ID: 1022376283

View in Genome Browser
Species Human (GRCh38)
Location 7:29814518-29814540
Sequence ATGTGCTTGTCGAAGGCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 112}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022376283 Original CRISPR ATGTGCTTGTCGAAGGCTGG GGG Intronic
901922998 1:12549281-12549303 GTGTGTTTGGCGAAGGCGGGCGG - Intergenic
909548084 1:76868838-76868860 AGGTGCCGTTCGAAGGCTGGAGG + Intronic
912577875 1:110691986-110692008 ATGTGCAGGTCAAAGTCTGGAGG + Intergenic
914009591 1:143765225-143765247 AGGGGCTTGTAGAAGGGTGGAGG + Intergenic
918627231 1:186670144-186670166 TGGGGCTTGTCGAAGGGTGGGGG + Intergenic
918975316 1:191476368-191476390 AGGGGCTTGTCGGAGGGTGGAGG + Intergenic
919702374 1:200643908-200643930 ATGTGCTTGTGGAACTGTGGGGG + Intronic
924300806 1:242635986-242636008 ATGTAAATGTCGAAGTCTGGGGG - Intergenic
1064816817 10:19274800-19274822 AGGTGCTTGCCGAGAGCTGGGGG + Intronic
1065785593 10:29211009-29211031 ATGTGATTGTCAAGGGCTGCTGG + Intergenic
1068303228 10:55173347-55173369 ATGTGTATGTAGAAGGATGGGGG + Intronic
1071805186 10:89111731-89111753 TGGTGCTTGCCAAAGGCTGGGGG - Intergenic
1073320941 10:102615979-102616001 CTGGGCTTGTCGGTGGCTGGGGG - Intronic
1074597394 10:114880182-114880204 TTGGGCTTGCCTAAGGCTGGGGG + Intronic
1074856479 10:117477693-117477715 ATGGGGTTGGCAAAGGCTGGGGG + Intergenic
1081536893 11:44002886-44002908 ATGGCCTTGTCCAGGGCTGGAGG + Intergenic
1081748521 11:45489866-45489888 ATGTGTTTGTCAAAAGCAGGTGG + Intergenic
1084147897 11:67274805-67274827 ATGTCCTTGACGGTGGCTGGTGG + Intronic
1086984950 11:93237665-93237687 CTGTGCTTGTCCCATGCTGGGGG - Intergenic
1087745027 11:101934108-101934130 ATGTGCTTGAAGACAGCTGGAGG - Intronic
1088904671 11:114145614-114145636 ATGTGGTTGCCAAAGGCTGGGGG + Intronic
1092991687 12:13909089-13909111 ATGAGCTTGTGGAAGGCAGAAGG - Intronic
1100731314 12:97473373-97473395 GTGTGTGTTTCGAAGGCTGGGGG + Intergenic
1104357198 12:128097705-128097727 AGGTGGTTGCCGGAGGCTGGGGG + Intergenic
1106386232 13:29288681-29288703 TTGTCTTTGTCTAAGGCTGGAGG + Intronic
1107810789 13:44197902-44197924 ATGTGGTTGTAAAAGGCTGGAGG - Intergenic
1109548175 13:63856886-63856908 AGGTGGTTGTCAGAGGCTGGTGG - Intergenic
1110746765 13:79063024-79063046 ATATGCTTGGCCAAGGGTGGTGG - Intergenic
1115853553 14:37606132-37606154 AGGTGCTTGAAGAAGTCTGGAGG + Intronic
1116802884 14:49461809-49461831 ATGTGCTTCTGGAAGGCTGAAGG - Intergenic
1117916804 14:60686213-60686235 GGGTGCTTGTCAGAGGCTGGAGG + Intergenic
1118187638 14:63551583-63551605 ATTTGCTTTTTGAATGCTGGAGG + Intergenic
1122150749 14:99724890-99724912 ACGTGCACGTGGAAGGCTGGTGG + Intronic
1122970883 14:105151779-105151801 GAGTGCTTGTGGAAAGCTGGGGG - Intronic
1124194051 15:27605126-27605148 ATGTCCTTGGGGATGGCTGGAGG + Intergenic
1129792670 15:78351978-78352000 TGGTGGTTGTCTAAGGCTGGGGG + Intergenic
1130042656 15:80418165-80418187 ATGTGCTTGTTGAAGAGAGGGGG + Intronic
