57955519 GGGCCCGGGGGCGCCGCAGCCGG - Intergenic
1149849324 17:60026021-60026043 GGGGCGGCGGCGGCCGGCGCTGG - Intergenic
1149860844 17:60120503-60120525 GGGGCGGCGGCGGCCGGCGCTGG + Intergenic
1150423193 17:65056650-65056672 GTGCCGGAGCCGCCCGCCGCCGG - Exonic
1150549067 17:66192201-66192223 GCGCCGGTGGTCGCCGCCGCCGG - Intergenic
1150791939 17:68205907-68205929 TAGCCGGAGGAAGCCGCCGCTGG + Intergenic
1151662407 17:75525764-75525786 GGGCCGGCGGCGGGCGCCGAGGG + Exonic
1152197262 17:78925105-78925127 GGGCGGGCGGGGGCCGCCGCTGG + Exonic
1152208865 17:78992261-78992283 GGGCCGGAGGGTGCCGGCTCTGG - Exonic
1152238067 17:79148759-79148781 GGGAGGGAGGCCGACCCCGCCGG + Intronic
1152433117 17:80260538-80260560 GGGCCGGCGGCGGCGGCGGCGGG + Intergenic
1152433130 17:80260568-80260590 GGGCCGGCGGCGGCGGCGGCGGG + Intergenic
1152433143 17:80260598-80260620 GGGCCGGCGGCGGCGGCGGCGGG + Intergenic
1152433156 17:80260628-80260650 GGGCCGGCGGCGGCGGCGGCGGG + Intergenic
1152433169 17:80260658-80260680 GGGCCGGCGGCGGCGGCGGCGGG + Intergenic
1152433182 17:80260688-80260710 GGGCCGGCGGCGGCGGCGGCGGG + Intergenic
1152433195 17:80260718-80260740 GGGCCGGCGGCGGCGGCGGCGGG + Intergenic
1152433208 17:80260748-80260770 GGGCCGGCGGCGGCGGCGGCGGG + Intergenic
1152433221 17:80260778-80260800 GGGCCGGCGGCGGCGGCGGCGGG + Intergenic
1152433234 17:80260808-80260830 GGGCCGGCGGCGGCGGCGGCGGG + Intergenic
1152516244 17:80826504-80826526 GGGCCGGAGGCCCTGGCTGCTGG - Intronic
1152571365 17:81122658-81122680 GGGCCCCACGCCGCCCCCGCCGG + Exonic
1152689593 17:81712065-81712087 GGGCCGAAGGCCACCGCCCGGGG - Intergenic
1152852965 17:82648418-82648440 GGCGCTGAGGCCGCCGCGGCCGG + Exonic
1152870692 17:82751720-82751742 GGGCCGGGGGCCGCCAGGGCGGG - Intergenic
1154490323 18:14917127-14917149 GGGCCGGAGGACGCAGCCAGGGG - Intergenic
1154954608 18:21242167-21242189 GAGGCGGCGGCCGCCGCAGCCGG - Intergenic
1155257913 18:24014645-24014667 GGGCGTCCGGCCGCCGCCGCGGG - Exonic
1157248260 18:46072086-46072108 GGGCGGGAGGCCAACGCGGCGGG - Intronic
1157279155 18:46334390-46334412 GGGGCGGGGGCGGGCGCCGCGGG + Intronic
1157384034 18:47247412-47247434 GGGGCAGGGGCCGCGGCCGCCGG - Intronic
1160204620 18:76822669-76822691 GGGCGCGAGGGCGCGGCCGCGGG - Intronic
1160631203 18:80247409-80247431 GGGCCTGGGGGCGCCGCCCCCGG - Exonic
1160668468 19:344586-344608 CGGCCGGGGGCGGCCGCCGATGG + Intronic
1160767026 19:813247-813269 GCGCGCGGGGCCGCCGCCGCTGG - Exonic
1160927885 19:1555795-1555817 GGGGCGCAGGCGGCGGCCGCGGG + Exonic
1161168341 19:2800580-2800602 TGGCCGGAGGCCTCCGCAGGTGG + Intronic
1161215786 19:3094531-3094553 GGGCCGGTGGCCGAGGCCGGAGG + Exonic
1161438726 19:4279093-4279115 GGGGCCGAGGCCGCGGCAGCTGG - Exonic
