ID: 1022365409

View in Genome Browser
Species Human (GRCh38)
Location 7:29709901-29709923
Sequence GTGATAGCTGAGATGGAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022365402_1022365409 18 Left 1022365402 7:29709860-29709882 CCAGAATTTGAAAAATAAACAGT No data
Right 1022365409 7:29709901-29709923 GTGATAGCTGAGATGGAACAGGG No data
1022365401_1022365409 24 Left 1022365401 7:29709854-29709876 CCATGTCCAGAATTTGAAAAATA No data
Right 1022365409 7:29709901-29709923 GTGATAGCTGAGATGGAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022365409 Original CRISPR GTGATAGCTGAGATGGAACA GGG Intergenic
No off target data available for this crispr