1130676736 15:85959412-85959434 ATGTTCTTGGAGAAGGATGGTGG + Intergenic
1132672736 16:1108368-1108390 GTGTGCTTGGCGGTGGCTGGAGG - Intergenic
1135262650 16:20994657-20994679 AAGTGGTTGTCAAAGTCTGGAGG - Intronic
1140120852 16:72081950-72081972 ATGTGCTCATCAAAAGCTGGAGG + Intronic
1141679205 16:85534530-85534552 ATGTGGTTGCCACAGGCTGGAGG - Intergenic
1142122649 16:88394646-88394668 GTGAGCTTGTCGAATGCTGGAGG + Intergenic
1146399637 17:32492975-32492997 AGTTGCCTGTCAAAGGCTGGAGG - Exonic
1146458759 17:33027067-33027089 ATGTTCTTTTTGAAGGCTGTAGG + Intronic
1149598740 17:57879656-57879678 ACGTGCATGTGGTAGGCTGGCGG + Exonic
1150314911 17:64160726-64160748 ATCTGCTTCTCAAAGGCTGGAGG + Intronic
1151661006 17:75517903-75517925 AGGGGCTTGTCGCAGGTTGGGGG + Intronic
1151735117 17:75934975-75934997 AAGTGCTTGCCTAAGGTTGGAGG + Intronic
1152517541 17:80834580-80834602 ATGTGCTCCTAAAAGGCTGGGGG - Intronic
1154316483 18:13308107-13308129 ATGGGCTTGATGAAGGGTGGAGG - Intronic
1155378723 18:25192370-25192392 ATGTGCTGGTCTCAGGCTGTTGG - Intronic
1156314423 18:35953898-35953920 AGGTGGTTGCCAAAGGCTGGGGG + Intergenic
1156585516 18:38426935-38426957 ATCTGGTTGTTGAAGGCTTGGGG + Intergenic
1160288847 18:77572023-77572045 ATGTGCATGTAGAAGGATGGAGG + Intergenic
1162777570 19:12989228-12989250 GTGTGCGTATGGAAGGCTGGGGG + Intergenic
1162777576 19:12989256-12989278 GTGTGCGTATGGAAGGCTGGGGG + Intergenic
1162777596 19:12989372-12989394 GTGTGCGTATGGAAGGCTGGGGG + Intergenic
1166573147 19:43812009-43812031 ATGTGCTTGTGGTCAGCTGGAGG + Intronic
1166744787 19:45136467-45136489 ATGGGCTTGTCCATGGCTTGGGG + Intronic
931288151 2:60849798-60849820 ATGTCCTTGTGGAAGGCAGAGGG + Intergenic
931649594 2:64455237-64455259 GTGTGCATGTGGAAGGCTGCTGG + Intronic
933070451 2:77850855-77850877 ATATGCTTGTGGGAGGCTGGGGG + Intergenic
934527056 2:95058547-95058569 AGGTGTGTGTCGAAGGCTGGGGG + Intergenic
934696161 2:96402115-96402137 ATGTGGTTGCCAGAGGCTGGAGG + Intergenic
935276233 2:101477246-101477268 AGGTCCTTGTCAATGGCTGGGGG + Intergenic
936023103 2:109010326-109010348 GTGTGGGTGTTGAAGGCTGGGGG - Intergenic
936253689 2:110889506-110889528 TTGTTCTTGTCTAAGGCTGCAGG - Intronic
937040357 2:118815983-118816005 ATGAGCTTGACCAAGGCAGGTGG - Intergenic
937614521 2:123905721-123905743 TTGTGCTAGTCGAAGTCTTGAGG - Intergenic
945476674 2:210291059-210291081 ATGTGCTTGACAAAAGCTGTAGG + Exonic
1169466375 20:5844452-5844474 ATGTGTTTGGGGATGGCTGGAGG + Intronic
1170586112 20:17735388-17735410 ATGTGCTTGTCAAAGTTTGAAGG + Intronic
1171260264 20:23725844-23725866 ATGTGATGGGCAAAGGCTGGAGG - Intergenic
1173336845 20:42118960-42118982 TTGTGCTTGACAAATGCTGGAGG + Intronic
1179106318 21:38403797-38403819 CTGTGCTTGTGGAAGGCAGCTGG - Intronic
1182350088 22:29694524-29694546 ATGTGCAAGGGGAAGGCTGGTGG - Intronic
1183243860 22:36678594-36678616 ATGTGCTGGGGGAAGGATGGAGG - Intronic
1183682496 22:39341285-39341307 ATGGGTTTCTGGAAGGCTGGTGG - Intergenic
951562164 3:23979727-23979749 ATGTGCTTGTAATAGGCTGCTGG - Exonic