1161628594 19:5340236-5340258 GGGCCGGGCGCCGCCGGGGCCGG + Intronic
1161703060 19:5805316-5805338 GGGCCGGAGGGGGCGGCCGCGGG - Intergenic
1162019924 19:7863724-7863746 AGTCAGGAGGCCGCAGCCGCGGG + Intronic
1162312413 19:9914743-9914765 GGCCCAGCGGCTGCCGCCGCCGG - Intronic
1162396590 19:10420860-10420882 GGGTCCGAGGCTGCCGCCACAGG - Exonic
1162481411 19:10928961-10928983 GGGTGGGTGGCCGCCGCGGCCGG + Intronic
1162744281 19:12790154-12790176 TGGCTGGAGGCTGCCGCGGCTGG + Intronic
1163138755 19:15332300-15332322 AGGCCGCACGCCGCCCCCGCCGG + Intronic
1163551171 19:17967155-17967177 GGGCCGGGGGCGGCGGCGGCAGG - Intronic
1163586949 19:18169339-18169361 GCGCCGGAGGCTGCGGCGGCGGG + Exonic
1163612458 19:18308534-18308556 GGGCCAGAGGCCAGCGCTGCAGG + Intronic
1163667858 19:18611611-18611633 GGGCTGGAGGCCCTCGCCGCCGG + Intronic
1165058731 19:33194749-33194771 GGGCAGGAGGCGGCGCCCGCGGG + Exonic
1165472056 19:36009538-36009560 GGGGCGGAGGCCGAGGCTGCAGG + Exonic
1166543277 19:43619557-43619579 GGAGCGGGGGCCGCCGGCGCCGG - Exonic
1166869734 19:45864164-45864186 GCGCCGGGGGCCGCAGCCCCAGG - Intronic
1168297348 19:55383871-55383893 TGGTCGGCGCCCGCCGCCGCGGG - Exonic
1168339254 19:55614210-55614232 GGGTCGCAGGCCGCCGCCGCGGG - Exonic
925189481 2:1871332-1871354 TGGCTGGAAGCCGCCGCTGCTGG + Intronic
925609487 2:5691917-5691939 CGGGCGGAGGCCGCCGTCTCAGG + Intergenic
926131011 2:10303104-10303126 GGGCCCGCTGCAGCCGCCGCCGG + Intronic
927558164 2:24050123-24050145 GGGCCGCAGACCCCCGCCTCCGG - Intronic
927567255 2:24123732-24123754 GGGCCGGGGGCCTCCCGCGCAGG - Intronic
929188669 2:39120650-39120672 GTGCGGGATGCCGCCGCCTCCGG - Intronic
930700945 2:54457088-54457110 GGGCGCGGGGCCGCCGCCTCCGG - Intronic
931348843 2:61470863-61470885 GGGCCGGCGGTCCCCGCAGCGGG + Intergenic
931671610 2:64653482-64653504 GGGCCGGGCGCCGCCGCGGGAGG - Intronic
934488146 2:94737316-94737338 CGGCTGGAGGGCGCCACCGCGGG - Intergenic
934655921 2:96116776-96116798 GGGCCGGAGACCCCGGCCGCCGG - Intergenic
935265160 2:101387421-101387443 CGGCCGGCGGCCGGCGCGGCCGG - Exonic
935645311 2:105329624-105329646 GGGACGGCGGGCGCCGGCGCCGG - Exonic
936038320 2:109129640-109129662 CGGGCGGCGGCCACCGCCGCGGG + Exonic
938063827 2:128270574-128270596 GGGCCCGAGGCGGCCGGGGCAGG + Intronic
938727296 2:134120154-134120176 GCGCCCGGGGCCGCCGCCGCGGG - Intronic
938796012 2:134718838-134718860 GGGCCGGGGGCGGCAGCCGGTGG + Exonic
941111044 2:161418780-161418802 GGGCTGCAGGCTGCCTCCGCCGG + Intronic
942965794 2:181891698-181891720 GGGGCGTGGGCCGCCGCCGAGGG + Intergenic
944412849 2:199459319-199459341 CTGCCGGCGGCCGCGGCCGCGGG - Intronic
944632567 2:201642638-201642660 GGGCCGGCGGCCGCCGAGGCCGG - Intronic
944664965 2:201952258-201952280 GGGAAGGAGGCAGCCGCTGCTGG + Intergenic
945033068 2:205682798-205682820 CGGGCGGAGGCAGCCGCCGCCGG - Exonic
946339182 2:219057389-219057411 GGGCCCGGGGCCGGGGCCGCAGG - Intronic
946966577 2:225042771-225042793 GGGCGGGGGGCGGCCGCCGAGGG + Intergenic
947518652 2:230828186-230828208 GGGCGGGAGACCTCAGCCGCGGG + Intergenic
947724135 2:232387076-232387098 GCGCCGCAGCCAGCCGCCGCAGG + Intergenic
948910303 2:240999242-240999264 GGGGCGGGGGCGGCAGCCGCCGG + Intronic
1169914354 20:10672122-10672144 GGGCCGGGGGCGGCCGCCGCAGG - Intronic
1171023506 20:21608212-21608234 CAGCCGGAGGCCGCCGGCTCAGG - Intergenic
1172277172 20:33686092-33686114 GGGCCGGCGGCGGGCGCCGCGGG + Exonic
1172284648 20:33732149-33732171 GGGGCGGAGGGCGCCGGGGCTGG + Intronic
1172320961 20:33994533-33994555 GAGCCGGAAGCAGCCGCGGCCGG - Intronic
1172587265 20:36093469-36093491 GGTCCAGGCGCCGCCGCCGCTGG + Intronic
1172752061 20:37258117-37258139 GGGACAGAGCCCGCCTCCGCTGG + Intronic
1173594042 20:44247523-44247545 GGGCCGGGAGCCGCCTGCGCCGG + Intronic
1174174517 20:48636429-48636451 GGGCGGGAGGGCGGCCCCGCTGG - Intronic
1174390905 20:50217743-50217765 GGACCACAGGCCGCCGCCTCAGG + Intergenic
1174467953 20:50731750-50731772 CGGCCGGAGGAGGCCGTCGCGGG + Exonic
1175199282 20:57266703-57266725 AGGTGGGAGGCCGCCGGCGCGGG - Intergenic
1175847228 20:62065344-62065366 GGGCCCGAGCCCGCCCCCGCCGG - Exonic
1175847314 20:62065569-62065591 GGGCCGGCCGCCCCCGCCGAGGG - Exonic
1175992461 20:62796572-62796594 GGGCTGGTGGCCGCCTCCCCCGG - Exonic
1176118872 20:63445293-63445315 GGGCCGCAGGCTGCTGCTGCCGG - Exonic
1176162166 20:63653465-63653487 GGGCGGGAGGCGGGCGCGGCGGG + Intergenic
1176550021 21:8217023-8217045 GGGCCGGCGGCGGCCGCCGCGGG + Intergenic
1176550023 21:8217026-8217048 GGCCCCGCGGCGGCCGCCGCCGG - Intergenic
1176550278 21:8217880-8217902 GGGCCGGCGGACCCCGCCCCGGG - Intergenic
1176569206 21:8400918-8400940 GGGCCGGCGGACCCCGCCCCGGG - Intergenic
1176577120 21:8445150-8445172 GGGCCGGCGGACCCCGCCCCGGG - Intergenic
1178327929 21:31660152-31660174 GGTCCTTGGGCCGCCGCCGCGGG + Intronic
1178334672 21:31732286-31732308 GCGGCGGCGGCCGCGGCCGCGGG + Intergenic
1178872083 21:36385505-36385527 GGGCCAGAGGCCCTCGCCGAGGG + Intronic
1179511823 21:41878816-41878838 GGCCCCGCGGCCCCCGCCGCCGG - Exonic
1179529598 21:42009805-42009827 GGGCCGGCGGCCCGGGCCGCGGG - Intronic
1180005394 21:45018448-45018470 GGGCCAGAGGCGGTCGCGGCGGG + Intergenic
1180041893 21:45284329-45284351 GGGCCTGAGGCCACAGCTGCGGG + Intronic
1180087842 21:45516026-45516048 GGGCCGGGGGCTGCCGCGGGTGG + Exonic
1180151577 21:45950844-45950866 GAGCCGGAGGCGGCCGCTGCGGG - Intergenic
1180160789 21:45997913-45997935 GAGCCAGAGGCCGCCTCGGCAGG + Intronic
1180650233 22:17370354-17370376 GGGCGGGAGTCGGCCGCGGCCGG + Intronic