952909304 3:38168363-38168385 TTGTGGTTGTCTAAGGCTGGAGG - Intronic
955836510 3:63061389-63061411 ATGAAGTGGTCGAAGGCTGGTGG + Intergenic
961213764 3:125144361-125144383 CAGTGCTTGTCCAAGGCTGCAGG + Intronic
962348110 3:134636588-134636610 ATGTGCTTGTTGTCAGCTGGTGG - Intronic
963026563 3:140924880-140924902 TTGTGCTTGTTCAAGGCAGGAGG + Intergenic
965310745 3:167124875-167124897 TGGTGCTTGTCGGAGGGTGGGGG + Intergenic
966669143 3:182507209-182507231 ATGGGCTTGTGGAAGGTTTGGGG + Intergenic
969980833 4:11152385-11152407 AAGGCCTTGTCAAAGGCTGGAGG - Intergenic
978896585 4:113895753-113895775 AATTGTTGGTCGAAGGCTGGGGG + Intergenic
980788417 4:137585326-137585348 ATATGCTTGTGGGAGGATGGGGG - Intergenic
989475171 5:41866774-41866796 ATGTTCTTCTCCAATGCTGGAGG + Intronic
990968356 5:61474989-61475011 ATGTGCTTTTGGAGGGCTGAAGG - Intronic
991161934 5:63513267-63513289 AGGGGCCTGTCGAGGGCTGGGGG + Intergenic
993349495 5:86830755-86830777 TGGTGGTTGTCGAAGGTTGGGGG + Intergenic
995735317 5:115294773-115294795 ATGTGCGTGTGGTATGCTGGGGG + Intronic
999283149 5:150378142-150378164 ATGTGTTTGAGGAATGCTGGGGG + Intronic
1000314708 5:160078573-160078595 CTGTGCTAGTAGAAGGCTGTTGG - Intronic
1001018340 5:168161889-168161911 ATGTGCTCGGGGAAGGGTGGTGG - Intronic
1002289059 5:178187367-178187389 CTGTGCTCGGGGAAGGCTGGCGG - Intergenic
1002308291 5:178297122-178297144 ATGTGAATGTCTAAGGCTGAAGG - Intronic
1003490813 6:6619975-6619997 ATGAGTATGTGGAAGGCTGGTGG + Intronic
1005951724 6:30636665-30636687 ATGTGCTTGTTGGGGGGTGGGGG + Intronic
1006836067 6:36999451-36999473 GTGTGCTTGACTGAGGCTGGAGG + Intergenic
1007370109 6:41421229-41421251 ATGTGTTTGGGGAAGGCAGGTGG + Intergenic
1018184606 6:161255697-161255719 TTGTGGTTGTCTAGGGCTGGAGG + Intronic
1019729845 7:2623742-2623764 CCGTGCTTGTCCTAGGCTGGGGG + Intergenic
1022376283 7:29814518-29814540 ATGTGCTTGTCGAAGGCTGGGGG + Intronic
1023834611 7:44060828-44060850 AGGTGATCGACGAAGGCTGGTGG + Exonic
1028959911 7:96737141-96737163 ATGTGTTTGTGGCTGGCTGGGGG - Intergenic
1036761195 8:11509566-11509588 CTGTGGTTGTCTAAGCCTGGGGG + Intronic
1048637639 8:136315499-136315521 ATGTGATTGTCTAAGAATGGTGG - Intergenic
1048704015 8:137129791-137129813 TAGTGGTTGTCCAAGGCTGGGGG + Intergenic
1053652873 9:40187084-40187106 ATGTGTGTGTTGAAGGTTGGGGG - Intergenic
1053903278 9:42816392-42816414 ATGTGTGTGTTGAAGGTTGGGGG - Intergenic
1054531708 9:66189137-66189159 ATGTGTGTGTTGAAGGTTGGGGG + Intergenic
1061569860 9:131470579-131470601 AGGTCCCTGTCCAAGGCTGGTGG - Intronic
1203769983 EBV:44955-44977 AGGTGCTTGTGGAAGTCTTGCGG + Intergenic
1185849939 X:3475928-3475950 ATGTGCTTGTCCAGCCCTGGTGG + Intergenic
1189073663 X:37891451-37891473 TAGTGCTTGCCTAAGGCTGGAGG + Intronic
1190062389 X:47219466-47219488 GTGTGCTTGTGGAAGGAGGGCGG + Intronic
1196708850 X:118741793-118741815 ATGTGTTTGTTGCAGGGTGGCGG + Intronic
1200812397 Y:7499574-7499596 ATGTGCTTGTCCAGCCCTGGTGG - Intergenic