1180871704 22:19150293-19150315 GGCCGGGGCGCCGCCGCCGCGGG + Intergenic
1180910630 22:19447576-19447598 GGGGCGTAGGGCGCGGCCGCCGG - Intronic
1181934591 22:26429513-26429535 GGGCGGGAGGGCGGCGCGGCTGG + Intronic
1182295734 22:29310551-29310573 GGGCCTGGGGCCGCCCCAGCGGG + Intronic
1182903943 22:33920713-33920735 AGGCGGGCGGCCCCCGCCGCCGG + Intronic
1183665154 22:39242587-39242609 GGGCCGCAGGCCGCCCGCCCGGG - Intronic
1184759436 22:46536554-46536576 GCGCTGGAGGCCGCCACCGCGGG - Exonic
1184759567 22:46537033-46537055 GGGCCGGAGGGCGAAGGCGCGGG + Exonic
1185241494 22:49749847-49749869 GGGATGGAGGCTGCAGCCGCAGG - Intergenic
1185248677 22:49787638-49787660 ACCGCGGAGGCCGCCGCCGCCGG + Intronic
1203254911 22_KI270733v1_random:133349-133371 GGGCCGGCGGCGGCCGCCGCGGG + Intergenic
1203254913 22_KI270733v1_random:133352-133374 GGCCCCGCGGCGGCCGCCGCCGG - Intergenic
1203255173 22_KI270733v1_random:134218-134240 GGGCCGGCGGACCCCGCCCCGGG - Intergenic
1203262967 22_KI270733v1_random:178428-178450 GGGCCGGCGGCGGCCGCCGCGGG + Intergenic
1203262969 22_KI270733v1_random:178431-178453 GGCCCCGCGGCGGCCGCCGCCGG - Intergenic
1203263229 22_KI270733v1_random:179297-179319 GGGCCGGCGGACCCCGCCCCGGG - Intergenic
949987521 3:9552694-9552716 GGGCCGGCGGCGGCGGCGGCTGG + Exonic
956178919 3:66500301-66500323 GAGCCGGTGACCGCCGCGGCCGG - Exonic
959587716 3:108040679-108040701 GGGCTGGAGGCAGCCGCCACAGG + Intergenic
961333499 3:126156601-126156623 GGGCCGGAGCCCACAGCTGCAGG - Intronic
961545365 3:127629374-127629396 GGGCCAGAGTGCGGCGCCGCCGG + Intronic
961929370 3:130517095-130517117 GGGCCCGGGGCCGCCGGGGCGGG + Intergenic
966372128 3:179261321-179261343 GTGCCGGAGCCCCCCCCCGCGGG + Intronic
966886284 3:184379759-184379781 GGCCCGGAGCCCCCCGCTGCTGG - Intronic
967904103 3:194486800-194486822 CGGCTGCACGCCGCCGCCGCGGG - Intronic
968199463 3:196739969-196739991 GCGCAGGACTCCGCCGCCGCTGG + Exonic
968225215 3:196968828-196968850 GAGACTGGGGCCGCCGCCGCCGG + Exonic
968511361 4:997305-997327 GGGGCGGAGGCCGGGCCCGCTGG - Intronic
968910052 4:3473006-3473028 GGGCAGGAGGCCACAGCCACCGG + Intronic
968933923 4:3600098-3600120 AGGCGGGAGGCCGCCGGCGGTGG + Intergenic
970205752 4:13654274-13654296 GCGCCGGAGGACACCGCAGCTGG + Intergenic
971019075 4:22516115-22516137 GGGGCGGGGGCGGCCGCCGGCGG - Intergenic
972245854 4:37244841-37244863 GGGCAGGAGACCGCCGCGACAGG + Exonic
973293470 4:48491177-48491199 GGACGGGAGGCGGCCGTCGCGGG + Exonic
975666790 4:76741084-76741106 GAGGCGGAGGCCGACGCCTCGGG - Exonic
975666939 4:76741694-76741716 TCGCCGGTGGCCGCCGCCTCGGG + Exonic
975779055 4:77819917-77819939 GGCCCCGCGGCCGCGGCCGCCGG + Intergenic
975779057 4:77819920-77819942 GCGCCGGCGGCCGCGGCCGCGGG - Intergenic
976569803 4:86594697-86594719 GGGCCGCCGGCAGCCGCCGCGGG - Exonic
983238709 4:165207708-165207730 GCCGCGGGGGCCGCCGCCGCAGG + Intronic
983398495 4:167233915-167233937 GAGGCGGGGGCCGCGGCCGCCGG - Intronic
984714968 4:182917185-182917207 GGGCCTGGGGCCGCGGACGCTGG - Intronic
984778664 4:183505120-183505142 GGGCCCGCGGCGGCCGCGGCCGG + Exonic
984888579 4:184473026-184473048 GGGCCGGCGTCCGCCGGGGCTGG - Intronic
985754673 5:1706246-1706268 GGGTCGGGGGCCTCCTCCGCGGG + Intergenic
987912757 5:24170160-24170182 GGGGCGGAGCCCGCTGCCGAGGG + Intronic
988816446 5:34839269-34839291 GGTCAGGAGGCCGACGCAGCGGG + Intronic
991063637 5:62403731-62403753 GGGCCATCGGCCGCCGCCGCGGG - Exonic
995512391 5:112922045-112922067 TGGCCGGGGGTCGCCGCCGCTGG - Intronic
995764597 5:115602058-115602080 AGGGCGGGGGCCGCCGCCGGGGG - Intronic
996978290 5:129460361-129460383 GGGCGAGAAGCCGCGGCCGCGGG + Exonic
1001401932 5:171451062-171451084 GGGCGGGAGGCGGCCGGCGGCGG - Intronic
1001506490 5:172284061-172284083 GGTGCGGAGGGCGGCGCCGCGGG - Exonic
1002424565 5:179167554-179167576 AGCCTGGAGGCCGCCTCCGCTGG + Intronic
1002541213 5:179907660-179907682 GGGCCTGTGGGCGCCGCGGCTGG - Intronic
1002895562 6:1378316-1378338 CGCCCGGCGGCCGCCGCTGCCGG + Intergenic
1004044617 6:12012216-12012238 CGGGCGGGGGCCGCAGCCGCCGG - Intronic
1005596187 6:27381194-27381216 GGTCCCGAGGCCTGCGCCGCGGG + Intronic
1007625365 6:43243562-43243584 GGTCGGAAGGCCGCCGCCGCCGG + Intergenic
1007701923 6:43770803-43770825 GGGCCGGAGCCCGCGCCCGGAGG + Exonic
1008160393 6:48068874-48068896 GGGCGGGCGGCGGGCGCCGCGGG + Intergenic
1010244868 6:73653727-73653749 GGCCCAGAGACCGCCGCCCCCGG + Intronic
1013155734 6:107490048-107490070 GGGCCGGGGGCCGGCGCGGGAGG - Exonic
1017146601 6:151240642-151240664 GGCCGAGGGGCCGCCGCCGCTGG - Exonic
1018686415 6:166307784-166307806 GGGACGGGGACCACCGCCGCGGG - Exonic
1019587025 7:1810676-1810698 GCGGCGGAGGCCGCCCCGGCGGG - Intergenic
1019614840 7:1954518-1954540 GGGCAGGAGGCCGTGGCTGCAGG + Intronic
1019629811 7:2042944-2042966 GGGCCAGAGGACGCTGCCACAGG + Intronic
1020278289 7:6637464-6637486 GGGCCGGTGGGCGGCGGCGCGGG + Intronic
1020445400 7:8262219-8262241 CGGCTGGTGGCGGCCGCCGCAGG - Exonic
1020713315 7:11636504-11636526 GTGCTGGAGCCCGCTGCCGCAGG + Exonic
1022207607 7:28179783-28179805 GGGCCGGCGGCCGCGGGCGGGGG - Intronic
1022207612 7:28179789-28179811 GGGCCGGGGCCGGCGGCCGCGGG - Intronic
1022207976 7:28180839-28180861 GGGGGGAAGGCCGCCGCAGCTGG + Intergenic
1022363375 7:29685054-29685076 GGGCCGGAGGCCGCCGCCGCGGG - Intergenic
1022396177 7:29989641-29989663 AGCCCGGAGCCCGCCGCCCCAGG - Intronic
1022698007 7:32728685-32728707 GGCCGGGGGGCCGCCGCCGCGGG + Intergenic
1023638419 7:42236481-42236503 GCCGCGGGGGCCGCCGCCGCTGG - Intronic
1023846492 7:44123741-44123763 GGCTCGCAGGCCGGCGCCGCGGG + Intronic
1025089740 7:56052058-56052080 GGACTGGAGCCCGCCGCCTCGGG + Intronic
1025941426 7:66078332-66078354 GGGGCGGAGGCTGCCTCTGCAGG + Intronic
1026000466 7:66556698-66556720 GGGCAGGACGCCGCCTCGGCGGG - Intergenic
1026360869 7:69599738-69599760 GGGCTGGGGGCCGGCGCGGCCGG + Exonic
1026740523 7:72975932-72975954 GGCTCGGAGGCCGCCTCCTCTGG - Intergenic
1026797822 7:73377417-73377439 GGCTCGGAGGCCGCCGCCTCCGG - Intergenic
1026990200 7:74580766-74580788 GGGCAGGAGGTCGCTGCTGCGGG + Intronic
1027103209 7:75389139-75389161 GGCTCGGAGGCCGCCTCCTCTGG + Intergenic
1029110523 7:98211295-98211317 GGGCGGGAGGCCGGCGCCTGGGG - Intergenic
1029524237 7:101085504-101085526 GGCCTGGAGGCCGCCGTTGCTGG - Exonic
1029640471 7:101816559-101816581 GGGCGGGCGGGCGCCACCGCCGG - Intronic
1030780439 7:113593553-113593575 GGTCCGGAGGCCTGCCCCGCGGG - Intergenic
1032344437 7:131106169-131106191 GGGCCGGCGTTCCCCGCCGCGGG - Intergenic
1034147359 7:148884622-148884644 GGCCCGGAGCCCGCCGCGGACGG + Intergenic
1034223083 7:149460437-149460459 GGGCCGGGGGCCGCCGTTGAGGG - Intronic
1034284321 7:149874237-149874259 GAGCAGGAAGCCGCCGCCCCGGG - Intronic
1034418982 7:150979188-150979210 TGGGCCGTGGCCGCCGCCGCAGG - Intergenic
1034678809 7:152912100-152912122 GGGCAGGAGGCCGCTGCAGAGGG + Intergenic
1035266379 7:157692244-157692266 GGGCCGGGAGCGGGCGCCGCGGG - Intronic
1035431978 7:158829375-158829397 GGCCCGGAGGCGGGCGCCGGCGG - Exonic
1036910626 8:12754871-12754893 CGGCCAGAGGCGGCGGCCGCGGG + Exonic
1037825217 8:22156567-22156589 GGGGCGGGGGCCGCGGCCGCCGG - Exonic
1038761089 8:30384674-30384696 GGGCTGGGGGCTGCAGCCGCTGG - Exonic
1040055915 8:43056607-43056629 GGGCCGGAAGCGCGCGCCGCGGG - Intronic
1041355240 8:56993413-56993435 GGGCCCGCGGCCGCGGCCGATGG - Exonic
1047393726 8:124475036-124475058 GGGCCCGGGGCCGCGGCCGGGGG - Exonic
1049011400 8:139890032-139890054 AGGACGGAGGCCGCCGCCCCGGG + Intronic
1049405405 8:142449961-142449983 GGGCCGGGGGCGGCGGCGGCTGG + Exonic
1049406176 8:142452746-142452768 GGGGCGGAGGACGCCGCAGGAGG - Intronic
1049585410 8:143430512-143430534 GGGCGGGGGGGCGCCGGCGCGGG + Intergenic
1049621059 8:143598532-143598554 GGGCAGGGGGCCGGCGCCGGAGG - Exonic
1049693714 8:143973619-143973641 GGGGCCGGGGCCGCCGCGGCCGG + Intronic
1049762201 8:144336655-144336677 GGGCCCGGCGCCGCCGCCCCCGG - Intergenic
1051287364 9:15510700-15510722 GGGGCCGAGGCTGCAGCCGCTGG - Intronic
1052494965 9:29213647-29213669 TGGCCGGGGGCCGCGGGCGCAGG - Intergenic
1053240062 9:36487788-36487810 GGGCGGGAGGGCGGCGCCGAGGG + Intergenic
1053409139 9:37904260-37904282 TGGCCGCAGGCCGCCGCGGCGGG + Intronic
1053919441 9:42973289-42973311 GGGCTGGAGGGCGCCGCCGCGGG + Intergenic
1054380778 9:64487069-64487091 TGGCTGGAGGGCGCCGCCGCGGG + Intergenic
1054514969 9:66029242-66029264 TGGCTGGAGGGCGCCGCCGCGGG - Intergenic
1056799474 9:89681371-89681393 GGGGCGGGGGCGGCCGCCGGGGG - Intergenic
1057881530 9:98796304-98796326 GGGCCCGGGGCCGCAGCGGCGGG - Exonic
1060139889 9:121201249-121201271 CGGCCGCAGCCCGCCCCCGCAGG - Intronic
1061489940 9:130939236-130939258 GGCCCCGAGGGCGCCCCCGCCGG + Intronic
1061540778 9:131277086-131277108 GGGGCGGGGGCCACCGCCTCCGG - Intergenic
1062476076 9:136728154-136728176 GCGCCGGAGGCTGCCGTGGCGGG - Intergenic
1062491675 9:136807979-136808001 GCGCCGGAGGCCGCGGGGGCCGG + Exonic
1062596472 9:137302083-137302105 GGGCCGGGGGTCGCCGCCGCGGG + Exonic
1062626038 9:137441841-137441863 GGTCCCGGGGCCGCCGCCGTCGG + Intergenic
1202800347 9_KI270719v1_random:170002-170024 GGGGCGCAGGGCGCCGGCGCAGG + Intergenic
1203471571 Un_GL000220v1:117355-117377 GGGCCGGCGGACCCCGCCCCGGG - Intergenic
1203479392 Un_GL000220v1:161327-161349 GGGCCGGCGGACCCCGCCCCGGG - Intergenic
1196442264 X:115728100-115728122 GGGCCGGTGCCCGCCGCTGCTGG - Intergenic
1196445613 X:115844720-115844742 GCGCCGGTGCCCGCCGCTGCTGG + Intergenic
1196446284 X:115847701-115847723 GCGCCGGTGCCCGCCGCTGCTGG + Intergenic
1196446955 X:115850682-115850704 GCGCCGGTGCCCGCCGCTGCTGG + Intergenic
1196447624 X:115853665-115853687 GCGCCGGTGCCCGCCGCTGCTGG + Intergenic
1196448294 X:115856644-115856666 GCGCCGGTGCCCGCCGCTGCTGG + Intergenic
1196448963 X:115859635-115859657 GCGCCGGTGCCCGCCGCTGCTGG + Intergenic
1196449634 X:115862626-115862648 GCGCCGGTGCCCGCCGCTGCTGG + Intergenic
1196450303 X:115865609-115865631 GCGCCGGTGCCCGCCGCTGCTGG + Intergenic
1196450973 X:115868594-115868616 GCGCCGGTGCCCGCCGCTGCTGG + Intergenic
1196451644 X:115871573-115871595 GCGCCGGTGCCCGCCGCTGCTGG + Intergenic
1196452315 X:115874560-115874582 GCGCCGGTGCCCGCCGCTGCTGG + Intergenic
1196452985 X:115877529-115877551 GCGCCGGTGCCCGCCGCTGCTGG + Intergenic
1196453655 X:115880522-115880544 GCGCCGGTGCCCGCCGCTGCTGG + Intergenic
1196454324 X:115883531-115883553 GCGCCGGTGCCCGCCGCTGCTGG + Intergenic
1197745975 X:129932411-129932433 GGGCCGCGGGGCGCGGCCGCGGG - Intergenic
1197980978 X:132217856-132217878 GAGGCGGCGGCCGGCGCCGCAGG - Intronic
1199699106 X:150363467-150363489 GGGCGGGCGGCCGCCGGCGCGGG - Exonic
1199760028 X:150898400-150898422 CGGCCGGTGGCAGCCACCGCAGG + Intronic
1200292618 X:154886840-154886862 GGCCAGCCGGCCGCCGCCGCCGG + Exonic
1200339462 X:155382580-155382602 GGCCAGCCGGCCGCCGCCGCCGG + Exonic
1200347008 X:155458113-155458135 GGCCAGCCGGCCGCCGCCGCCGG - Exonic
1200786317 Y:7263748-7263770 GGGGCTGAGGCAGCCGCAGCGGG + Intergenic